Databasing Expression with Integrative Biochip Informatics
|
|
- Kristina Andrews
- 6 years ago
- Views:
Transcription
1 Databasing Expression with Integrative Biochip Informatics Ju Han Kim, M.D., Ph.D., M.S. SNUBiomedical Informatics Seoul Nat t Univ. School of Medicine Databasing Gene Expression Bio-databases Microarray basics Do we really need databases for expression? An example for pharmacogenomics approach Public repositories for expression Relational vs. Object Oriented Models OM-MAGEML The reality Integrative biochip informatics, coming soon
2 Bio-databases PIR: bio-sequences in the 60 s by M. Dayhoff NAR review: major 500 bio-databases Primary Secondary -. Standardization Integration Intelligence Paradigm Shift - Clinical Knowledge Management - Clinician-directed Resource-directed Dr. Faughnan Dr. Elson Dr. Abraham Dr. Abraham Dr. Dandy Informatics Dr. Belsky Dr. connelly
3 The Central Dogma of Life DNA RNA Protein
4
5 Bio-databases, what are the problems Heterogeneity: data types and forms Complexity Only loosely connected Noise & quality Level of granularity Curation Is modelling even possible? In-silico experiment is only possible with models Clinical knowledge engineering: 3-D Visualization of Gene Expression Streicher J, et al., Nature Genetics 2000;25:147-52
6 Clinical knowledge engineering: Future queries Database Structure Streicher J, et al., Nature Genetics 2000;25: Biochip basics Bioinformatics pipeline
7 Biochip, Core competency They are the genes! We have the map! Natural measure of quantification. Literally, INFINITE # of states Dynamic series on time & space Don t need to extract bio-molecules. Now systemic perturbations! Streamlining & automation of the process put abstraction barrier Do biology in silico! *********************** *********************** Say NO to lab bench! A Functional Genomics Strategy Interesting Patients Interesting Animals Interesting Cell Lines Make Biochip Appropriate Tissue Appropriate Conditions Extract RNA Hybridize Biochip Access Significance Functional Clustering Data Preprocessing Scan Biochip Biological Validation Post-cluster Analysis & Integration Informatical Validation???
8 Biochip informatics: clustering A 11 A 21 A 31 A 41 A 51 A 61 A 71 A 81 A 91 A 12 A 22 A 32 A 42 A 52 A 62 A 72 A 82 A 92 A 13 A 23 A 33 A 43 A 53 A 63 A 73 A 83 A 93 A 14 A 24 A 34 A 44 A 54 A 64 A 74 A 84 A 94 A 15 A 25 A 35 A 45 A 55 A 65 A 75 A 85 A 95 A 16 A 26 A 36 A 46 A 56 A 66 A 76 A 86 A 96 time Biochip informatics: clustering clustering
9 Hierarchical & Partitional Clustering Clinical relevance of Biochip informatics Dx. Discovery Tx. Px.
10 Really need databases for expression? Standard practice for gene sequences is.. How do we know the data integrity without data? Are authors interpretations sufficient? It s a whole new type of data. Observational vs. experimental Enormous potential for the good of public Where to house the data? In what format? and.. what s next? With a single format for gene expression data, databases should be able to 'talk' to one another and exchange data. The existence of a standard language should also spur development of software tools to query the databases, and to manage and display gene expression data.
11 An example for pharmacogenomics
12 An example for pharmacogenomics Expression data repository projects Public repositories in making: GEO : NCBI GeneX : NCGR ArrayExpress : EBI In-house databases : Stanford, MIT, U. Pennsylvania Organism specific databases: Mouse in Jackson
13
14 Database Model: Relational vs. Object-Oriented (or Frame-based) MIAME Model RAD Model Stanford Microarray Database (SMD) Relational Ontology for samples Gene index for genes Annotation for Exp.
