Molecular Dynamics of DNA origami nanostructures
|
|
- Gwendoline Garrett
- 5 years ago
- Views:
Transcription
1 Molecular Dynamics of DNA origami nanostructures Christopher Maffeo PI: Aleksei Aksimentiev Department of Physics University of Illinois at Urbana-Champaign Blue Waters Symposium June 5, 2018
2 All-atom Molecular Dynamics (MD) U = Atoms modeled as classical point particles Interactions prescribed by CHARMM36 force field bonded + i>j with CUFIX corrections Simulations run using NAMD on Blue Waters k(r ij r 0 ) 2 + k ( 0 ) 2 + k(1 + cos(n + )) U min Rmin r ij 12 + Cq iq j 0r ij 2 R 6 min r ij bond angle dihedral Lennard-Jones (van der Waals) electrostatic Phillips et.al. J. Com. Chem. 26:1781
3 Single-stranded DNA hybridizes with sequence specificity phosphate sugar. adenine. guanine thymine cytosine
4 DNA origami Building a structure with nanoscale precision by folding DNA 2.5 nm Viral DNA (scaffold) Synthetic DNA (staples) ~30 40 nucleotides
5 Downloaded fr to I, and S41 to S49). Increasing the concentrainterfaces, create rich opportunities for adjusting ntarity, including dimers, trimers, and a teands8n to+s21). 1, and nthe+ conformational 1 and tion of cations shifts the equilibrium toward the equilibrium, and changing it merthe (Fig.planes 1D; fig. defined S7, B to F;by andnfigs. closed state by predominantly reducing the avreversibly and rapidly, by global parameters such o illustrate the ability of finely the click-in shape n + 2 can not be tuned, and ~34.3 /bp asthat cation ognition for precisely defining conis thescheme smallest increment of curvature canconcentration and solution temperature. erage time that the switch dwells in the open state (fig. S23I). We test these options in detail using ensemble and mational states within a multidomain DNA be achieved. The greater the strength of the designed insingle-molecule fluorescence resonance energy ct, we designed a switchlike DNA object conteraction between the shape-complementary transfer (FRET) experiments, as well as TEM imng of two rigid beams connected by a pivot interfaces of the switch, the lower the cation conaging and electrophoretic mobility analysis per. 1E and fig. S22). The switch can dwell either centration necessary for stabilizing the closed formed as a function of cation concentration and n ensemble of open states or in a closed state. state (Fig. 2B and fig. S23, B and C). In the switch temperature with the switch object and for a distructure of the closed state is prescribed by version with 16 stacking bonds, the transition meric brick complex. For both the switch and the pe-complementary patterns of double-helical occurred over a narrow concentration interval dimeric bricks, increasing the cation concentraa domains that can click into each other when ranging from 6 to 12 mm MgCl2. For stronger tion shifted the conformational equilibrium fromdietz two beams draw together (Fig. 1E, right). and coworkers, the open or monomeric states to the closed or Science ect imaging by negative-stain TEM confirms hybridization-based interactions at all comple(2012) dimeric states, respectively (Fig. 2, A and B, and the switch adopts open and closed conformentary sites instead of the minimal stacking DNA origami structures Fig. 1. Synthetic DNA membr D REPORTS channel formed by 54 doublelattice. Cylinders indicate double brane stem; orange strands with oligonucleotides that hybridize Geometric specifications of the tr = 6 nm, inner diame Yan and diameter coworkers, D Science (2013) fully surrounded by DNA helices of a 7-base strand extension actin for mutant M1 and l = 14 nm f B Fig. 1. Synthetic DNA membrane channels. (A) Schematic illustration of the channel formed by 54 double-helical DNA domains packed on a honeycomb lattice. Cylinders indicate double-helical DNA domains. Red denotes transmembrane stem; orange strands with orange ellipsoids indicate cholesterol-modified oligonucleotides that hybridize to single-stranded DNA adaptor strands. (B) Geometric specifications of the transmembrane channel. Length L = 47 nm, tube diameter D = 6 nm, inner diameter d = 2 nm. The length of the central channel fully surrounded by DNA helices is 42 nm. The star symbol indicates the position of a 7-base strand extension acting as a defect in channel mutants [l = 15 nm for mutant M1 and l = 14 nm for mutant M2; see text S6 and cadnano maps Yan and coworkers, Science (2011) rvatures. (A) Schematic representation of the hem(c) Schematic representation of the ellipsoid. (D) TEM EM grids. The concave surface is visible as a dark area. d on TEM grids. Due to the spherical symmetry, the of the ellipsoid. The outline of the ellipsoid is visible. 