How to deal with the microarray results.
|
|
- Shawn Hunt
- 5 years ago
- Views:
Transcription
1 How to deal with the microarray results. Britt Gabrielsson PhD RCEM, Div of metabolism and cardiovascular research Department of Medicine The Sahlgrenska Academy at Göteborg University
2 and then we will perform microarray analysis. Project design DNA microarray technology Data analysis Results/verification Biological/functional relevance Follow-up studies
3 Publications - present to future trends PubMed DNA array + DNA microarray + oligonucleotide array + oligonucleotide microarray
4 Publications - present to future trends PubMed previous search terms AND cancer, clinical or yeast
5 Common microarray work flow Planning Pilot Data analysis Verification Revised planning Extended study Data analysis Story selection Follow up studies
6 Advantages of a pilot study Estimate experimental variability Refine the experimental design Optimize selection of time points or doses Triplicate biological replicates per experimental group in the pilot Possibility to add-on to extend the study Provides preliminary data for project funding
7 From list of genes to biological context Once again; if you have favourite genes which are your main interest - use an alternative method. There will only be a few genes that you already know the function of. If you don t get the genes you love, love the genes you get!!
8 The list of genes mental vertigo
9 Reduced list of genes managable
10 The reductionist s point of view From the list of regulated genes to future projects - identification of genes with a commonality e.g. pathway, biological process, chromosomal region, upstream regulation - verification and extended data mining
11 From list of genes to biological context Aim: to define future possible lines of investigation 1 st screen to get an overview of the data Add own keywords to auto-annotations (e.g. apoptosis, lipid metabolism) Use of overview databases 2 nd screen more detailed information Use of more specialized databases
12 First a word about Gene Ontology The Gene Ontology Consortium ( aims to describe the gene product function in a cell and provides a controlled vocabulary to describe these attributes. The three organizing principles of GO are molecular function, biological process and cellular component. A gene product has one or more molecular functions and is used in one or more biological processes; it might be associated with one or more cellular components.
13 Example; insulin-like growth factor 1 (IGF1) Expressed in most tissues with liver as the main production site Is secreted and has both paracrine and endocrine actions Detected in circulation bound to one of many IGF-binding proteins The main regulators are growth hormone and insulin Acts via the IGF1-receptor dimer or a hybrid composed of IGF1- and insulin receptor monomers Has growth-promoting and metabolic effects
14 Example; IGF1 (insulin-like growth factor 1) defined by GO classification Biological process; 1501 // skeletal development // traceable author statement /// 6260 // DNA replication // traceable author statement /// 6928 // cell motility // traceable author statement /// 7165 // signal transduction // traceable author statement /// 7265 // Ras prot Cellular component; 5615 // extracellular space // inferred from electronic annotation Molecular function; 5159 // insulin-like growth factor receptor binding // traceable author statement /// 5179 // hormone activity // traceable author statement /// 8083 // growth factor activity // inferred from electronic annotation /// // prothoracicotrophic hormone ---
15 1 st screen databases AIM: to get an overview of main functions of the gene products and if possible to add your own key word NCBI: Entrez Gene (OMIM) SwissProt GeneCard
16 NCBI
17 NCBI
18 The importance of knowing the different aliases Example AdipoQ= Adiponectin= APM1= Acrp30= Acdc
19 GeneCard
20 GeneCard
21 ExPASy/Swiss-Prot
22 ExPASy/Swiss-Prot
23 ExPASy/Swiss-Prot
24 For non-reductionists - other resources There are several web-based resources that can used to group regulated genes according to GO classifications i.e. biological processes, molecular function and cellular component. The analysis tests whether the observed number of genes of a GO process differ from the expected number of genes. Examples of such web-sites are FatiGO and GOTree Machine.