15 ArrayDB
16 MGED participants including Affymetrix Berkeley DDBJ DKFZ EMBL Gene Logic Incyte Max Plank Institute NCBI NCGR NHGRI Sanger Centre Stanford Uni Pennsylvania Uni Washington Whitehead Institute Reporting a Microarray Experiment Experimental Data Image Files Data Files Experimental Description Purpose of Study Experimental Details Standard Needed to Describe Microarray Experiment
17 Goals of a Microarray Data Standard Encapsulate Data and Experiment Description Rationale for Experimental Study Experimental Details Experimental Data Standard Data Access and Exchange Format Upload and Retrieval from Public Repositories Data Exchange Between Portals Widespread Industry Support Microarray Standards MIAME Minimum Information About a Microarray Experiment Experimental Design, Array Design, Hybridization, Samples, Measurements and Normalization MAGE-ML XML Implementation of the MIAME Standard Formed Via Merge of MAML and GEML Standards De Facto Widespread Industry Support
18 Conceptual view of gene expression data.
19 Three parts of gene expression DB Gene annotation may be given as links to gene sequence databases Sample annotation there currently are no public external databases (except the species taxonomy) Gene expression matrix each position contains information characterizing the expression of a particular gene in a particular sample. What are the measurement units for gene expression levels? General principles of MIAME design The recorded information about each experiment should be sufficient to interpret the experiment and should be detailed enough to enable comparisons to similar experiments and permit replication of experiments The information should be structured in a way that enables useful querying as well as automated data analysis and mining
20 MIAME structure I. Array design II. Experiment design 1. Experimental design 2. Samples used, extract preparation and labeling 3. Hybridization procedures and parameters 4. Measurement data and specifications of data processing Microarray Information to be Captured
21 Six components of microarray experiment. Three levels of microarray gene expression data processing.
22 MAGE-OM Framework for Developing MAGE-ML OMG specifications are developed in UML MAGE-OM represents a data driven model of microarray experiments This model can be used to automatically generate an XML DTD UML (Unified Modeling Language) Standard object-oriented design language Methods for showing relationships between data objects Objects are boxes (things) Association between objects are indicated by lines
23 Main Packages Biosequence Quantitation Type ArrayDesign DesignElement Array BioMaterial BioAssay BioAssayData Experiment HigherLevelAnalysis Protocol Description Audit and Security Measurement BioEvent
24
25 Mapping from MAGE-OM to MAGE-ML Generated DTD
26 ArrayDesign 의 Class Diagram MAGE-ML : Microarray Data Exchange Formats Platform for moving data between data generators and shared databases International format to communicate data from DB to third part application Support MIAME compliant data Information Available online Current DTD (Document Type Definition) A few sample data sets
27
28 MAML(Microarray Markup Language) standard / vocabulary communication / msg ontology
29 RDB implementation of MAGEML Web Server XML INTERNET Client XML RDBMS 관계형데이터베이스에서 XML로변환후연결한다. XML이라는 object는데이터베이스와응용프로그램간에데이터교환을위한표준기술의역할을한다. 데이터베이스에직접의존하는부분이적어지며갱신의부담이적어진다. 플랫폼이나기타언어등에제약을받지않고 XML의자원을전세계적으로이용할수있다. Middleware Implementation in Database Client Middleware Database <Overview of data transfer structure> XML File JSP http DOM 을처리하는 Servlet JDBC DATABASE (MySQL)
30 Transforming the cancer center Goals of National Center for Toxicogenomics
31 Minimum information to be recorded about toxicogenomics experiments Experimental design parameters, animal husbandry information or cell line and culture information, exposure parameters, dosing regimen, dose groups, and in-life observations. Microarray data, specifying the number and details of replicate array bioassays associated with particular samples, and including PCR transcript analysis if available. Numerical biological endpoint data, including necropsy weights or cell counts and doubling times, clinical chemistry and enzyme assays, hematology, urinalysis, other. Textual endpoint information such as gross observations, pathology and microscopy findings. ArrayTrack Commercial Tools Public In-house Microarray Database Functional components INTERFACE GeneLib ProteinLib PathwayLib ToxicantLib User
32 Development of a Toxicogenomic Supportive Database: dbzach Lyle D. Burgoon* Department of Pharmacology & Toxicology Institute For Environmental Toxicology and The National Food Safety & Toxicology Center Michigan State University tel: (517) fax: (517) burgoonl@msu.edu Research Program Supported by: National Institutes of Health P42 ES , *T32 ES07255 IBM/Mayo Clinic Collaboration Applied Genomics Data Analysis Genomic data (DNA) GeneChip array data (RNA) Protein data Clinical Data Signs Symptoms Laboratory Radiology Etc. Phase I Databases Genome Proteome Disease Tumors Drugs Optimized, individualized healthcare