0 nm. (G) Schematic representation of the nanoflask.. (I) TEM images of the nanoflask, randomly deposited om of the flask are clearly visible in the images. Scale emag.org on September 27, SCIENCE (figs. S22 to S24)]. (C) Cross-sectio porated in a lipid bilayer. (D) Averag purified DNA channel structures ( displayed in figs. S1 and S2). (E an adhering to small unilamellar vesic oleoyl-sn-glycero-3-phosphocholine of vesicle size distribution and bindin to S9. (G) TEM image of DNA channe upper right part of the image. DNA covered areas or sticking to SUVs (s VOL NOVEMBER 2 Fig. 4. Schematics (left), (middle), and TEM images (right)30ofmm(a) an and (C), the diam 12.5AFM mm MgCl MgCl S-shaped structure, a sphere, (C) aspherical screw. All scale bars indicate 200 nm, images compared Fig. 4. Bending enables the design of intricate nonlinear shapes. Red single scaffold strand(b) designed to fold into aand 50-nm-wide wireframe 25 nm emag.org nanorobot (15 MD) that can be reversibly reconfigured in three different con4. Reversibly reconfigurable non base pairing multistate DNA devices segments indicate regions in which deletions and insertions are installed. capsule resembling a beach ball and four typical particles representing Shih and coworkers, Science (2009) and all zoom-in images (images without scale bars) are 200 by 200 nm. In (B) flattening of the Scaleshapes. bars, 20 nm. Modelrow: of a schematic 3-by-6 helix DNA-origami bundle different of the beach ball. The design states: folds as six Dietz bent crosses and coworkers, Science formational disassembled, and assembled with (2015) open or closed arms, h arbitrary (A)(A)Top representations of aprojections reconfig5 mm MgCl2 designed to bend into a half-circle with a 25-nm radius that bears three 2 (inset) connected on a single scaffold. (D) A concave triangle that is folded 2
6 Cryo-electron microscopy and all-atom simulation for DNA origami structure prediction Reference structure docked into cryo-em 2 RMSD of scaffold (nm) time (ns) PNAS 109:20012 Nucleic Acids Research 44:3013
7 Comparison between simulation and experiment EM density psuedo-atomic model Nucleic Acids Research 44:3013 simulation
8 Interactions in a simple coarse-grained DNA model 4 nm cutoff 100 mm
9 Coarse-grained model captures programmed curvature Design and TEM: Science 325:725
10 Adaptive resolution simulation of DNA origami systems Andersen et al., Nature 2009 Birkedal Group
11 DNA-based Voltage sensing Keyser Group Experimental setup All-atom MD simulation 5 na 150 ms ACS Nano 9: (2015) Idea: use DNA origami as a local voltage probe
12 Design of a nanoscale voltage sensor Keyser and Tinnefeld Groups Nano Lett., doi: /acs.nanolett.7b05354 (2018)
13 Coarse-grained simulations of a FRET plate capture ~5 bp/bead CG model 40 µs simulations 100 mv 200 mv 300 mv 400 mv 600 mv Nano Lett., doi: /acs.nanolett.7b05354 (2018)
14 CG simulation of FRET efficiency 2 beads/bp CG model 1 µs simulations 100 mv 400 mv 200 mv Design A1 300 mv Nano Lett., doi: /acs.nanolett.7b05354 (2018)
15 Voltage sensing with DNA origami Experiment: Simulation: Nano Lett., doi: /acs.nanolett.7b05354 (2018)
16 DNA Ion Channels Jejoong Yoo Nano Letters, 13: 2351 Porins, 1 ns conductance Yoo & Aksimentiev, JPCL 6, 4680 (2015)
17 DNA Ion Channels Conductance < 0.1 ns Membrane channel made of a single DNA duplex (0.1 ns) Nano Letters 16:4665 (2016) Gramicidin ion channels Chen-Yu Li Porin-like DNA channel 40 ns Keyser Group ACS Nano 10:8207 (2016)
18 All-atom MD simulation of lipid-dna interface Chen Yu Li No applied electric field Lipid molecule around the DNA channel can translocate to the other leaflet.