25 GO Tree Machine (GOTM)
26 Selecting for possible lines of research What was the question again? Identifying putative susceptibility genes Are there linkage studies to this chromosomal region? Does the Ethical licence allow genomic studies? Identifying biomarkers for diagnostic purposes Limited to secreted proteins Are there assays available? Identifying disease mechanisms How to differentiate pathology from mechanism leading to disease? External influences such as funding or competition in the field
27 The pragmatic view on selecting putative projects General knowledge of the gene/genes Novelty - knowledge of the gene in your field What types of follow-up experiments can be performed (techniques in the lab, collaborators, sample availability). Time/cost/resources
28 2 nd screen databases Aim: To get more detailed knowledge of the gene products of the reduced list NCBI: PubMed, OMIM, Gene Expression Omnibus GeneCard Applied Biosystems: Panther GNF SymAtlas (Tissue distribution) Nucleic Acids Research publishes an update database issue January each year.
29 NCBI PubMed and OMIM
30 NCBI OMIM GENE FUNCTION By RNase protection and Western blot analysis, Schaffler et al. (1999) showed that APM1 is expressed by differentiated adipocytes as a 33-kD protein that is also detectable in serum MOLECULAR GENETICS In 253 nondiabetic Italian subjects, Filippi et al. (2004) found that the 276G-T SNP of the adiponectin gene was associated with higher body mass index (BMI) (p less than 0.01), plasma insulin (p less than 0.02), and homeostasis model assessment-estimated insulin resistance (HOMA-IR) (p less than 0.02) ANIMAL MODEL Maeda et al. (2002) generated mice deficient in adiponectin/acrp30 by targeted disruption. Homozygous mutant mice showed delayed clearance of free fatty acid in plasma, low levels of fatty acid transport protein-1 (FATP1; ) mrna in muscle, high levels of TNF-alpha (191160) mrna in adipose tissue, and high plasma TNF-alpha concentrations
31 GeneCard - a gateway with several links to other sites Chromosomal Location (HGNC and/or Entrez Gene NCBI Genomic Views According to UCSC and Ensembl) Protein info (UniProt/Swiss-Protein, Ensembl) Phenotype (Jackson lab - Mouse Genome Informatics) Ontologies/Pathways (Gene Ontology and KEGG) Transcripts (NCBI, link to Applied Biosystems for assays) Tissue distribution (Affymetrix-based, SAGE)
32 Applied Biosystems (
33 Applied Biosystems (
34 Tissue distribution - GNF SymAtlas Genomics Institute of the Novartis Foundation (
35 Expression databases Large-scale analysis of gene expression has led to a proliferation of databases for storing the vast quantities of expression data. Most are Web-based and are compliant with the MIAME* and the Gene Ontology Consortium. A few examples: Gene Expression Omnibus (GEO NCBI) ArrayExpress (EMBL) Stanford Microarray Database (non-public) Expression Array Manager *Minimum Information About a Microarray Experiment
36 Gene expression omnibus
37 Gene expression omnibus Data download Cluster analysis
38 Follow-up studies Verification of main findings; At transcript level (real-time PCR or Northern blot) At protein level (immunohistochemistry, Western Blot, ELISA/RIA, FACS) Staining and characterizations of cells (tissues) Cell culture/animal studies RNAi/transgenic experiments
39 Summary The importance of asking a precise question i.e. the project design limits the interpretation of the out-put data Initial reduction of data to identify possible future lines of research. Use over-view databases to annotate the regulated genes In view of the present knowledge in your field and possible follow-up studies, select a few putative lines of research. Go back to further data mining and more detailed bioinformatics
40 Final words about working in multidisciplinary collaborations Who has the over-all responsibility? Who performs specific parts of the project? How to report forward and to whom? How to report backward and to whom? Understanding each other/communication Decision making How do we publish?
41 Present to future trends Diagnostics (cancer, identification of biomarkers) Functional studies, the microarray data constitutes a minor part of the article Cross-species comparisons and translational research. Shared transcriptional profiles between species to identify conserved pathways and mechanisms (longevity).
