Molecular Dynamics of DNA origami nanostructures

Size: px
Start display at page:

Download "Molecular Dynamics of DNA origami nanostructures"

Transcription

1 Molecular Dynamics of DNA origami nanostructures Christopher Maffeo PI: Aleksei Aksimentiev Department of Physics University of Illinois at Urbana-Champaign Blue Waters Symposium June 5, 2018

2 All-atom Molecular Dynamics (MD) U = Atoms modeled as classical point particles Interactions prescribed by CHARMM36 force field bonded + i>j with CUFIX corrections Simulations run using NAMD on Blue Waters k(r ij r 0 ) 2 + k ( 0 ) 2 + k(1 + cos(n + )) U min Rmin r ij 12 + Cq iq j 0r ij 2 R 6 min r ij bond angle dihedral Lennard-Jones (van der Waals) electrostatic Phillips et.al. J. Com. Chem. 26:1781

3 Single-stranded DNA hybridizes with sequence specificity phosphate sugar. adenine. guanine thymine cytosine

4 DNA origami Building a structure with nanoscale precision by folding DNA 2.5 nm Viral DNA (scaffold) Synthetic DNA (staples) ~30 40 nucleotides

5 Downloaded fr to I, and S41 to S49). Increasing the concentrainterfaces, create rich opportunities for adjusting ntarity, including dimers, trimers, and a teands8n to+s21). 1, and nthe+ conformational 1 and tion of cations shifts the equilibrium toward the equilibrium, and changing it merthe (Fig.planes 1D; fig. defined S7, B to F;by andnfigs. closed state by predominantly reducing the avreversibly and rapidly, by global parameters such o illustrate the ability of finely the click-in shape n + 2 can not be tuned, and ~34.3 /bp asthat cation ognition for precisely defining conis thescheme smallest increment of curvature canconcentration and solution temperature. erage time that the switch dwells in the open state (fig. S23I). We test these options in detail using ensemble and mational states within a multidomain DNA be achieved. The greater the strength of the designed insingle-molecule fluorescence resonance energy ct, we designed a switchlike DNA object conteraction between the shape-complementary transfer (FRET) experiments, as well as TEM imng of two rigid beams connected by a pivot interfaces of the switch, the lower the cation conaging and electrophoretic mobility analysis per. 1E and fig. S22). The switch can dwell either centration necessary for stabilizing the closed formed as a function of cation concentration and n ensemble of open states or in a closed state. state (Fig. 2B and fig. S23, B and C). In the switch temperature with the switch object and for a distructure of the closed state is prescribed by version with 16 stacking bonds, the transition meric brick complex. For both the switch and the pe-complementary patterns of double-helical occurred over a narrow concentration interval dimeric bricks, increasing the cation concentraa domains that can click into each other when ranging from 6 to 12 mm MgCl2. For stronger tion shifted the conformational equilibrium fromdietz two beams draw together (Fig. 1E, right). and coworkers, the open or monomeric states to the closed or Science ect imaging by negative-stain TEM confirms hybridization-based interactions at all comple(2012) dimeric states, respectively (Fig. 2, A and B, and the switch adopts open and closed conformentary sites instead of the minimal stacking DNA origami structures Fig. 1. Synthetic DNA membr D REPORTS channel formed by 54 doublelattice. Cylinders indicate double brane stem; orange strands with oligonucleotides that hybridize Geometric specifications of the tr = 6 nm, inner diame Yan and diameter coworkers, D Science (2013) fully surrounded by DNA helices of a 7-base strand extension actin for mutant M1 and l = 14 nm f B Fig. 1. Synthetic DNA membrane channels. (A) Schematic illustration of the channel formed by 54 double-helical DNA domains packed on a honeycomb lattice. Cylinders indicate double-helical DNA domains. Red denotes transmembrane stem; orange strands with orange ellipsoids indicate cholesterol-modified oligonucleotides that hybridize to single-stranded DNA adaptor strands. (B) Geometric specifications of the transmembrane channel. Length L = 47 nm, tube diameter D = 6 nm, inner diameter d = 2 nm. The length of the central channel fully surrounded by DNA helices is 42 nm. The star symbol indicates the position of a 7-base strand extension acting as a defect in channel mutants [l = 15 nm for mutant M1 and l = 14 nm for mutant M2; see text S6 and cadnano maps Yan and coworkers, Science (2011) rvatures. (A) Schematic representation of the hem(c) Schematic representation of the ellipsoid. (D) TEM EM grids. The concave surface is visible as a dark area. d on TEM grids. Due to the spherical symmetry, the of the ellipsoid. The outline of the ellipsoid is visible. 0 nm. (G) Schematic representation of the nanoflask.. (I) TEM images of the nanoflask, randomly deposited om of the flask are clearly visible in the images. Scale emag.org on September 27, SCIENCE (figs. S22 to S24)]. (C) Cross-sectio porated in a lipid bilayer. (D) Averag purified DNA channel structures ( displayed in figs. S1 and S2). (E an adhering to small unilamellar vesic oleoyl-sn-glycero-3-phosphocholine of vesicle size distribution and bindin to S9. (G) TEM image of DNA channe upper right part of the image. DNA covered areas or sticking to SUVs (s VOL NOVEMBER 2 Fig. 4. Schematics (left), (middle), and TEM images (right)30ofmm(a) an and (C), the diam 12.5AFM mm MgCl MgCl S-shaped structure, a sphere, (C) aspherical screw. All scale bars indicate 200 nm, images compared Fig. 4. Bending enables the design of intricate nonlinear shapes. Red single scaffold strand(b) designed to fold into aand 50-nm-wide wireframe 25 nm emag.org nanorobot (15 MD) that can be reversibly reconfigured in three different con4. Reversibly reconfigurable non base pairing multistate DNA devices segments indicate regions in which deletions and insertions are installed. capsule resembling a beach ball and four typical particles representing Shih and coworkers, Science (2009) and all zoom-in images (images without scale bars) are 200 by 200 nm. In (B) flattening of the Scaleshapes. bars, 20 nm. Modelrow: of a schematic 3-by-6 helix DNA-origami bundle different of the beach ball. The design states: folds as six Dietz bent crosses and coworkers, Science formational disassembled, and assembled with (2015) open or closed arms, h arbitrary (A)(A)Top representations of aprojections reconfig5 mm MgCl2 designed to bend into a half-circle with a 25-nm radius that bears three 2 (inset) connected on a single scaffold. (D) A concave triangle that is folded 2