33 PsyBase 년서울대학교병원신경정신과에서사용되기시작된국내최초의전자의무기록 PsyBase 1.0.
34
35 Streamlining the process Miniaturization & Streamlining the process Image analysis Array fabrication Cluster analysis Data mining Pathway/network analysis Data management layer clone data Cell data Exp. data Inhouse data Outside data Slide data Hyb. data scan data Integrated biochip informatics CIS Literature and Factual Database mining Integrated biochip informatics Image analysis Array fabrication Cluster analysis Data mining Pathway/network analysis Data management layer Rosetta transcriptomics Ideker, 2001, Science Chemoinformatics clone data Outside data Slide data Cell data Hyb. data Exp. data scan data Inhouse data Communication Ontology
36 Xperanto: Expressionist s Esperanto in XML Xperanto: Expressionist s Esperanto in XML
37 Xperanto: Expressionist s Esperanto in XML Xperanto: Expressionist s Esperanto in XML
38 Xperanto: Expressionist s Esperanto in XML MGED Ontology 1. Input control 2. R-DB construction MAGE-OM Relational DB 인터넷 RDB implementation Translation to/from XML MAGEstk (Java API) DTD or Schema (generated from MAGE-OM) MAGE-ML Data Entry by HTML XML Validation XML Expression Repository 임상정보모델링 Open Source & XML 발현정보모델링 서열정보모델링 MGED Ontology MAGE-OM DTD or Schema (generated from MAGE-OM) XML Validation Relational DB RDB implementation MAGEstk (Java API) Data Entry by HTML MAGE-ML 인터넷 XML Expression Repository
39 Thank you!
Microarray Informatics
Microarray Informatics Donald Dunbar MSc Seminar 31 st January 2007 Aims To give a biologist s view of microarray experiments To explain the technologies involved To describe typical microarray experiments
More informationMinimum Information About a Microarray Experiment (MIAME) Successes, Failures, Challenges
Opinion TheScientificWorldJOURNAL (2009) 9, 420 423 TSW Development & Embryology ISSN 1537-744X; DOI 10.1100/tsw.2009.57 Minimum Information About a Microarray Experiment (MIAME) Successes, Failures, Challenges
More informationMinimum Information About a Microarray Experiment MIAME for Environmental Genomics
Minimum Information About a Microarray Experiment MIAME for Environmental Genomics DRAFT for discussion Based on the MIAME/Tox draft (27th August, 2003). Environmental genomics is a diverse, heterogeneous
More informationMGED Standard implementation: establishing an infrastructure for sharing microarray data "
MGED Standard implementation: establishing an infrastructure for sharing microarray data " Philippe Rocca-Serra Scientific Data Manager Microarray Informatics Team @ EMBL-EBI European Bioinformatics Institute,
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review Visualizing
More informationMicroarray Informatics
Microarray Informatics Donald Dunbar MSc Seminar 4 th February 2009 Aims To give a biologistʼs view of microarray experiments To explain the technologies involved To describe typical microarray experiments
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review
More informationMeasuring and Understanding Gene Expression
Measuring and Understanding Gene Expression Dr. Lars Eijssen Dept. Of Bioinformatics BiGCaT Sciences programme 2014 Why are genes interesting? TRANSCRIPTION Genome Genomics Transcriptome Transcriptomics
More informationWeb-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide.
Page 1 of 24 Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. When and Where---Wednesdays at 1pm-2pmRoom 438 Library Admin Building Beginning September
More informationArrayExpress and Gene Expression Atlas: Mining Functional Genomics data
ArrayExpress and Gene Expression Atlas: Mining Functional Genomics data Functional Genomics Team EBI-EMBL emma@ebi.ac.uk http://www.ebi.ac.uk/~emma/bcn_2012/ Talk structure Why do we need a database for
More informationHow to deal with the microarray results.