42 Web-sites Information; NCBI (incl Gene, OMIM, PubMed) ExPASy GeneCards TIGR Gene Ontology Panther/Applied Biosystems Affymetrix GNF SymAtlas Nucleic Acids Research db 2006 Data mining of gene expression data; GO Tree Machine FatiGO Databases for expression data; GEO (NCBI) Stanford Microarray Database (SMD) ArrayExpress Expression Array Manager NB there are a number of microarray expression data linked to the publications
Analysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review Visualizing
More informationImportant gene-information's
Sequences, domains and databases. How to gather information on a gene. Jens Bohnekamp, Institute for Biochemistry Important gene-information's Protein sequence Nucleotide sequence Gene structure Protein
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review
More informationImpact of Retinoic acid induced-1 (Rai1) on Regulators of Metabolism and Adipogenesis
Impact of Retinoic acid induced-1 (Rai1) on Regulators of Metabolism and Adipogenesis The mammalian system undergoes ~24 hour cycles known as circadian rhythms that temporally orchestrate metabolism, behavior,
More informationMicroarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison. CodeLink compatible
Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison CodeLink compatible Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood
More informationAnnotation. (Chapter 8)
Annotation (Chapter 8) Genome annotation Genome annotation is the process of attaching biological information to sequences: identify elements on the genome attach biological information to elements store
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationDRAGON DATABASE OF GENES ASSOCIATED WITH PROSTATE CANCER (DDPC) Monique Maqungo
DRAGON DATABASE OF GENES ASSOCIATED WITH PROSTATE CANCER (DDPC) Monique Maqungo South African National Bioinformatics Institute University of the Western Cape RELEVEANCE OF DATA SHARING! Fragmented data
More informationA WEB-BASED TOOL FOR GENOMIC FUNCTIONAL ANNOTATION, STATISTICAL ANALYSIS AND DATA MINING
A WEB-BASED TOOL FOR GENOMIC FUNCTIONAL ANNOTATION, STATISTICAL ANALYSIS AND DATA MINING D. Martucci a, F. Pinciroli a,b, M. Masseroli a a Dipartimento di Bioingegneria, Politecnico di Milano, Milano,
More informationTypes of Databases - By Scope
Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of
More informationRetrieval of gene information at NCBI
Retrieval of gene information at NCBI Some notes 1. http://www.cs.ucf.edu/~xiaoman/fall/ 2. Slides are for presenting the main paper, should minimize the copy and paste from the paper, should write in
More informationMicroarray Informatics
Microarray Informatics Donald Dunbar MSc Seminar 4 th February 2009 Aims To give a biologistʼs view of microarray experiments To explain the technologies involved To describe typical microarray experiments
More informationBioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
More informationBioinformatics for Cell Biologists
Bioinformatics for Cell Biologists 15 19 March 2010 Developmental Biology and Regnerative Medicine (DBRM) Schedule Monday, March 15 09.00 11.00 Introduction to course and Bioinformatics (L1) D224 Helena
More informationMicroarray Data Analysis in GeneSpring GX 11. Month ##, 200X
Microarray Data Analysis in GeneSpring GX 11 Month ##, 200X Agenda Genome Browser GO GSEA Pathway Analysis Network building Find significant pathways Extract relations via NLP Data Visualization Options
More informationGenetics and Bioinformatics
Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s
More informationPATHWAY ANALYSIS. Susan LM Coort, PhD Department of Bioinformatics, Maastricht University. PET course: Toxicogenomics
PATHWAY ANALYSIS Susan LM Coort, PhD Department of Bioinformatics, Maastricht University 1 Data analysis overview Microarray scans Slide based on a slide from J. Pennings, RIVM, NL Image analysis Preprocessing
More informationThis place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.