6 Cryo-electron microscopy and all-atom simulation for DNA origami structure prediction Reference structure docked into cryo-em 2 RMSD of scaffold (nm) time (ns) PNAS 109:20012 Nucleic Acids Research 44:3013

7 Comparison between simulation and experiment EM density psuedo-atomic model Nucleic Acids Research 44:3013 simulation

8 Interactions in a simple coarse-grained DNA model 4 nm cutoff 100 mm

9 Coarse-grained model captures programmed curvature Design and TEM: Science 325:725

10 Adaptive resolution simulation of DNA origami systems Andersen et al., Nature 2009 Birkedal Group

11 DNA-based Voltage sensing Keyser Group Experimental setup All-atom MD simulation 5 na 150 ms ACS Nano 9: (2015) Idea: use DNA origami as a local voltage probe

12 Design of a nanoscale voltage sensor Keyser and Tinnefeld Groups Nano Lett., doi: /acs.nanolett.7b05354 (2018)

13 Coarse-grained simulations of a FRET plate capture ~5 bp/bead CG model 40 µs simulations 100 mv 200 mv 300 mv 400 mv 600 mv Nano Lett., doi: /acs.nanolett.7b05354 (2018)

14 CG simulation of FRET efficiency 2 beads/bp CG model 1 µs simulations 100 mv 400 mv 200 mv Design A1 300 mv Nano Lett., doi: /acs.nanolett.7b05354 (2018)

15 Voltage sensing with DNA origami Experiment: Simulation: Nano Lett., doi: /acs.nanolett.7b05354 (2018)

16 DNA Ion Channels Jejoong Yoo Nano Letters, 13: 2351 Porins, 1 ns conductance Yoo & Aksimentiev, JPCL 6, 4680 (2015)

17 DNA Ion Channels Conductance < 0.1 ns Membrane channel made of a single DNA duplex (0.1 ns) Nano Letters 16:4665 (2016) Gramicidin ion channels Chen-Yu Li Porin-like DNA channel 40 ns Keyser Group ACS Nano 10:8207 (2016)

18 All-atom MD simulation of lipid-dna interface Chen Yu Li No applied electric field Lipid molecule around the DNA channel can translocate to the other leaflet.

19 Lipid translocation through toroidal pores is very common and very fast

20 Lipid translocation through toroidal pores is very common and very fast DPhPE DPhPC 3-5 orders of magnitude faster than natural scramblases scramblase

21 Experimental verification Scale bars are 10 µm Keyser Group Ohmann, Li, Ulrich F. Keyser, Aksimentiev,

22 Works in human cells Annexin V binds specifically to PS lipids found in inner leaflet of human cells Breast cancer cells from the cell line MDA-MB-231 Positive control: apoptosis-inducing microbial alkaloid staurosporine Negative control: DNA folding buffer Scale bar is 20 µm

23 Acknowledgements Aksimentiev Group Aleksei Aksimentiev Chen-Yu Li Jejoong Yoo Center for Macromolecular Modeling and Bioinformatics Victoria Birkedal Ulrich Keyser Philip Tinnefeld

DNA nanotechnology. Aleksei Aksimentiev Department of Physics, UIUC

DNA nanotechnology. Aleksei Aksimentiev Department of Physics, UIUC DNA nanotechnology Aleksei Aksimentiev Department of Physics, UIUC 1 DNA up-close backbone sugar ring base phosphate Double stranded DNA 5 -AAGCTGGTTCAG-3 Single stranded DNA DNA up-close backbone nucleotide

More information

Introduction to Simulation and Modeling of DNA Systems. Aleksei Aksimentiev Department of Physics, University of Illinois at Urbana -Champaign

Introduction to Simulation and Modeling of DNA Systems. Aleksei Aksimentiev Department of Physics, University of Illinois at Urbana -Champaign Introduction to Simulation and Modeling of DNA Systems Aleksei Aksimentiev Department of Physics, University of Illinois at Urbana -Champaign DNA, the blueprint A nucleus of a human cell contains 23x2

More information

Supporting Information: In situ structure and dynamics of DNA origami determined through molecular dynamics simulations

Supporting Information: In situ structure and dynamics of DNA origami determined through molecular dynamics simulations Supporting Information: In situ structure and dynamics of DNA origami determined through molecular dynamics simulations Jejoong Yoo and Aleksei Aksimentiev Department of Physics and Center for the Physics

More information

(a) Overview of the 2-helix bundle (2HB) nanospring design used in this study. The

(a) Overview of the 2-helix bundle (2HB) nanospring design used in this study. The 1 Supplementary Figure 1 Design of the DNA origami spring (nanospring). (a) Overview of the 2-helix bundle (2HB) nanospring design used in this study. The scheme was produced by cadnano software 1. Scaffold,

More information

Final exam. Please write your name on the exam and keep an ID card ready.