19 Lipid translocation through toroidal pores is very common and very fast
20 Lipid translocation through toroidal pores is very common and very fast DPhPE DPhPC 3-5 orders of magnitude faster than natural scramblases scramblase
21 Experimental verification Scale bars are 10 µm Keyser Group Ohmann, Li, Ulrich F. Keyser, Aksimentiev,
22 Works in human cells Annexin V binds specifically to PS lipids found in inner leaflet of human cells Breast cancer cells from the cell line MDA-MB-231 Positive control: apoptosis-inducing microbial alkaloid staurosporine Negative control: DNA folding buffer Scale bar is 20 µm
23 Acknowledgements Aksimentiev Group Aleksei Aksimentiev Chen-Yu Li Jejoong Yoo Center for Macromolecular Modeling and Bioinformatics Victoria Birkedal Ulrich Keyser Philip Tinnefeld
DNA nanotechnology. Aleksei Aksimentiev Department of Physics, UIUC
DNA nanotechnology Aleksei Aksimentiev Department of Physics, UIUC 1 DNA up-close backbone sugar ring base phosphate Double stranded DNA 5 -AAGCTGGTTCAG-3 Single stranded DNA DNA up-close backbone nucleotide
More informationIntroduction to Simulation and Modeling of DNA Systems. Aleksei Aksimentiev Department of Physics, University of Illinois at Urbana -Champaign
Introduction to Simulation and Modeling of DNA Systems Aleksei Aksimentiev Department of Physics, University of Illinois at Urbana -Champaign DNA, the blueprint A nucleus of a human cell contains 23x2
More informationSupporting Information: In situ structure and dynamics of DNA origami determined through molecular dynamics simulations
Supporting Information: In situ structure and dynamics of DNA origami determined through molecular dynamics simulations Jejoong Yoo and Aleksei Aksimentiev Department of Physics and Center for the Physics
More information(a) Overview of the 2-helix bundle (2HB) nanospring design used in this study. The
1 Supplementary Figure 1 Design of the DNA origami spring (nanospring). (a) Overview of the 2-helix bundle (2HB) nanospring design used in this study. The scheme was produced by cadnano software 1. Scaffold,
More informationFinal exam. Please write your name on the exam and keep an ID card ready.
Biophysics of Macromolecules Prof. R. Jungmann and Prof. J. Lipfert SS 2017 Final exam Final exam First name: Last name: Student number ( Matrikelnummer ): Please write your name on the exam and keep an
More informationSupporting Information for: Plasmonic Nanopores. for Trapping, Controlling Displacement, and. Sequencing of DNA
Supporting Information for: Plasmonic Nanopores for Trapping, Controlling Displacement, and Sequencing of DNA Maxim Belkin, Shu-Han Chao, Magnus P. Jonsson,,, Cees Dekker,, and Aleksei Aksimentiev, Department
More informationTechnical Seminar 22th Jan 2013 DNA Origami
Technical Seminar 22th Jan 2013 DNA Origami Hitoshi Takizawa, PhD Agenda 1) Basis of structural DNA nanotechnology 2) DNA origami technique (2D, 3D, complex shape) 3) Programmable nanofactory 4) Application
More informationSupporting Information Defined Bilayer Interactions of DNA Nanopores Revealed with a Nuclease-Based Nanoprobe Strategy
Supporting Information Defined Bilayer Interactions of DNA Nanopores Revealed with a Nuclease-Based Nanoprobe Strategy Jonathan R. Burns* & Stefan Howorka* 1 Contents 1. Design of DNA nanopores... 3 1.1.
More informationSUPPLEMENTARY INFORMATION
A biomimetic DNA-based channel for the ligand-controlled transport of charged molecular cargo across a biological membrane Jonathan R. Burns, Astrid Seifert, Niels Fertig, Stefan Howorka NATURE NANOTECHNOLOGY
More informationThe Computational Microscope. Main funding: simulation of an entire virus
The Computational Microscope Klaus Schulten Dept. Physics / Beckman Institute, U. Illinois NIH., October 2007 Main funding: simulation of an entire virus The Computational Microscope Computational Microscope
More informationStructural Bioinformatics (C3210) DNA and RNA Structure
Structural Bioinformatics (C3210) DNA and RNA Structure Importance of DNA/RNA 3D Structure Nucleic acids are essential materials found in all living organisms. Their main function is to maintain and transmit
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1. Mechanism for signal-induced opening of the DNA box. a, An atomic model of the DNA box held closed by locks (orange and blue) that are double helices formed by two short strands
More informationDNA Glycosylase Exercise
Name StarBiochem DNA Glycosylase Exercise Background In this exercise, you will use StarBiochem, a protein 3-D viewer, to explore the structure of a DNA repair protein found in most species, including
More informationNucleic acids. How DNA works. DNA RNA Protein. DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology
Nucleic acid chemistry and basic molecular theory Nucleic acids DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology Cell cycle DNA RNA Protein Transcription Translation
More informationAn Investigation of Mechanical. Properties of DNA Origami. Nanostructures
An Investigation of Mechanical Properties of DNA Origami Nanostructures HONORS THESIS Submitted to The Engineering Honors Committee 119 Hitchcock Hall College of Engineering The Ohio State University Columbus,
More informationActive delivery of single DNA molecules into a plasmonic nanopore for. label-free optical sensing
Supporting Information: Active delivery of single DNA molecules into a plasmonic nanopore for label-free optical sensing Xin Shi 1,2, Daniel V Verschueren 1, and Cees Dekker 1* 1. Department of Bionanoscience,
More informationGene and DNA structure. Dr Saeb Aliwaini
Gene and DNA structure Dr Saeb Aliwaini 2016 DNA during cell cycle Cell cycle for different cell types Molecular Biology - "Study of the synthesis, structure, and function of macromolecules (DNA, RNA,
More informationNIH Public Access Author Manuscript Science. Author manuscript; available in PMC 2010 February 7.