G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic
More informationLecture 11 Microarrays and Expression Data
Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il Lecture 11 Microarrays and Expression Data Genetic Expression Data Microarray experiments Applications Expression
More informationMARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305
MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305 UNIT-1 MARINE GENOMICS AND PROTEOMICS 1. Define genomics? 2. Scope and functional genomics? 3. What is Genetics? 4. Define functional genomics? 5. What
More informationIngenuity Pathway Analysis (IPA )
Ingenuity Pathway Analysis (IPA ) For the analysis and interpretation of omics data IPA is a web-based software application for the analysis, integration, and interpretation of data derived from omics
More informationMicroarray Informatics
Microarray Informatics Donald Dunbar MSc Seminar 31 st January 2007 Aims To give a biologist s view of microarray experiments To explain the technologies involved To describe typical microarray experiments
More informationUsing 2-way ANOVA to dissect the immune response to hookworm infection in mouse lung
Using 2-way ANOVA to dissect the immune response to hookworm infection in mouse lung Using 2-way ANOVA to dissect the immune response to hookworm infection in mouse lung General microarry data analysis
More informationSeven Keys to Successful Microarray Data Analysis
Seven Keys to Successful Microarray Data Analysis Experiment Design Platform Selection Data Management System Access Differential Expression Biological Significance Data Publication Type of experiment
More informationElixir: European Bioinformatics Research Infrastructure. Rolf Apweiler
Elixir: European Bioinformatics Research Infrastructure Rolf Apweiler EMBL-EBI Service Mission To enable life science research and its translation to medicine, agriculture, the bioindustries and society
More informationEECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science
EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can
More informationMicroarrays & Gene Expression Analysis
Microarrays & Gene Expression Analysis Contents DNA microarray technique Why measure gene expression Clustering algorithms Relation to Cancer SAGE SBH Sequencing By Hybridization DNA Microarrays 1. Developed
More informationGene expression analysis: Introduction to microarrays
Gene expression analysis: Introduction to microarrays Adam Ameur The Linnaeus Centre for Bioinformatics, Uppsala University February 15, 2006 Overview Introduction Part I: How a microarray experiment is
More informationResources Available through the Albert Einstein College of Medicine Nathan Shock Center
Resources Available through the Albert Einstein College of Medicine Nathan Shock Center http://www.einstein.yu.edu/centers/aging/ Available Proteostasis-related plasmids Sent as filter spotted DNA - shrna
More informationGeneWEB Tutorial. Enhancing Biological Research with Gene Networks Bioinformatics Department
GeneWEB Tutorial Enhancing Biological Research with Gene Networks Bioinformatics Department 1 Topics to be Discussed What is GeneWEB and what can it do for me? Gene Network Versus Canonical Pathway Entering
More informationCS 5984: Topics and Schedule
CS 5984: and Schedule T. M. Murali January 19, 2006 T. M. Murali January 19, 2006 CS 5984: and Schedule Continuum of Models in Systems Biology From Building with a scaffold: emerging strategies for high-
More informationBIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis
BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology Lecture 2: Microarray analysis Genome wide measurement of gene transcription using DNA microarray Bruce Alberts, et al., Molecular Biology
More informationBiology 644: Bioinformatics
Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....
More informationDatabasing Expression with Integrative Biochip Informatics
Databasing Expression with Integrative Biochip Informatics Ju Han Kim, M.D., Ph.D., M.S. SNUBiomedical Informatics Seoul Nat t Univ. School of Medicine Databasing Gene Expression Bio-databases Microarray
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationMICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE
MICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE National Center for Biotechnology Information With only a few exceptions, every
More informationGene Network Central (GNC) Pro Tutorial
Gene Network Central (GNC) Pro Tutorial.Enhancing Biological Research with Gene Networks Topics to be Discussed What is GNC Pro and what can it do for me? Gene Network Versus Canonical Pathway Entering
More informationGene-centered resources at NCBI
COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving
More informationDNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT.