Final exam. Please write your name on the exam and keep an ID card ready. Biophysics of Macromolecules Prof. R. Jungmann and Prof. J. Lipfert SS 2017 Final exam Final exam First name: Last name: Student number ( Matrikelnummer ): Please write your name on the exam and keep an

More information

Supporting Information for: Plasmonic Nanopores. for Trapping, Controlling Displacement, and. Sequencing of DNA

Supporting Information for: Plasmonic Nanopores. for Trapping, Controlling Displacement, and. Sequencing of DNA Supporting Information for: Plasmonic Nanopores for Trapping, Controlling Displacement, and Sequencing of DNA Maxim Belkin, Shu-Han Chao, Magnus P. Jonsson,,, Cees Dekker,, and Aleksei Aksimentiev, Department

More information

Technical Seminar 22th Jan 2013 DNA Origami

Technical Seminar 22th Jan 2013 DNA Origami Technical Seminar 22th Jan 2013 DNA Origami Hitoshi Takizawa, PhD Agenda 1) Basis of structural DNA nanotechnology 2) DNA origami technique (2D, 3D, complex shape) 3) Programmable nanofactory 4) Application

More information

Supporting Information Defined Bilayer Interactions of DNA Nanopores Revealed with a Nuclease-Based Nanoprobe Strategy

Supporting Information Defined Bilayer Interactions of DNA Nanopores Revealed with a Nuclease-Based Nanoprobe Strategy Supporting Information Defined Bilayer Interactions of DNA Nanopores Revealed with a Nuclease-Based Nanoprobe Strategy Jonathan R. Burns* & Stefan Howorka* 1 Contents 1. Design of DNA nanopores... 3 1.1.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION A biomimetic DNA-based channel for the ligand-controlled transport of charged molecular cargo across a biological membrane Jonathan R. Burns, Astrid Seifert, Niels Fertig, Stefan Howorka NATURE NANOTECHNOLOGY

More information

The Computational Microscope. Main funding: simulation of an entire virus

The Computational Microscope. Main funding: simulation of an entire virus The Computational Microscope Klaus Schulten Dept. Physics / Beckman Institute, U. Illinois NIH., October 2007 Main funding: simulation of an entire virus The Computational Microscope Computational Microscope

More information

Structural Bioinformatics (C3210) DNA and RNA Structure

Structural Bioinformatics (C3210) DNA and RNA Structure Structural Bioinformatics (C3210) DNA and RNA Structure Importance of DNA/RNA 3D Structure Nucleic acids are essential materials found in all living organisms. Their main function is to maintain and transmit

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1. Mechanism for signal-induced opening of the DNA box. a, An atomic model of the DNA box held closed by locks (orange and blue) that are double helices formed by two short strands

More information

DNA Glycosylase Exercise

DNA Glycosylase Exercise Name StarBiochem DNA Glycosylase Exercise Background In this exercise, you will use StarBiochem, a protein 3-D viewer, to explore the structure of a DNA repair protein found in most species, including

More information

Nucleic acids. How DNA works. DNA RNA Protein. DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology

Nucleic acids. How DNA works. DNA RNA Protein. DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology Nucleic acid chemistry and basic molecular theory Nucleic acids DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology Cell cycle DNA RNA Protein Transcription Translation

More information

An Investigation of Mechanical. Properties of DNA Origami. Nanostructures

An Investigation of Mechanical. Properties of DNA Origami. Nanostructures An Investigation of Mechanical Properties of DNA Origami Nanostructures HONORS THESIS Submitted to The Engineering Honors Committee 119 Hitchcock Hall College of Engineering The Ohio State University Columbus,

More information

Active delivery of single DNA molecules into a plasmonic nanopore for. label-free optical sensing

Active delivery of single DNA molecules into a plasmonic nanopore for. label-free optical sensing Supporting Information: Active delivery of single DNA molecules into a plasmonic nanopore for label-free optical sensing Xin Shi 1,2, Daniel V Verschueren 1, and Cees Dekker 1* 1. Department of Bionanoscience,

More information

Gene and DNA structure. Dr Saeb Aliwaini

Gene and DNA structure. Dr Saeb Aliwaini Gene and DNA structure Dr Saeb Aliwaini 2016 DNA during cell cycle Cell cycle for different cell types Molecular Biology - "Study of the synthesis, structure, and function of macromolecules (DNA, RNA,

More information

NIH Public Access Author Manuscript Science. Author manuscript; available in PMC 2010 February 7.

NIH Public Access Author Manuscript Science. Author manuscript; available in PMC 2010 February 7. NIH Public Access Author Manuscript Published in final edited form as: Science. 2009 August 7; 325(5941): 725 730. doi:10.1126/science.1174251. Folding DNA into Twisted and Curved Nanoscale Shapes Hendrik

More information

DNA Repair Protein Exercise

DNA Repair Protein Exercise Name StarBiochem DNA Repair Protein Exercise Background In this exercise, you will use StarBiochem, a protein 3-D viewer, to explore the structure of a DNA repair protein found in most species, including

More information

Supplementary Information. Arrays of Individual DNA Molecules on Nanopatterned Substrates

Supplementary Information. Arrays of Individual DNA Molecules on Nanopatterned Substrates Supplementary Information Arrays of Individual DNA Molecules on Nanopatterned Substrates Roland Hager, Alma Halilovic, Jonathan R. Burns, Friedrich Schäffler, Stefan Howorka S1 Figure S-1. Characterization