NIH Public Access Author Manuscript Published in final edited form as: Science. 2009 August 7; 325(5941): 725 730. doi:10.1126/science.1174251. Folding DNA into Twisted and Curved Nanoscale Shapes Hendrik
More informationDNA Repair Protein Exercise
Name StarBiochem DNA Repair Protein Exercise Background In this exercise, you will use StarBiochem, a protein 3-D viewer, to explore the structure of a DNA repair protein found in most species, including
More informationSupplementary Information. Arrays of Individual DNA Molecules on Nanopatterned Substrates
Supplementary Information Arrays of Individual DNA Molecules on Nanopatterned Substrates Roland Hager, Alma Halilovic, Jonathan R. Burns, Friedrich Schäffler, Stefan Howorka S1 Figure S-1. Characterization
More information1.1 Chemical structure and conformational flexibility of single-stranded DNA
1 DNA structures 1.1 Chemical structure and conformational flexibility of single-stranded DNA Single-stranded DNA (ssdna) is the building base for the double helix and other DNA structures. All these structures
More informationExcess Titanium Dioxide Nanoparticles on Cell Surface Induce Cytotoxicity by Hindering Ion Exchange and Disrupting Exocytosis Processes
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2015 Supporting Information Excess Titanium Dioxide Nanoparticles on Cell Surface Induce Cytotoxicity
More informationSupporting Information
Supporting Information Wiley-VCH 2014 69451 Weinheim, Germany Complex Reconfiguration of DNA Nanostructures** Bryan Wei,* Luvena L. Ong, Jeffrey Chen, Alexander S. Jaffe, and Peng Yin* ange_201402437_sm_miscellaneous_information.pdf
More informationMCB 110:Biochemistry of the Central Dogma of MB. MCB 110:Biochemistry of the Central Dogma of MB
MCB 110:Biochemistry of the Central Dogma of MB Part 1. DNA replication, repair and genomics (Prof. Alber) Part 2. RNA & protein synthesis. Prof. Zhou Part 3. Membranes, protein secretion, trafficking
More informationINDIAN INSTITUTE OF TECHNOLOGY ROORKEE NPTEL NPTEL ONLINE CERTIFICATION COURSE. Biomedical Nanotechnology. Lec - 06 DNA Nanotechnology
INDIAN INSTITUTE OF TECHNOLOGY ROORKEE NPTEL NPTEL ONLINE CERTIFICATION COURSE Biomedical Nanotechnology Lec - 06 DNA Nanotechnology Dr. Arup Kumar Das Department of Mechanical and Industrial Engineering
More informationCurrent ( pa) Current (pa) Voltage (mv) Voltage ( mv)
Current ( pa) 3000 2000 1000 0-1000 -2000-3000 a -400-200 0 200 400 Voltage (mv) P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 P11 P12 P13 P14 P15 P16 P17 P18 Average Current (pa) 4500 3000 1500 0-1500 -3000-4500 b -400-200
More informationMaking a Model of DNA Instructions
Instructions 1) Colour the individual structures on the worksheet as follows: adenine = red guanine = blue phosphate = brown thymine = green cytosine = yellow deoxyribose = purple 2) Cut out each structure.
More informationBy the end of today, you will have an answer to: How can 1 strand of DNA serve as a template for replication?