DNA/RNA MICROARRAYS This protocol is based on the EDVOTEK protocol DNA/RNA Microarrays. 10 groups of students NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. 1. EXPERIMENT OBJECTIVE The objective of this
More informationGS Analysis of Microarray Data
GS01 0163 Analysis of Microarray Data Keith Baggerly and Brad Broom Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org bmbroom@mdanderson.org 8
More informationData representation for clinical data and metadata
Data representation for clinical data and metadata WP1: Data representation for clinical data and metadata Inconsistent terminology creates barriers to identifying common clinical entities in disparate
More informationGS Analysis of Microarray Data
GS01 0163 Analysis of Microarray Data Keith Baggerly and Brad Broom Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org bmbroom@mdanderson.org 7
More informationComputational Genomics
Computational Genomics Introduction to cell biology, genomics, development, and probability Eric Xing Lecture 1a, January 18, 2007 Reading: Chap. 1, DTM book Introduction to cell biology, functional genomics,
More informationGene expression analysis. Gene expression analysis. Total RNA. Rare and abundant transcripts. Expression levels. Transcriptional output of the genome
Gene expression analysis Gene expression analysis Biology of the transcriptome Observing the transcriptome Computational biology of gene expression sven.nelander@wlab.gu.se Recent examples Transcriptonal
More informationB I O I N F O R M A T I C S
B I O I N F O R M A T I C S Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be SUPPLEMENTARY CHAPTER: DATA BASES AND MINING 1 What
More informationOld EXAM 1 BIO409/509 NAME. Please number your answers and write them on the attached, lined paper.
Old EXAM 1 BIO409/509 NAME Please number your answers and write them on the attached, lined paper. 1) Describe euchromatin and heterochromatin. Which form of chromatin would the insulin gene be found in
More informationMS bioinformatics analysis for proteomics. Protein anotations
MS bioinformatics analysis for proteomics Protein anotations UCO - Córdoba Organized by: ProteoRed, EUPA and Seprot Alberto Medina January, 23rd 2009 Summary Introduction Some issues Software: Fatigo -
More informationPage 1. AMPTask Force on MLS Molecular Pathology Curriculum Dear Molecular Diagnostics Laboratory Manager,
AMPTask Force on MLS Molecular Pathology Curriculum Dear Molecular Diagnostics Laboratory Manager, Recently the Association for Molecular Pathology (AMP) has decided to develop a suggested curriculum in
More informationMeasuring and Understanding Gene Expression
Measuring and Understanding Gene Expression Dr. Lars Eijssen Dept. Of Bioinformatics BiGCaT Sciences programme 2014 Why are genes interesting? TRANSCRIPTION Genome Genomics Transcriptome Transcriptomics
More informationMotivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
More informationCURRICULUM VITAE. Educational Qualification: DEGREE INSTITUTION YEAR PROGRESS. Bharathidasan University Tamil Nadu
CURRICULUM VITAE M.BHARATH VIJAYARAGAVAN Masters in Biomedical sciences Nationality: Indian E-mail: bharathragavan@gmail.com Mobile: 91-9911738539 Sex: Male; Age: 23 Objective: Cell Signaling is an important
More informationOur website:
Biomedical Informatics Summer Internship Program (BMI SIP) The Department of Biomedical Informatics hosts an annual internship program each summer which provides high school, undergraduate, and graduate
More informationFollowing text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005
Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of
More informationIntroduction to Bioinformatics and Gene Expression Technology
Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA
More informationuser s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
More informationWeb-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide.
Page 1 of 24 Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. When and Where---Wednesdays at 1pm-2pmRoom 438 Library Admin Building Beginning September
More informationSNPs - GWAS - eqtls. Sebastian Schmeier
SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association
More informationGene-centered databases and Genome Browsers
COURSE OF BIOINFORMATICS a.a. 2015-2016 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about
More informationGS Analysis of Microarray Data
GS01 0163 Analysis of Microarray Data Keith Baggerly and Kevin Coombes Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org kcoombes@mdanderson.org
More informationGene-centered databases and Genome Browsers
COURSE OF BIOINFORMATICS a.a. 2016-2017 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about
More informationCAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1
CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing
More informationChapter 10 Genetic Engineering: A Revolution in Molecular Biology
Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical
More informationMinimum Information About a Microarray Experiment (MIAME) Successes, Failures, Challenges
Opinion TheScientificWorldJOURNAL (2009) 9, 420 423 TSW Development & Embryology ISSN 1537-744X; DOI 10.1100/tsw.2009.57 Minimum Information About a Microarray Experiment (MIAME) Successes, Failures, Challenges
More informationCytomics in Action: Cytokine Network Cytometry
Cytomics in Action: Cytokine Network Cytometry Jonni S. Moore, Ph.D. Director, Clinical and Research Flow Cytometry and PathBioResource Associate Professor of Pathology & Laboratory Medicine University
More informationuser s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
More informationThe University of California, Santa Cruz (UCSC) Genome Browser
The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,
More information11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11
Proteomics, functional genomics, and systems biology Biosciences 741: Genomics Fall, 2013 Week 11 1 Figure 6.1 The future of genomics Functional Genomics The field of functional genomics represents the
More informationPractice Exam A. Briefly describe how IL-25 treatment might be able to help this responder subgroup of liver cancer patients.