More information

1.1 Chemical structure and conformational flexibility of single-stranded DNA

1.1 Chemical structure and conformational flexibility of single-stranded DNA 1 DNA structures 1.1 Chemical structure and conformational flexibility of single-stranded DNA Single-stranded DNA (ssdna) is the building base for the double helix and other DNA structures. All these structures

More information

Excess Titanium Dioxide Nanoparticles on Cell Surface Induce Cytotoxicity by Hindering Ion Exchange and Disrupting Exocytosis Processes

Excess Titanium Dioxide Nanoparticles on Cell Surface Induce Cytotoxicity by Hindering Ion Exchange and Disrupting Exocytosis Processes Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2015 Supporting Information Excess Titanium Dioxide Nanoparticles on Cell Surface Induce Cytotoxicity

More information

Supporting Information

Supporting Information Supporting Information Wiley-VCH 2014 69451 Weinheim, Germany Complex Reconfiguration of DNA Nanostructures** Bryan Wei,* Luvena L. Ong, Jeffrey Chen, Alexander S. Jaffe, and Peng Yin* ange_201402437_sm_miscellaneous_information.pdf

More information

MCB 110:Biochemistry of the Central Dogma of MB. MCB 110:Biochemistry of the Central Dogma of MB

MCB 110:Biochemistry of the Central Dogma of MB. MCB 110:Biochemistry of the Central Dogma of MB MCB 110:Biochemistry of the Central Dogma of MB Part 1. DNA replication, repair and genomics (Prof. Alber) Part 2. RNA & protein synthesis. Prof. Zhou Part 3. Membranes, protein secretion, trafficking

More information

INDIAN INSTITUTE OF TECHNOLOGY ROORKEE NPTEL NPTEL ONLINE CERTIFICATION COURSE. Biomedical Nanotechnology. Lec - 06 DNA Nanotechnology

INDIAN INSTITUTE OF TECHNOLOGY ROORKEE NPTEL NPTEL ONLINE CERTIFICATION COURSE. Biomedical Nanotechnology. Lec - 06 DNA Nanotechnology INDIAN INSTITUTE OF TECHNOLOGY ROORKEE NPTEL NPTEL ONLINE CERTIFICATION COURSE Biomedical Nanotechnology Lec - 06 DNA Nanotechnology Dr. Arup Kumar Das Department of Mechanical and Industrial Engineering

More information

Current ( pa) Current (pa) Voltage (mv) Voltage ( mv)

Current ( pa) Current (pa) Voltage (mv) Voltage ( mv) Current ( pa) 3000 2000 1000 0-1000 -2000-3000 a -400-200 0 200 400 Voltage (mv) P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 P11 P12 P13 P14 P15 P16 P17 P18 Average Current (pa) 4500 3000 1500 0-1500 -3000-4500 b -400-200

More information

Making a Model of DNA Instructions

Making a Model of DNA Instructions Instructions 1) Colour the individual structures on the worksheet as follows: adenine = red guanine = blue phosphate = brown thymine = green cytosine = yellow deoxyribose = purple 2) Cut out each structure.

More information

By the end of today, you will have an answer to: How can 1 strand of DNA serve as a template for replication?

By the end of today, you will have an answer to: How can 1 strand of DNA serve as a template for replication? Name: Period: Date: KIPP NYC College Prep Genetics and Biotech UNIT 9: Introduction to DNA Lecture 4: DNA Modeling and Intro to Replication By the end of today, you will have an answer to: How can 1 strand

More information

Toward sequencing DNA with a synthetic nanopore

Toward sequencing DNA with a synthetic nanopore Toward sequencing DNA with a synthetic nanopore Aleksei Aksimentiev University of Illinois at Urbana-Champaign Bio- Nano Systems DNA up-close backbone sugar ring base phosphate Double stranded DNA 5 -AAGCTGGTTCAG-3

More information

Supporting Information. Label-Free Optical Detection of DNA. Translocations Through Plasmonic Nanopores

Supporting Information. Label-Free Optical Detection of DNA. Translocations Through Plasmonic Nanopores Supporting Information Label-Free Optical Detection of DNA Translocations Through Plasmonic Nanopores Daniel V. Verschueren 1, Sergii Pud 1, Xin Shi 1,2, Lorenzo De Angelis 3, L. Kuipers 3, and Cees Dekker

More information

DBP4: Biosensors. DNA passing through a nanopore (all-atom MD simulation) Diamond thin films as tethering surfaces for bacterial capture

DBP4: Biosensors. DNA passing through a nanopore (all-atom MD simulation) Diamond thin films as tethering surfaces for bacterial capture 8 DBP4: Biosensors Biomedical relevance Significance and challenges Biosensors provide unique ways to investigate and monitor the health of a living body. Computational microscope can image nanodevices

More information

Your Name: MID TERM ANSWER SHEET SIN: ( )

Your Name: MID TERM ANSWER SHEET SIN: ( ) MIDTERM EXAMINATION (October 23, 2008) BIOE150. Introduction to Bio-Nanoscience & Bio-Nanotechnology Professor Seung-Wuk Lee Fall Semester, 2008 0. Write down your name and the last digit of your SIN in

More information

Hmwk 6. Nucleic Acids

Hmwk 6. Nucleic Acids The purpose of this homework exercise is Hmwk 6. Nucleic Acids 1). to recognize fundamental features of B-form DNA and A-form RNA 2). to view the folded structure of trna B-FORM DNA In aqueous solutions,

More information

Lecture 13. Motor Proteins I

Lecture 13. Motor Proteins I Lecture 13 Motor Proteins I Introduction: The study of motor proteins has become a major focus in cell and molecular biology. Motor proteins are very interesting because they do what no man-made engines

More information

DNA. The Rise of the. Nanorobots. When designed properly, DNA folds into tiny devices that move like macroscopic machines.