How to deal with the microarray results. Britt Gabrielsson PhD RCEM, Div of metabolism and cardiovascular research Department of Medicine The Sahlgrenska Academy at Göteborg University and then we will
More informationMICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE
MICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE National Center for Biotechnology Information With only a few exceptions, every
More informationIntroduction to BIOINFORMATICS
Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What
More informationDeakin Research Online
Deakin Research Online This is the published version: Church, Philip, Goscinski, Andrzej, Wong, Adam and Lefevre, Christophe 2011, Simplifying gene expression microarray comparative analysis., in BIOCOM
More informationThe Open2Dprot Proteomics Project for n-dimensional Protein Expression Data Analysis. The Open2Dprot Project. Introduction
The Open2Dprot Proteomics Project for n-dimensional Protein Expression Data Analysis http://open2dprot.sourceforge.net/ Revised 2-05-2006 * (cf. 2D-LC) Introduction There is a need for integrated proteomics
More informationInformatics I: Data Standards. Jessie Tenenbaum, PhD,
Informatics I: Data Standards Jessie Tenenbaum, PhD, FACMI jessie.tenenbaum@duke.edu @jessiet1023 JDT Intro Division of Translational Biomedical Informatics in B&B Dept. Previous life as Program Manager
More informationInformatics I: Data Standards. Jessie Tenenbaum,
Informatics I: Data Standards Jessie Tenenbaum, PhD @jessiet1023 JDT Intro Division of Translational Biomedical Informatics in B&B Dept. Previous life as Program Manager at Microsoft PhD 2007 in Biomedical
More informationGenetics and Bioinformatics
Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s
More informationPioneering Clinical Omics
Pioneering Clinical Omics Clinical Genomics Strand NGS An analysis tool for data generated by cutting-edge Next Generation Sequencing(NGS) instruments. Strand NGS enables read alignment and analysis of
More informationBiology 644: Bioinformatics
Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....
More informationSeven Keys to Successful Microarray Data Analysis
Seven Keys to Successful Microarray Data Analysis Experiment Design Platform Selection Data Management System Access Differential Expression Biological Significance Data Publication Type of experiment
More informationIntroduction to Bioinformatics and Gene Expression Technology
Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA
More informationEngineering Genetic Circuits
Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
More informationA WEB-BASED TOOL FOR GENOMIC FUNCTIONAL ANNOTATION, STATISTICAL ANALYSIS AND DATA MINING
A WEB-BASED TOOL FOR GENOMIC FUNCTIONAL ANNOTATION, STATISTICAL ANALYSIS AND DATA MINING D. Martucci a, F. Pinciroli a,b, M. Masseroli a a Dipartimento di Bioingegneria, Politecnico di Milano, Milano,
More informationIntroduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics
Introduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics abedi777@ymail.com Outlines Technology Basic concepts Data analysis Printed Microarrays In Situ-Synthesized
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Dortmund, 16.-20.07.2007 Lectures: Sven Rahmann Exercises: Udo Feldkamp, Michael Wurst 1 Goals of this course Learn about Software tools Databases Methods (Algorithms) in
More informationGenomes contain all of the information needed for an organism to grow and survive.
Section 3: Genomes contain all of the information needed for an organism to grow and survive. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the components of the
More informationHenning Hermjakob Proteomics Services Team European Bioinformatics Institute. From Integrating Standards to Integrating Data: BioMAP and MIBBI
Henning Hermjakob Proteomics Services Team European Bioinformatics Institute From Integrating Standards to Integrating Data: BioMAP and MIBBI BioMAP Background CacinoGenomics (EU IP) project EU directives
More informationFollowing text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005
Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationOverview of Health Informatics. ITI BMI-Dept
Overview of Health Informatics ITI BMI-Dept Fellowship Week 5 Overview of Health Informatics ITI, BMI-Dept Day 10 7/5/2010 2 Agenda 1-Bioinformatics Definitions 2-System Biology 3-Bioinformatics vs Computational
More informationWhat is Bioinformatics?