Practice Exam 2007 1. A special JAK-STAT signaling system (JAK5-STAT5) was recently identified in which a gene called TS5 becomes selectively transcribed and expressed in the liver upon induction by a
More informationArrayExpress and Gene Expression Atlas: Mining Functional Genomics data
ArrayExpress and Gene Expression Atlas: Mining Functional Genomics data Functional Genomics Team EBI-EMBL emma@ebi.ac.uk http://www.ebi.ac.uk/~emma/bcn_2012/ Talk structure Why do we need a database for
More informationGenome Informatics. Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, Kiyoko F. Aoki-Kinoshita
Genome Informatics Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, 2008 Kiyoko F. Aoki-Kinoshita Introduction Genome informatics covers the computer- based modeling and data processing
More informationBiomarkers for Delirium
Biomarkers for Delirium Simon T. Dillon, Ph. D. Director of Proteomics BIDMC Genomics, Proteomics, Bioinformatics and Systems Biology Center DF/HCC Proteomics Core Div. of Interdisciplinary Medicine and
More informationUpstream/Downstream Relation Detection of Signaling Molecules using Microarray Data
Vol 1 no 1 2005 Pages 1 5 Upstream/Downstream Relation Detection of Signaling Molecules using Microarray Data Ozgun Babur 1 1 Center for Bioinformatics, Computer Engineering Department, Bilkent University,
More informationTranscriptome Assembly, Functional Annotation (and a few other related thoughts)
Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 23, 2017 Differential Gene Expression Generalized Workflow File Types
More informationBeyond Genomics: Detecting Codes and Signals in the Cellular Transcriptome
Beyond Genomics: Detecting Codes and Signals in the Cellular Transcriptome Brendan J. Frey University of Toronto Purpose of my talk To identify aspects of bioinformatics in which attendees of ISIT may
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationIntroduction to BIOINFORMATICS
Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What
More informationApril transmart v1.2 Case Study for PredicTox
April 2015 transmart v1.2 Case Study for PredicTox Agenda Agenda! What is PredicTox?! Brief transmart overview! Answering scientific questions with transmart s help: A case study maximizing data value!
More information2. Materials and Methods
Identification of cancer-relevant Variations in a Novel Human Genome Sequence Robert Bruggner, Amir Ghazvinian 1, & Lekan Wang 1 CS229 Final Report, Fall 2009 1. Introduction Cancer affects people of all
More informationMolecular Cell Biology - Problem Drill 01: Introduction to Molecular Cell Biology
Molecular Cell Biology - Problem Drill 01: Introduction to Molecular Cell Biology Question No. 1 of 10 1. Which statement describes how an organism is organized from most simple to most complex? Question
More informationNiemann-Pick Type C Disease Gene Variation Database ( )
NPC-db (vs. 1.1) User Manual An introduction to the Niemann-Pick Type C Disease Gene Variation Database ( http://npc.fzk.de ) curated 2007/2008 by Dirk Dolle and Heiko Runz, Institute of Human Genetics,
More informationCodeLink Human Whole Genome Bioarray
CodeLink Human Whole Genome Bioarray 55,000 human gene targets on a single bioarray The CodeLink Human Whole Genome Bioarray comprises one of the most comprehensive coverages of the human genome, as it
More informationTest Bank for Molecular Cell Biology 7th Edition by Lodish
Test Bank for Molecular Cell Biology 7th Edition by Lodish Link download full: http://testbankair.com/download/test-bank-formolecular-cell-biology-7th-edition-by-lodish/ Chapter 5 Molecular Genetic Techniques
More informationWhat is Bioinformatics?