DNA. The Rise of the. Nanorobots. When designed properly, DNA folds into tiny devices that move like macroscopic machines. The Rise of the DNA Nanorobots When designed properly, DNA folds into tiny devices that move like macroscopic machines. MECHANICAL ENGINEERING AUGUST 2016 P.45 Throughout the patient s body, the tiny robots

More information

Molecular Biology (1)

Molecular Biology (1) Molecular Biology (1) DNA structure and basic applications Mamoun Ahram, PhD Second semester, 2017-2018 Resources This lecture Cooper, pp. 49-52, 118-119, 130 What is molecular biology? Central dogma

More information

Detection of local protein structures along DNA using solid-state nanopores

Detection of local protein structures along DNA using solid-state nanopores Detection of local protein structures along DNA using solid-state nanopores nanopore Stefan Kowalczyk Adam Hall Cees Dekker RecA-DNA filament (Nano Letters cover September 2009) Bremen 29-06-2009 Main

More information

Fundamentals of Organic Chemistry. CHAPTER 10: Nucleic Acids

Fundamentals of Organic Chemistry. CHAPTER 10: Nucleic Acids Fundamentals of Organic Chemistry CHEM 109 For Students of Health Colleges Credit hrs.: (2+1) King Saud University College of Science, Chemistry Department CHEM 109 CHAPTER 10: Nucleic Acids 2 o Nucleic

More information

BCH302 [Practical] 1

BCH302 [Practical] 1 BCH302 [Practical] 1 2 DNA is made of 2 polynucleotide chains which run in opposite direction antiparallel. DNA has a double helical structure. Each polynucleotide chain of DNA consists of monomer units

More information

The Double Helix. DNA and RNA, part 2. Part A. Hint 1. The difference between purines and pyrimidines. Hint 2. Distinguish purines from pyrimidines

The Double Helix. DNA and RNA, part 2. Part A. Hint 1. The difference between purines and pyrimidines. Hint 2. Distinguish purines from pyrimidines DNA and RNA, part 2 Due: 3:00pm on Wednesday, September 24, 2014 You will receive no credit for items you complete after the assignment is due. Grading Policy The Double Helix DNA, or deoxyribonucleic

More information

Light Sensitization of DNA Nanostructures via Incorporation of Photo-Cleavable Spacers

Light Sensitization of DNA Nanostructures via Incorporation of Photo-Cleavable Spacers Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2016 Light Sensitization of DNA Nanostructures via Incorporation of Photo-Cleavable Spacers

More information

Discoveries Through the Computational Microscope

Discoveries Through the Computational Microscope Discoveries Through the Computational Microscope Accuracy Speed-up Unprecedented Scale Investigation of drug (Tamiflu) resistance of the swine flu virus demanded fast response! Klaus Schulten Department

More information

FRET Enhancement close to Gold Nanoparticle. Positioned in DNA Origami Constructs

FRET Enhancement close to Gold Nanoparticle. Positioned in DNA Origami Constructs Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information FRET Enhancement close to Gold Nanoparticle Positioned in

More information

CGTAAGAGTACGTCCAGCATCGGF ATCATTATCTACATCXXXXXTACCATTCATTCAGATCTCACTATCGCATTCTCATGCAGGTCGTAGCCXS

CGTAAGAGTACGTCCAGCATCGGF ATCATTATCTACATCXXXXXTACCATTCATTCAGATCTCACTATCGCATTCTCATGCAGGTCGTAGCCXS 5 CGTAAGAGTACGTCCAGCATCGGF ATCATTATCTACATCXXXXXTACCATTCATTCAGATCTCACTATCGCATTCTCATGCAGGTCGTAGCCXS 29 Supplementary Figure 1 Sequence of the DNA primer/template pair used in Figure 1bc. A 23nt primer is

More information

Lecture 5. Biomolecular Self-assembly (and Detection)

Lecture 5. Biomolecular Self-assembly (and Detection) 10.524 Lecture 5. Biomolecular Self-assembly (and Detection) Instructor: Prof. Zhiyong Gu (Chemical Engineering & UML CHN/NCOE Nanomanufacturing Center) Lecture 6: Biomolecular Self-assembly Table of Contents

More information

DNA AND CHROMOSOMES. Genetica per Scienze Naturali a.a prof S. Presciuttini

DNA AND CHROMOSOMES. Genetica per Scienze Naturali a.a prof S. Presciuttini DNA AND CHROMOSOMES This document is licensed under the Attribution-NonCommercial-ShareAlike 2.5 Italy license, available at http://creativecommons.org/licenses/by-nc-sa/2.5/it/ 1. The Building Blocks

More information

RNA does not adopt the classic B-DNA helix conformation when it forms a self-complementary double helix

RNA does not adopt the classic B-DNA helix conformation when it forms a self-complementary double helix Reason: RNA has ribose sugar ring, with a hydroxyl group (OH) If RNA in B-from conformation there would be unfavorable steric contact between the hydroxyl group, base, and phosphate backbone. RNA structure

More information

Supporting Information for. Localized DNA Hybridization Chain Reactions. on DNA Origami

Supporting Information for. Localized DNA Hybridization Chain Reactions. on DNA Origami Supporting Information for Localized DNA Hybridization Chain Reactions on DNA Origami Hieu Bui 1,3*, Shalin Shah 2*, Reem Mokhtar 1, Tianqi Song 1, Sudhanshu Garg 1, John Reif 1,2 1 Department of Computer

More information

Chapter 9: DNA: The Molecule of Heredity

Chapter 9: DNA: The Molecule of Heredity Chapter 9: DNA: The Molecule of Heredity What is DNA? Answer: Molecule that carries the blueprint of life General Features: DNA is packages in chromosomes (DNA + Proteins) Gene = Functional segment of

More information

What Are the Chemical Structures and Functions of Nucleic Acids?