Name: Period: Date: KIPP NYC College Prep Genetics and Biotech UNIT 9: Introduction to DNA Lecture 4: DNA Modeling and Intro to Replication By the end of today, you will have an answer to: How can 1 strand
More informationToward sequencing DNA with a synthetic nanopore
Toward sequencing DNA with a synthetic nanopore Aleksei Aksimentiev University of Illinois at Urbana-Champaign Bio- Nano Systems DNA up-close backbone sugar ring base phosphate Double stranded DNA 5 -AAGCTGGTTCAG-3
More informationSupporting Information. Label-Free Optical Detection of DNA. Translocations Through Plasmonic Nanopores
Supporting Information Label-Free Optical Detection of DNA Translocations Through Plasmonic Nanopores Daniel V. Verschueren 1, Sergii Pud 1, Xin Shi 1,2, Lorenzo De Angelis 3, L. Kuipers 3, and Cees Dekker
More informationDBP4: Biosensors. DNA passing through a nanopore (all-atom MD simulation) Diamond thin films as tethering surfaces for bacterial capture
8 DBP4: Biosensors Biomedical relevance Significance and challenges Biosensors provide unique ways to investigate and monitor the health of a living body. Computational microscope can image nanodevices
More informationYour Name: MID TERM ANSWER SHEET SIN: ( )
MIDTERM EXAMINATION (October 23, 2008) BIOE150. Introduction to Bio-Nanoscience & Bio-Nanotechnology Professor Seung-Wuk Lee Fall Semester, 2008 0. Write down your name and the last digit of your SIN in
More informationHmwk 6. Nucleic Acids
The purpose of this homework exercise is Hmwk 6. Nucleic Acids 1). to recognize fundamental features of B-form DNA and A-form RNA 2). to view the folded structure of trna B-FORM DNA In aqueous solutions,
More informationLecture 13. Motor Proteins I
Lecture 13 Motor Proteins I Introduction: The study of motor proteins has become a major focus in cell and molecular biology. Motor proteins are very interesting because they do what no man-made engines
More informationDNA. The Rise of the. Nanorobots. When designed properly, DNA folds into tiny devices that move like macroscopic machines.
The Rise of the DNA Nanorobots When designed properly, DNA folds into tiny devices that move like macroscopic machines. MECHANICAL ENGINEERING AUGUST 2016 P.45 Throughout the patient s body, the tiny robots
More informationMolecular Biology (1)
Molecular Biology (1) DNA structure and basic applications Mamoun Ahram, PhD Second semester, 2017-2018 Resources This lecture Cooper, pp. 49-52, 118-119, 130 What is molecular biology? Central dogma
More informationDetection of local protein structures along DNA using solid-state nanopores
Detection of local protein structures along DNA using solid-state nanopores nanopore Stefan Kowalczyk Adam Hall Cees Dekker RecA-DNA filament (Nano Letters cover September 2009) Bremen 29-06-2009 Main
More informationFundamentals of Organic Chemistry. CHAPTER 10: Nucleic Acids
Fundamentals of Organic Chemistry CHEM 109 For Students of Health Colleges Credit hrs.: (2+1) King Saud University College of Science, Chemistry Department CHEM 109 CHAPTER 10: Nucleic Acids 2 o Nucleic
More informationBCH302 [Practical] 1
BCH302 [Practical] 1 2 DNA is made of 2 polynucleotide chains which run in opposite direction antiparallel. DNA has a double helical structure. Each polynucleotide chain of DNA consists of monomer units
More informationThe Double Helix. DNA and RNA, part 2. Part A. Hint 1. The difference between purines and pyrimidines. Hint 2. Distinguish purines from pyrimidines
DNA and RNA, part 2 Due: 3:00pm on Wednesday, September 24, 2014 You will receive no credit for items you complete after the assignment is due. Grading Policy The Double Helix DNA, or deoxyribonucleic
More informationLight Sensitization of DNA Nanostructures via Incorporation of Photo-Cleavable Spacers
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2016 Light Sensitization of DNA Nanostructures via Incorporation of Photo-Cleavable Spacers
More informationDiscoveries Through the Computational Microscope
Discoveries Through the Computational Microscope Accuracy Speed-up Unprecedented Scale Investigation of drug (Tamiflu) resistance of the swine flu virus demanded fast response! Klaus Schulten Department
More informationFRET Enhancement close to Gold Nanoparticle. Positioned in DNA Origami Constructs
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information FRET Enhancement close to Gold Nanoparticle Positioned in
More informationCGTAAGAGTACGTCCAGCATCGGF ATCATTATCTACATCXXXXXTACCATTCATTCAGATCTCACTATCGCATTCTCATGCAGGTCGTAGCCXS
5 CGTAAGAGTACGTCCAGCATCGGF ATCATTATCTACATCXXXXXTACCATTCATTCAGATCTCACTATCGCATTCTCATGCAGGTCGTAGCCXS 29 Supplementary Figure 1 Sequence of the DNA primer/template pair used in Figure 1bc. A 23nt primer is
More informationLecture 5. Biomolecular Self-assembly (and Detection)
10.524 Lecture 5. Biomolecular Self-assembly (and Detection) Instructor: Prof. Zhiyong Gu (Chemical Engineering & UML CHN/NCOE Nanomanufacturing Center) Lecture 6: Biomolecular Self-assembly Table of Contents
More informationDNA AND CHROMOSOMES. Genetica per Scienze Naturali a.a prof S. Presciuttini
DNA AND CHROMOSOMES This document is licensed under the Attribution-NonCommercial-ShareAlike 2.5 Italy license, available at http://creativecommons.org/licenses/by-nc-sa/2.5/it/ 1. The Building Blocks
More informationRNA does not adopt the classic B-DNA helix conformation when it forms a self-complementary double helix
Reason: RNA has ribose sugar ring, with a hydroxyl group (OH) If RNA in B-from conformation there would be unfavorable steric contact between the hydroxyl group, base, and phosphate backbone. RNA structure
More informationSupporting Information for. Localized DNA Hybridization Chain Reactions. on DNA Origami
Supporting Information for Localized DNA Hybridization Chain Reactions on DNA Origami Hieu Bui 1,3*, Shalin Shah 2*, Reem Mokhtar 1, Tianqi Song 1, Sudhanshu Garg 1, John Reif 1,2 1 Department of Computer
More informationChapter 9: DNA: The Molecule of Heredity
Chapter 9: DNA: The Molecule of Heredity What is DNA? Answer: Molecule that carries the blueprint of life General Features: DNA is packages in chromosomes (DNA + Proteins) Gene = Functional segment of
More informationWhat Are the Chemical Structures and Functions of Nucleic Acids?
THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic
More informationCSCI 2570 Introduction to Nanocomputing
CSCI 2570 Introduction to Nanocomputing DNA Computing John E Savage DNA (Deoxyribonucleic Acid) DNA is double-stranded helix of nucleotides, nitrogen-containing molecules. It carries genetic information
More informationActivity A: Build a DNA molecule
Name: Date: Student Exploration: Building DNA Vocabulary: double helix, DNA, enzyme, lagging strand, leading strand, mutation, nitrogenous base, nucleoside, nucleotide, replication Prior Knowledge Questions
More informationA Domain Swapping Study of Nano-Capsule Proteins. Rongli Fan, Aimee L. Boyle, Vee Vee Cheong, See Liang Ng, Brendan P. Orner*
A Domain Swapping Study of Nano-Capsule Proteins Rongli Fan, Aimee L. Boyle, Vee Vee Cheong, See Liang Ng, Brendan P. Orner* Figure S1. Amino acid sequences of proteins used in this study. Grey shading
More informationSupplementary Figure 1 Two distinct conformational states of the HNH domain in crystal structures. a
Supplementary Figure 1 Two distinct conformational states of the HNH domain in crystal structures. a HNH-state 1 in PDB 4OO8, in which the distance from the C atom of the HNH catalytic residue 840 to the
More informationWhich diagram represents a DNA nucleotide? A) B) C) D)
3594-1 - Page 1 Name: 1) What is a definition of the term "gene"? A) a transfer-rna nucleotide sequence specific for a particular amino acid B) three messenger-rna nucleotides coded for a specific amino
More informationChapter 10. DNA: The Molecule of Heredity. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc.
Chapter 10 DNA: The Molecule of Heredity Lectures by Gregory Ahearn University of North Florida Copyright 2009 Pearson Education, Inc. 10.1 What Is The Structure Of DNA? Deoxyribonucleic acid (DNA) is
More informationSupporting Information
Supporting Information Terasawa et al. 10.1073/pnas.1120327109 SI Materials and Methods Modeling of Shape Transformation. To determine whether the depletion volume effect can drive budding transformation,
More informationAnalysis of Solid State Nanopore for Signal Processing and Control
Nguyen 1 Analysis of Solid State Nanopore for Signal Processing and Control Nathan N. Nguyen, Christopher R. O Donnell, Raj Maitra, William B. Dunbar University of California - Santa Cruz, Santa Cruz,
More informationTileSoft: Sequence Optimization Software for Designing DNA Secondary Structures
1 TileSoft: Sequence Optimization Software for Designing DNA Secondary Structures P. Yin*, B. Guo*, C. Belmore*, W. Palmeri*, E. Winfree, T. H. LaBean* and J. H. Reif* * Department of Computer Science,
More informationDNA and RNA Structure Guided Notes
Nucleic acids, especially DNA, are considered as the key biomolecules that guarantee the continuity of life. DNA is the prime genetic molecule which carry all the hereditary information that's passed from
More informationAppendix A DNA and PCR in detail DNA: A Detailed Look
Appendix A DNA and PCR in detail DNA: A Detailed Look A DNA molecule is a long polymer consisting of four different components called nucleotides. It is the various combinations of these four bases or
More informationHmwk # 8 : DNA-Binding Proteins : Part II
The purpose of this exercise is : Hmwk # 8 : DNA-Binding Proteins : Part II 1). to examine the case of a tandem head-to-tail homodimer binding to DNA 2). to view a Zn finger motif 3). to consider the case
More informationWhat is Nano-Bio? Non-Covalent Interactions
- - What is Nano-Bio? Physicist: Biotech: Biologists: -study of molecular interactions -application of nano-tools to study biological systems. -application of nano-tools to detect, treat, and prevent disease
More informationBIO 101 : The genetic code and the central dogma
BIO 101 : The genetic code and the central dogma NAME Objectives The purpose of this exploration is to... 1. design experiments to decipher the genetic code; 2. visualize the process of protein synthesis;
More informationNucleic Acids. Information specifying protein structure
Nucleic Acids Nucleic acids represent the fourth major class of biomolecules (other major classes of biomolecules are proteins, carbohydrates, fats) Genome - the genetic information of an organism Information
More informationLesson 1 Introduction to Restriction Analysis
Lesson 1 Introduction to Restriction Analysis Consideration 1. How Does DNA Become Fragmented Into Pieces? DNA consists of a series of nitrogenous base molecules held together by weak hydrogen bonds. These