What is Bioinformatics? Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. - NCBI The ultimate goal of the field is
More informationOutline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information
From to Systems Biology Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - What can we learn Limitations Integration of omics - In-class
More informationIdentifying Candidate Informative Genes for Biomarker Prediction of Liver Cancer
Identifying Candidate Informative Genes for Biomarker Prediction of Liver Cancer Nagwan M. Abdel Samee 1, Nahed H. Solouma 2, Mahmoud Elhefnawy 3, Abdalla S. Ahmed 4, Yasser M. Kadah 5 1 Computer Engineering
More informationBCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC
More informationNGS to address ncrna and viruses
NGS to address ncrna and viruses Introduction & TRON Next generation sequencing transcriptomics ncrnas vrna June 30, 2010 John Castle Institute for Translational Oncology and Immunology (TRON) Mainz, Germany
More informationDrosophila White Paper 2003 August 13, 2003
Drosophila White Paper 2003 August 13, 2003 Explanatory Note: The first Drosophila White Paper was written in 1999. Revisions to this document were made in 2000 and the final version was published as the
More informationFrom Proteomics to Systems Biology. Integration of omics - information
From Proteomics to Systems Biology Integration of omics - information Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - data What
More informationINVESTIGATION OF THE BINDING SPECIFICITY OF IGF-IR USING MONOCLONAL ANTIBODIES
INVESTIGATION OF THE BINDING SPECIFICITY OF IGF-IR USING MONOCLONAL ANTIBODIES By Mehrnaz Keyhanfar, Pharm.D. A thesis submitted to the University of Adelaide, South Australia in fulfilment of the requirements
More informationMicroarray Technologies. Julie Støve Bødker cand scient, PhD
Microarray Technologies Julie Støve Bødker cand scient, PhD 2 Microarray Technologies - Outline I. Lecture, ~30 minutes II. Presentation of articles, ~30 minutes 1. Alizadeh et al., 2000: Maria Rodrigo
More informationWELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS)
WELCOME Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) Director, UB Genomics and Bioinformatics Core (GBC) o o o o o o o o o o o o Grow
More informationNetwork System Inference
Network System Inference Francis J. Doyle III University of California, Santa Barbara Douglas Lauffenburger Massachusetts Institute of Technology WTEC Systems Biology Final Workshop March 11, 2005 What
More informationBIMM 143: Introduction to Bioinformatics (Winter 2018)
BIMM 143: Introduction to Bioinformatics (Winter 2018) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bimm143_w18/ DRAFT: 2017-12-02 (20:48:10 PST
More informationEmerging Focus. Nutrigenomics. Department of Nutritional Sciences Faculty of Life Sciences
Emerging Focus Nutrigenomics Emerging Focus Nutrigenomics The Emerging Focus Nutrigenomics A New Research Group at the of the University of Vienna Overview Nutrigenomics is the study of the response of
More informationGene Expression Analysis with Pathway-Centric DNA Microarrays
Gene Expression Analysis with Pathway-Centric DNA Microarrays SuperArray Bioscience Corporation George J. Quellhorst, Jr. Ph.D. Manager, Customer Education Topics to be Covered Introduction to DNA Microarrays
More informationThe Secure Digital Patient Record Repository: Virginia s Approach to HIPAA & Medical Research
The Secure Digital Patient Record Repository: Virginia s Approach to HIPAA & Medical Research William A.Knaus M.D. Evelyn Troup Hobson Professor & Chair Department of Health Evaluation Sciences University
More informationFinal exam: Introduction to Bioinformatics and Genomics DUE: Friday June 29 th at 4:00 pm
Final exam: Introduction to Bioinformatics and Genomics DUE: Friday June 29 th at 4:00 pm Exam description: The purpose of this exam is for you to demonstrate your ability to use the different biomolecular
More information