What Are the Chemical Structures and Functions of Nucleic Acids? THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic

More information

CSCI 2570 Introduction to Nanocomputing

CSCI 2570 Introduction to Nanocomputing CSCI 2570 Introduction to Nanocomputing DNA Computing John E Savage DNA (Deoxyribonucleic Acid) DNA is double-stranded helix of nucleotides, nitrogen-containing molecules. It carries genetic information

More information

Activity A: Build a DNA molecule

Activity A: Build a DNA molecule Name: Date: Student Exploration: Building DNA Vocabulary: double helix, DNA, enzyme, lagging strand, leading strand, mutation, nitrogenous base, nucleoside, nucleotide, replication Prior Knowledge Questions

More information

A Domain Swapping Study of Nano-Capsule Proteins. Rongli Fan, Aimee L. Boyle, Vee Vee Cheong, See Liang Ng, Brendan P. Orner*

A Domain Swapping Study of Nano-Capsule Proteins. Rongli Fan, Aimee L. Boyle, Vee Vee Cheong, See Liang Ng, Brendan P. Orner* A Domain Swapping Study of Nano-Capsule Proteins Rongli Fan, Aimee L. Boyle, Vee Vee Cheong, See Liang Ng, Brendan P. Orner* Figure S1. Amino acid sequences of proteins used in this study. Grey shading

More information

Supplementary Figure 1 Two distinct conformational states of the HNH domain in crystal structures. a

Supplementary Figure 1 Two distinct conformational states of the HNH domain in crystal structures. a Supplementary Figure 1 Two distinct conformational states of the HNH domain in crystal structures. a HNH-state 1 in PDB 4OO8, in which the distance from the C atom of the HNH catalytic residue 840 to the

More information

Which diagram represents a DNA nucleotide? A) B) C) D)

Which diagram represents a DNA nucleotide? A) B) C) D) 3594-1 - Page 1 Name: 1) What is a definition of the term "gene"? A) a transfer-rna nucleotide sequence specific for a particular amino acid B) three messenger-rna nucleotides coded for a specific amino

More information

Chapter 10. DNA: The Molecule of Heredity. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc.

Chapter 10. DNA: The Molecule of Heredity. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc. Chapter 10 DNA: The Molecule of Heredity Lectures by Gregory Ahearn University of North Florida Copyright 2009 Pearson Education, Inc. 10.1 What Is The Structure Of DNA? Deoxyribonucleic acid (DNA) is

More information

Supporting Information

Supporting Information Supporting Information Terasawa et al. 10.1073/pnas.1120327109 SI Materials and Methods Modeling of Shape Transformation. To determine whether the depletion volume effect can drive budding transformation,

More information

Analysis of Solid State Nanopore for Signal Processing and Control

Analysis of Solid State Nanopore for Signal Processing and Control Nguyen 1 Analysis of Solid State Nanopore for Signal Processing and Control Nathan N. Nguyen, Christopher R. O Donnell, Raj Maitra, William B. Dunbar University of California - Santa Cruz, Santa Cruz,

More information

TileSoft: Sequence Optimization Software for Designing DNA Secondary Structures

TileSoft: Sequence Optimization Software for Designing DNA Secondary Structures 1 TileSoft: Sequence Optimization Software for Designing DNA Secondary Structures P. Yin*, B. Guo*, C. Belmore*, W. Palmeri*, E. Winfree, T. H. LaBean* and J. H. Reif* * Department of Computer Science,

More information

DNA and RNA Structure Guided Notes

DNA and RNA Structure Guided Notes Nucleic acids, especially DNA, are considered as the key biomolecules that guarantee the continuity of life. DNA is the prime genetic molecule which carry all the hereditary information that's passed from

More information

Appendix A DNA and PCR in detail DNA: A Detailed Look

Appendix A DNA and PCR in detail DNA: A Detailed Look Appendix A DNA and PCR in detail DNA: A Detailed Look A DNA molecule is a long polymer consisting of four different components called nucleotides. It is the various combinations of these four bases or

More information

Hmwk # 8 : DNA-Binding Proteins : Part II

Hmwk # 8 : DNA-Binding Proteins : Part II The purpose of this exercise is : Hmwk # 8 : DNA-Binding Proteins : Part II 1). to examine the case of a tandem head-to-tail homodimer binding to DNA 2). to view a Zn finger motif 3). to consider the case

More information

What is Nano-Bio? Non-Covalent Interactions

What is Nano-Bio? Non-Covalent Interactions - - What is Nano-Bio? Physicist: Biotech: Biologists: -study of molecular interactions -application of nano-tools to study biological systems. -application of nano-tools to detect, treat, and prevent disease

More information

BIO 101 : The genetic code and the central dogma

BIO 101 : The genetic code and the central dogma BIO 101 : The genetic code and the central dogma NAME Objectives The purpose of this exploration is to... 1. design experiments to decipher the genetic code; 2. visualize the process of protein synthesis;