What is Bioinformatics? Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. - NCBI The ultimate goal of the field is
More informationAbstract. comment reviews reports deposited research refereed research interactions information
http://genomebiology.com/2002/3/9/research/0046.1 Research Design and implementation of microarray gene expression markup language (MAGE-ML) Paul T Spellman 1, Michael Miller 2, Jason Stewart 3, Charles
More informationData Types in Bioinformatics
Data Types in Bioinformatics Patient diagnostics Karyotypes Fluorescent In Situ Hybridization Polymorphisms Microarrays, from pictures to interpretation Genetic sequence, from raw trace files to base-calls
More informationApplied Bioinformatics
Applied Bioinformatics Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Course overview What is bioinformatics Data driven science: the creation and advancement
More informationComputational Challenges of Medical Genomics
Talk at the VSC User Workshop Neusiedl am See, 27 February 2012 [cbock@cemm.oeaw.ac.at] http://medical-epigenomics.org (lab) http://www.cemm.oeaw.ac.at (institute) Introducing myself to Vienna s scientific
More informationExamination Assignments
Bioinformatics Institute of India H-109, Ground Floor, Sector-63, Noida-201307, UP. INDIA Tel.: 0120-4320801 / 02, M. 09818473366, 09810535368 Email: info@bii.in, Website: www.bii.in INDUSTRY PROGRAM IN
More informationChina National Grid --- BioNode. Jun Wang Beijing Genomics Institute
China National Grid --- BioNode Jun Wang Beijing Genomics Institute Core of life science and bio-tech: Getting, Mining, Applying the basic life information Old China meets New China? Sequencing, sequencing,
More informationIntroduction to Microarray Analysis
Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray
More informationMicroarrays & Gene Expression Analysis
Microarrays & Gene Expression Analysis Contents DNA microarray technique Why measure gene expression Clustering algorithms Relation to Cancer SAGE SBH Sequencing By Hybridization DNA Microarrays 1. Developed
More informationAccess to Information from Molecular Biology and Genome Research
Future Needs for Research Infrastructures in Biomedical Sciences Access to Information from Molecular Biology and Genome Research DG Research: Brussels March 2005 User Community for this information is
More informationELE4120 Bioinformatics. Tutorial 5
ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar
More informationNLM Funded Research Projects Involving Text Mining/NLP
NLM Funded Research Projects Involving Text Mining/NLP Jane Ye, PhD Program Officer Division of Extramural Programs 2017 BioCreative VI Workshop Funding Stakeholders Panel 1 NLM Grant Programs in Biomedical
More informationLecture 11 Microarrays and Expression Data
Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il Lecture 11 Microarrays and Expression Data Genetic Expression Data Microarray experiments Applications Expression
More informationearray 5.0 Create your own Custom Microarray Design
earray 5.0 Create your own Custom Microarray Design http://earray.chem.agilent.com earray 5.x Overview Session Summary Session Summary Agilent Genomics Microarray Solution earray Functional Overview Gene
More informationCAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1
CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing
More informationLabOptimize LIMS. Laboratory Tracking Platform
LabOptimize LIMS Laboratory Tracking Platform BioSoft Integrators offers a comprehensive solution to address tracking, process security, analysis and reporting of data with flexibility, scalability and
More informationBayer Pharma s High Tech Platform integrates technology experts worldwide establishing one of the leading drug discovery research platforms
Bayer Pharma s High Tech Platform integrates technology experts worldwide establishing one of the leading drug discovery research platforms Genomics Bioinformatics HTS Combinatorial chemistry Protein drugs
More informationEuropean Genome phenome Archive at the European Bioinformatics Institute. Helen Parkinson Head of Molecular Archives
European Genome phenome Archive at the European Bioinformatics Institute Helen Parkinson Head of Molecular Archives What is EMBL-EBI? International, non-profit research institute Part of the European Molecular
More informationFrom Proteomics to Systems Biology. Integration of omics - information
From Proteomics to Systems Biology Integration of omics - information Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - data What
More informationThe University of California, Santa Cruz (UCSC) Genome Browser
The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,
More informationProduct Applications for the Sequence Analysis Collection
Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a
More informationMicroarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison. CodeLink compatible
Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison CodeLink compatible Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood
More informationMotivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
More informationIntroduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
More informationCAPTURE-BASED APPROACH FOR COMPREHENSIVE DETECTION OF IMPORTANT ALTERATIONS
CAPTURE-BASE APPROACH FOR COMPREHENSIVE ETECTION OF IMPORTANT ALTERATIONS SEQUENCE MUTATIONS MICROSATELLITE INSTABILITY AMPLIFICATIONS GENOMIC REARRANGEMENTS For Research Use Only. Not for iagnostic Purposes.
More informationMaximizing opportunities towards achieving clinical success D R U G D I S C O V E R Y. Report Price Publication date
F o r a c l e a r e r m a r k e t p e r s p e c t i v e Early Stage Drug Safety Strategies & Risk Management Maximizing opportunities towards achieving clinical success D R U G D I S C O V E R Y Report
More informationThis place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.