More informationMOLECULAR STRUCTURE OF DNA
MOLECULAR STRUCTURE OF DNA Characteristics of the Genetic Material 1. Replication Reproduced and transmitted faithfully from cell to cell (generation to generation) 2. Information Storage Biologically
More informationInformation specifying protein structure. Chapter 19 Nucleic Acids Nucleotides Are the Building Blocks of Nucleic Acids
Chapter 19 Nucleic Acids Information specifying protein structure Nucleic acids represent the fourth major class of biomolecules (other major classes of biomolecules are proteins, carbohydrates, fats)
More informationtranslation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
More informationChapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc.
Chapter 8 Microbial Genetics Lectures prepared by Christine L. Case Structure and Function of Genetic Material Learning Objectives 8-1 Define genetics, genome, chromosome, gene, genetic code, genotype,
More informationMolecular Genetics Quiz #1 SBI4U K T/I A C TOTAL
Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct
More informationDNA Fingerprinting. The DNA fingerprinting technique is summarized as follows:
DNA Fingerprinting Introduction Laboratory techniques called DNA fingerprinting have been developed to identify or type an individual's DNA. One application of these techniques has been in solving crimes.
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature06147 SUPPLEMENTARY INFORMATION Figure S1 The genomic and domain structure of Dscam. The Dscam gene comprises 24 exons, encoding a signal peptide (SP), 10 IgSF domains, 6 fibronectin
More informationSupporting Information
Supporting Information Velocity of DNA during translocation through a solid state nanopore Calin Plesa, Nick van Loo, Philip Ketterer, Hendrik Dietz, Cees Dekker Department of Bionanoscience, Kavli Institute
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature08627 Supplementary Figure 1. DNA sequences used to construct nucleosomes in this work. a, DNA sequences containing the 601 positioning sequence (blue)24 with a PstI restriction site
More informationSupporting Information
Copyright WILEY-VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 2014. Supporting Information for Small, DOI: 10.1002/smll.201303558 Ultraspecific and Highly Sensitive Nucleic Acid Detection by Integrating
More informationDNA and RNA Structure. Unit 7 Lesson 1
Unit 7 Lesson 1 Students will be able to: Explain the structure and function of the DNA and RNA. Illustrate the structure of nucleotide. Summarize the differences between DNA and RNA. Identify the different
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationSuppl. Figure 1: RCC1 sequence and sequence alignments. (a) Amino acid
Supplementary Figures Suppl. Figure 1: RCC1 sequence and sequence alignments. (a) Amino acid sequence of Drosophila RCC1. Same colors are for Figure 1 with sequence of β-wedge that interacts with Ran in
More informationDNA and RNA are both composed of nucleotides. A nucleotide contains a base, a sugar and one to three phosphate groups. DNA is made up of the bases
1 DNA and RNA are both composed of nucleotides. A nucleotide contains a base, a sugar and one to three phosphate groups. DNA is made up of the bases Adenine, Guanine, Cytosine and Thymine whereas in RNA
More informationWelcome! Virtual tutorial starts at 15:00 GMT. Please leave feedback afterwards at:
Welcome! Virtual tutorial starts at 15:00 GMT Please leave feedback afterwards at: www.archer.ac.uk/training/feedback/online-course-feedback.php Multi-resolution modelling of biological systems in LAMMPS
More informationSelf-assembly of oligonucleotides
Self-assembly of oligonucleotides Dr. K. Uma Maheswari Professor, School of Chemical & Biotechnology SASTRA University Joint Initiative of IITs and IISc Funded by MHRD Page 1 of 9 Table of Contents 1 APPLICATIONS
More informationDiscoveries Through the Computational Microscope Accuracy Speed-up Unprecedented Scale
Discoveries Through the Computational Microscope Accuracy Speed-up Unprecedented Scale Investigation of drug (Tamiflu) resistance of the swine flu virus demanded fast response! Klaus Schulten Department
More informationThe Blueprint of Life DNA & Protein Synthesis
The Blueprint of Life DNA & Protein Synthesis Why Do You Look Like That? Hair on your head grows up to 25 inches, but hair on our eyebrows grows only an inch or less. Why? Humans have five fingers on each
More informationWrite: Unit 5 Review at the top.