More information

Nucleic Acids. Information specifying protein structure

Nucleic Acids. Information specifying protein structure Nucleic Acids Nucleic acids represent the fourth major class of biomolecules (other major classes of biomolecules are proteins, carbohydrates, fats) Genome - the genetic information of an organism Information

More information

Lesson 1 Introduction to Restriction Analysis

Lesson 1 Introduction to Restriction Analysis Lesson 1 Introduction to Restriction Analysis Consideration 1. How Does DNA Become Fragmented Into Pieces? DNA consists of a series of nitrogenous base molecules held together by weak hydrogen bonds. These

More information

MOLECULAR STRUCTURE OF DNA

MOLECULAR STRUCTURE OF DNA MOLECULAR STRUCTURE OF DNA Characteristics of the Genetic Material 1. Replication Reproduced and transmitted faithfully from cell to cell (generation to generation) 2. Information Storage Biologically

More information

Information specifying protein structure. Chapter 19 Nucleic Acids Nucleotides Are the Building Blocks of Nucleic Acids

Information specifying protein structure. Chapter 19 Nucleic Acids Nucleotides Are the Building Blocks of Nucleic Acids Chapter 19 Nucleic Acids Information specifying protein structure Nucleic acids represent the fourth major class of biomolecules (other major classes of biomolecules are proteins, carbohydrates, fats)

More information

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen

More information

Chapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc.

Chapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc. Chapter 8 Microbial Genetics Lectures prepared by Christine L. Case Structure and Function of Genetic Material Learning Objectives 8-1 Define genetics, genome, chromosome, gene, genetic code, genotype,

More information

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct

More information

DNA Fingerprinting. The DNA fingerprinting technique is summarized as follows:

DNA Fingerprinting. The DNA fingerprinting technique is summarized as follows: DNA Fingerprinting Introduction Laboratory techniques called DNA fingerprinting have been developed to identify or type an individual's DNA. One application of these techniques has been in solving crimes.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature06147 SUPPLEMENTARY INFORMATION Figure S1 The genomic and domain structure of Dscam. The Dscam gene comprises 24 exons, encoding a signal peptide (SP), 10 IgSF domains, 6 fibronectin

More information

Supporting Information

Supporting Information Supporting Information Velocity of DNA during translocation through a solid state nanopore Calin Plesa, Nick van Loo, Philip Ketterer, Hendrik Dietz, Cees Dekker Department of Bionanoscience, Kavli Institute

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature08627 Supplementary Figure 1. DNA sequences used to construct nucleosomes in this work. a, DNA sequences containing the 601 positioning sequence (blue)24 with a PstI restriction site

More information

Supporting Information

Supporting Information Copyright WILEY-VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 2014. Supporting Information for Small, DOI: 10.1002/smll.201303558 Ultraspecific and Highly Sensitive Nucleic Acid Detection by Integrating

More information

DNA and RNA Structure. Unit 7 Lesson 1

DNA and RNA Structure. Unit 7 Lesson 1 Unit 7 Lesson 1 Students will be able to: Explain the structure and function of the DNA and RNA. Illustrate the structure of nucleotide. Summarize the differences between DNA and RNA. Identify the different

More information

I. Gene Expression Figure 1: Central Dogma of Molecular Biology

I. Gene Expression Figure 1: Central Dogma of Molecular Biology I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases

More information

Suppl. Figure 1: RCC1 sequence and sequence alignments. (a) Amino acid

Suppl. Figure 1: RCC1 sequence and sequence alignments. (a) Amino acid Supplementary Figures Suppl. Figure 1: RCC1 sequence and sequence alignments. (a) Amino acid sequence of Drosophila RCC1. Same colors are for Figure 1 with sequence of β-wedge that interacts with Ran in

More information

DNA and RNA are both composed of nucleotides. A nucleotide contains a base, a sugar and one to three phosphate groups. DNA is made up of the bases

DNA and RNA are both composed of nucleotides. A nucleotide contains a base, a sugar and one to three phosphate groups. DNA is made up of the bases 1 DNA and RNA are both composed of nucleotides. A nucleotide contains a base, a sugar and one to three phosphate groups. DNA is made up of the bases Adenine, Guanine, Cytosine and Thymine whereas in RNA

More information

Welcome! Virtual tutorial starts at 15:00 GMT. Please leave feedback afterwards at:

Welcome! Virtual tutorial starts at 15:00 GMT. Please leave feedback afterwards at: Welcome! Virtual tutorial starts at 15:00 GMT Please leave feedback afterwards at: www.archer.ac.uk/training/feedback/online-course-feedback.php Multi-resolution modelling of biological systems in LAMMPS

More information

Self-assembly of oligonucleotides

Self-assembly of oligonucleotides Self-assembly of oligonucleotides Dr. K. Uma Maheswari Professor, School of Chemical & Biotechnology SASTRA University Joint Initiative of IITs and IISc Funded by MHRD Page 1 of 9 Table of Contents 1 APPLICATIONS

More information

Discoveries Through the Computational Microscope Accuracy Speed-up Unprecedented Scale

Discoveries Through the Computational Microscope Accuracy Speed-up Unprecedented Scale Discoveries Through the Computational Microscope Accuracy Speed-up Unprecedented Scale Investigation of drug (Tamiflu) resistance of the swine flu virus demanded fast response! Klaus Schulten Department

More information

The Blueprint of Life DNA & Protein Synthesis

The Blueprint of Life DNA & Protein Synthesis The Blueprint of Life DNA & Protein Synthesis Why Do You Look Like That? Hair on your head grows up to 25 inches, but hair on our eyebrows grows only an inch or less. Why? Humans have five fingers on each

More information

Write: Unit 5 Review at the top.