G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic
More informationLARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES
1 LARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES Ezekiel Adebiyi, PhD Professor and Head, Covenant University Bioinformatics Research and CU NIH H3AbioNet node Covenant University,
More informationThe knowledge-driven exploration of integrated biomedical knowledge sources facilitates the generation of new hypotheses
The knowledge-driven exploration of integrated biomedical knowledge sources facilitates the generation of new hypotheses Vinh Nguyen 1, Olivier Bodenreider 2, Todd Minning 3, and Amit Sheth 1 1 Kno.e.sis
More informationCapabilities & Services
Capabilities & Services Accelerating Research & Development Table of Contents Introduction to DHMRI 3 Services and Capabilites: Genomics 4 Proteomics & Protein Characterization 5 Metabolomics 6 In Vitro
More information6. GENE EXPRESSION ANALYSIS MICROARRAYS
6. GENE EXPRESSION ANALYSIS MICROARRAYS BIOINFORMATICS COURSE MTAT.03.239 16.10.2013 GENE EXPRESSION ANALYSIS MICROARRAYS Slides adapted from Konstantin Tretyakov s 2011/2012 and Priit Adlers 2010/2011
More informationBioinformatics Analysis of Nano-based Omics Data
Bioinformatics Analysis of Nano-based Omics Data Penny Nymark, Pekka Kohonen, Vesa Hongisto and Roland Grafström Hands-on Workshop on Nano Safety Assessment, 29 th September, 2016, National Technical University
More informationBIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis
BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology Lecture 2: Microarray analysis Genome wide measurement of gene transcription using DNA microarray Bruce Alberts, et al., Molecular Biology
More informationMicrobial Metabolism Systems Microbiology
1 Microbial Metabolism Systems Microbiology Ching-Tsan Huang ( 黃慶璨 ) Office: Agronomy Hall, Room 111 Tel: (02) 33664454 E-mail: cthuang@ntu.edu.tw MIT OCW Systems Microbiology aims to integrate basic biological
More informationPhilippe Hupé 1,2. The R User Conference 2009 Rennes
A suite of R packages for the analysis of DNA copy number microarray experiments Application in cancerology Philippe Hupé 1,2 1 UMR144 Institut Curie, CNRS 2 U900 Institut Curie, INSERM, Mines Paris Tech
More informationComparative Analysis using the Illumina DASL assay with FFPE tissue. Wendell Jones, PhD Vice President, Statistics and Bioinformatics
TM Comparative Analysis using the Illumina DASL assay with FFPE tissue Wendell Jones, PhD Vice President, Statistics and Bioinformatics Background EA has examined several protocol assay possibilities for
More informationInformation Driven Biomedicine. Prof. Santosh K. Mishra Executive Director, BII CIAPR IV Shanghai, May
Information Driven Biomedicine Prof. Santosh K. Mishra Executive Director, BII CIAPR IV Shanghai, May 21 2004 What/How RNA Complexity of Data Information The Genetic Code DNA RNA Proteins Pathways Complexity
More informationOverview. General. RNA & Microarrays. Information Systems in the Life Sciences
Overview Information Systems in the Life Sciences PERP GeneChip data warehouse; Implementation of a dynamic time series query tool with graphical interface General PERP GeneChip data warehouse Affymetrix
More informationGene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis
Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods
More informationOutline. Array platform considerations: Comparison between the technologies available in microarrays
Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of
More informationBasics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility
2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,
More informationClinical and Research Questions
Health Record: The Next Leap Forward John Glaser, PhD Vice President and CIO Partners HealthCare May 8, 2008 Clinical and Research Questions Research Why do some patients with asthma respond to steroid
More informationData representation for clinical data and metadata
Data representation for clinical data and metadata WP1: Data representation for clinical data and metadata Inconsistent terminology creates barriers to identifying common clinical entities in disparate
More informationRosetta Biosoftware and GeneGo working together Resolver system/metacore workflow
Systems Reconstruction TM Technology Systems Biology for Drug Discovery Rosetta Biosoftware and GeneGo working together Resolver system/metacore workflow Workflow Overview User uploads gene expression
More informationDNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT.