Warm-up Take out a sheet of paper: Write: Unit 5 Review at the top. As each question goes on the board, write that question down and answer it. When answers come up, either write correct next to what you
More informationBASIC MOLECULAR GENETIC MECHANISMS Introduction:
BASIC MOLECULAR GENETIC MECHANISMS Introduction: nucleic acids. (1) contain the information for determining the amino acid sequence & the structure and function of proteins (1) part of the cellular structures:
More informationReview of Old Information: What is the monomer and polymer of: Macromolecule Monomer Polymer Carbohydrate Lipid Protein
Section 1.8 Question of the Day: Name: Review of Old Information: What is the monomer and polymer of: Macromolecule Monomer Polymer Carbohydrate Lipid Protein New Information: One of the most important
More informationHow Can Pieces of DNA Solve a Puzzle?
Introduction How Can Pieces of DNA Solve a Puzzle? One of the basic tools of modern biotechnology is DNA splicing: cutting DNA and linking it to other DNA molecules. The basic concept behind DNA splicing
More informationG-quadruplexes light up localized DNA circuits.
G-quadruplexes light up localized DNA circuits. Oscar Mendoza,*,, Jean-Louis Mergny,, Jean-Pierre Aimé, and Juan Elezgaray*,, Univ. Bordeaux, 33600 Bordeaux, France CBMN, CNRS UMR-5248, F-33600 Pessac,
More informationCentral Dogma. 1. Human genetic material is represented in the diagram below.
Central Dogma 1. Human genetic material is represented in the diagram below. 4. If 15% of a DNA sample is made up of thymine, T, what percentage of the sample is made up of cytosine, C? A) 15% B) 35% C)
More informationLecture 2: Central Dogma of Molecular Biology & Intro to Programming
Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Central Dogma of Molecular Biology Proteins: workhorse molecules of biological systems Proteins are synthesized from the genetic blueprints
More informationThe Structure of DNA
Name: The Structure of DNA 06/08/11 Students will turn in: 1. Assignment 1: DNA Worksheet 2. Assignment 2: Poster Draw a poster of the ladder structure of DNA, labeled. 3. Assignment 3: The completed DNA
More informationSupporting Information. DNA Tetraplexes-Based Toehold Activation for Controllable DNA Strand Displacement Reactions
Supporting Information DNA Tetraplexes-Based Toehold Activation for Controllable DNA Strand Displacement Reactions Wei Tang, Huaming Wang, Dingzhong Wang, Yan Zhao, Na Li, and Feng Liu* Beijing National
More informationDNA. Deoxyribose Nucleic Acid
DNA Deoxyribose Nucleic Acid Biomolecules Remember 1. Carbohydrates 2. Lipids 3. Nucleic acids hold genetic information; code for proteins 4. Proteins History of DNA Who Discovered DNA Rosalind Franklin
More informationComputational methods in bioinformatics: Lecture 1
Computational methods in bioinformatics: Lecture 1 Graham J.L. Kemp 2 November 2015 What is biology? Ecosystem Rain forest, desert, fresh water lake, digestive tract of an animal Community All species
More informationNature Structural & Molecular Biology: doi: /nsmb.2996
Supplementary Figure 1 Negative-stain EM of native cytoplasmic dynein. (a) A representative micrograph of negatively stained dynein, with the flexible dimeric molecules circled in white. (b) Reference-free
More informationSupplementary material 1: DNA tracing
Supplementary material 1: DNA tracing Figure S1:Typical AFM image showing DNA molecules relaxed when deposited with Mg 2+ DNA molecules that appear to have a higher or larger end (indicated by a red arrow
More informationMolecular Biology. IMBB 2017 RAB, Kigali - Rwanda May 02 13, Francesca Stomeo
Molecular Biology IMBB 2017 RAB, Kigali - Rwanda May 02 13, 2017 Francesca Stomeo Molecular biology is the study of biology at a molecular level, especially DNA and RNA - replication, transcription, translation,
More informationReviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): In their manuscript "Single Molecule Mirage: shifted molecular localizations through plasmonic coupling", Raab et al evaluate the effect that plasmonic
More informationThe Development of a Four-Letter Language DNA
The Development of a Four-Letter Language DNA The Griffith Experiment Chromosomes are comprised of two types of macromolecules, proteins and DNA, but which one is the stuff of genes? the answer was discovered
More information