Write: Unit 5 Review at the top. Warm-up Take out a sheet of paper: Write: Unit 5 Review at the top. As each question goes on the board, write that question down and answer it. When answers come up, either write correct next to what you

More information

BASIC MOLECULAR GENETIC MECHANISMS Introduction:

BASIC MOLECULAR GENETIC MECHANISMS Introduction: BASIC MOLECULAR GENETIC MECHANISMS Introduction: nucleic acids. (1) contain the information for determining the amino acid sequence & the structure and function of proteins (1) part of the cellular structures:

More information

Review of Old Information: What is the monomer and polymer of: Macromolecule Monomer Polymer Carbohydrate Lipid Protein

Review of Old Information: What is the monomer and polymer of: Macromolecule Monomer Polymer Carbohydrate Lipid Protein Section 1.8 Question of the Day: Name: Review of Old Information: What is the monomer and polymer of: Macromolecule Monomer Polymer Carbohydrate Lipid Protein New Information: One of the most important

More information

How Can Pieces of DNA Solve a Puzzle?

How Can Pieces of DNA Solve a Puzzle? Introduction How Can Pieces of DNA Solve a Puzzle? One of the basic tools of modern biotechnology is DNA splicing: cutting DNA and linking it to other DNA molecules. The basic concept behind DNA splicing

More information

G-quadruplexes light up localized DNA circuits.

G-quadruplexes light up localized DNA circuits. G-quadruplexes light up localized DNA circuits. Oscar Mendoza,*,, Jean-Louis Mergny,, Jean-Pierre Aimé, and Juan Elezgaray*,, Univ. Bordeaux, 33600 Bordeaux, France CBMN, CNRS UMR-5248, F-33600 Pessac,

More information

Central Dogma. 1. Human genetic material is represented in the diagram below.

Central Dogma. 1. Human genetic material is represented in the diagram below. Central Dogma 1. Human genetic material is represented in the diagram below. 4. If 15% of a DNA sample is made up of thymine, T, what percentage of the sample is made up of cytosine, C? A) 15% B) 35% C)

More information

Lecture 2: Central Dogma of Molecular Biology & Intro to Programming

Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Central Dogma of Molecular Biology Proteins: workhorse molecules of biological systems Proteins are synthesized from the genetic blueprints

More information

The Structure of DNA

The Structure of DNA Name: The Structure of DNA 06/08/11 Students will turn in: 1. Assignment 1: DNA Worksheet 2. Assignment 2: Poster Draw a poster of the ladder structure of DNA, labeled. 3. Assignment 3: The completed DNA

More information

Supporting Information. DNA Tetraplexes-Based Toehold Activation for Controllable DNA Strand Displacement Reactions

Supporting Information. DNA Tetraplexes-Based Toehold Activation for Controllable DNA Strand Displacement Reactions Supporting Information DNA Tetraplexes-Based Toehold Activation for Controllable DNA Strand Displacement Reactions Wei Tang, Huaming Wang, Dingzhong Wang, Yan Zhao, Na Li, and Feng Liu* Beijing National

More information

DNA. Deoxyribose Nucleic Acid

DNA. Deoxyribose Nucleic Acid DNA Deoxyribose Nucleic Acid Biomolecules Remember 1. Carbohydrates 2. Lipids 3. Nucleic acids hold genetic information; code for proteins 4. Proteins History of DNA Who Discovered DNA Rosalind Franklin

More information

Computational methods in bioinformatics: Lecture 1

Computational methods in bioinformatics: Lecture 1 Computational methods in bioinformatics: Lecture 1 Graham J.L. Kemp 2 November 2015 What is biology? Ecosystem Rain forest, desert, fresh water lake, digestive tract of an animal Community All species

More information

Nature Structural & Molecular Biology: doi: /nsmb.2996

Nature Structural & Molecular Biology: doi: /nsmb.2996 Supplementary Figure 1 Negative-stain EM of native cytoplasmic dynein. (a) A representative micrograph of negatively stained dynein, with the flexible dimeric molecules circled in white. (b) Reference-free

More information

Supplementary material 1: DNA tracing

Supplementary material 1: DNA tracing Supplementary material 1: DNA tracing Figure S1:Typical AFM image showing DNA molecules relaxed when deposited with Mg 2+ DNA molecules that appear to have a higher or larger end (indicated by a red arrow

More information

Molecular Biology. IMBB 2017 RAB, Kigali - Rwanda May 02 13, Francesca Stomeo

Molecular Biology. IMBB 2017 RAB, Kigali - Rwanda May 02 13, Francesca Stomeo Molecular Biology IMBB 2017 RAB, Kigali - Rwanda May 02 13, 2017 Francesca Stomeo Molecular biology is the study of biology at a molecular level, especially DNA and RNA - replication, transcription, translation,

More information

Reviewers' comments: Reviewer #1 (Remarks to the Author):

Reviewers' comments: Reviewer #1 (Remarks to the Author): Reviewers' comments: Reviewer #1 (Remarks to the Author): In their manuscript "Single Molecule Mirage: shifted molecular localizations through plasmonic coupling", Raab et al evaluate the effect that plasmonic

More information

The Development of a Four-Letter Language DNA

The Development of a Four-Letter Language DNA The Development of a Four-Letter Language DNA The Griffith Experiment Chromosomes are comprised of two types of macromolecules, proteins and DNA, but which one is the stuff of genes? the answer was discovered

More information