DNA/RNA MICROARRAYS This protocol is based on the EDVOTEK protocol DNA/RNA Microarrays. 10 groups of students NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. 1. EXPERIMENT OBJECTIVE The objective of this
More informationUsing 2-way ANOVA to dissect the immune response to hookworm infection in mouse lung
Using 2-way ANOVA to dissect the immune response to hookworm infection in mouse lung Using 2-way ANOVA to dissect the immune response to hookworm infection in mouse lung General microarry data analysis
More informationB I O I N F O R M A T I C S
B I O I N F O R M A T I C S Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be SUPPLEMENTARY CHAPTER: DATA BASES AND MINING 1 What
More informationVALLIAMMAI ENGINEERING COLLEGE
VALLIAMMAI ENGINEERING COLLEGE SRM Nagar, Kattankulathur 603 203 DEPARTMENT OF COMPUTER SCIENCE AND ENGINEERING QUESTION BANK VII SEMESTER BM6005 BIO INFORMATICS Regulation 2013 Academic Year 2018-19 Prepared
More informationOutline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information
From to Systems Biology Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - What can we learn Limitations Integration of omics - In-class
More informationThe EORTC Molecular Screening programme SPECTA
The EORTC Molecular Screening programme SPECTA February 2016 Denis Lacombe, MD, MSc EORTC, Director General Brussels, Belgium The changing shape of clinical research Phase I RESOURCES Phase III The changing
More informationPharmacogenomics within the EHR
Pharmacogenomics within the EHR Session #258, March 8, 2018 2:30 PM 3:30 PM Jon Walter McKeeby, DSc NIH CC CIO Jharana Tina Patel, PharmD, MBA, Pharmacy Information Officer 1 Conflict of Interest Jon Walter
More informationACCELERATING GENOMIC ANALYSIS ON THE CLOUD. Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia to analyze thousands of genomes
ACCELERATING GENOMIC ANALYSIS ON THE CLOUD Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia to analyze thousands of genomes Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of
More informationTypes of Databases - By Scope
Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of
More informationBiomarker Data Management in Clinical Trials: Addressing the Challenges of the New Regulatory Landscape
Biomarker Data Management in Clinical Trials: Addressing the Challenges of the New Regulatory Landscape Introduction Biomarkers and specialty labs are core to modern clinical trials.the broad and evergrowing
More informationMicroarray Gene Expression Analysis at CNIO
Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples
More information- OMICS IN PERSONALISED MEDICINE
SUMMARY REPORT - OMICS IN PERSONALISED MEDICINE Workshop to explore the role of -omics in the development of personalised medicine European Commission, DG Research - Brussels, 29-30 April 2010 Page 2 Summary
More informationThe first and only fully-integrated microarray instrument for hands-free array processing
The first and only fully-integrated microarray instrument for hands-free array processing GeneTitan Instrument Transform your lab with a GeneTitan Instrument and experience the unparalleled power of streamlining
More informationNext Generation Oncology Sequencing in your Laboratory. Built by pioneers in cancer genomics and liquid biopsy approaches PROGENEUS
PROGENEUS Next Generation Oncology Sequencing in your Laboratory Built by pioneers in cancer genomics and liquid biopsy approaches For Research Use Only. Not for iagnostic Purposes. personalgenome.com/progeneus
More informationNo longer only a field of experimental
COMPUTING PRACTICES Integrating Biological Research through Web Services A case study demonstrates that Web services could be key to coordinating and standardizing incompatible applications in bioinformatics,
More informationStefano Monti. Workshop Format
Gad Getz Stefano Monti Michael Reich {gadgetz,smonti,mreich}@broad.mit.edu http://www.broad.mit.edu/~smonti/aws Broad Institute of MIT & Harvard October 18-20, 2006 Cambridge, MA Workshop Format Morning
More informationCodeLink Human Whole Genome Bioarray
CodeLink Human Whole Genome Bioarray 55,000 human gene targets on a single bioarray The CodeLink Human Whole Genome Bioarray comprises one of the most comprehensive coverages of the human genome, as it
More informationIntroduction and Public Sequence Databases. BME 110/BIOL 181 CompBio Tools
Introduction and Public Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 29, 2011 Course Syllabus: Admin http://www.soe.ucsc.edu/classes/bme110/spring11 Reading: Chapters 1, 2 (pp.29-56),
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationBuilding A Knowledge Base of Severe Adverse Drug Events Based On AERS Reporting Data Using Semantic Web Technologies
Building A Knowledge Base of Severe Adverse Drug Events Based On AERS Reporting Data Using Semantic Web Technologies Guoqian Jiang, MD, PhD Mayo Clinic College of Medicine, Rochester, MN, USA MEDINFO 2013
More information