Supporting Information

Transcription

1 Supporting Information Soft Conducting Polymer Hydrogels Cross-Linked and Doped by Tannic Acid for Spinal Cord Injury Repair Lei Zhou, 1, 2, # Lei Fan, 1, 2, 3, # Xin Yi, 1,2 Zhengnan Zhou, 4 Can liu, 3 Ruming Fu, 1, 2 Cong Dai, 4 Zhengao Wang, 1, 2 Xiuxing Chen, 6 Peng Yu, 1, 2 Dafu Chen, 5 Guoxin Tan, 4,* Qiyou Wang, 3,* 1, 2, * and Chengyun Ning 1 College of Materials Science and Technology, South China University of Technology, Guangzhou, , China 2 National Engineering Research Center for Tissue Restoration and Reconstruction, South China University of Technology, Guangzhou, , China 3 Department of Spine Surgery, The Third Affiliated Hospital of Sun Yat-sen University, Guangzhou, , China 4 School of Chemical Engineering and Light Industry, Guangdong University of Technology, Guangzhou, , China 5 Laboratory of Bone Tissue Engineering, Beijing Research Institute of Orthopaedics and Traumatology, Beijing JiShuiTan Hospital, Beijing, , China 6 VIP Inpatient Department, Sun Yat-sen University Cancer Center, Guangzhou, , China # These authors contributed equally to this work. *Correspondence and requests for materials should be addressed to G.T.( tanguoxin@126.com), Q. W.( wqiyou@163.com) or C.N.( imcyning@scut.edu.cn) S1

2 Figure S1. FT-IR spectra of the pristine PPy, TA and CPHs samples. S2

3 Figure S2. Photographs of the CPH self-recovery process. a-c) The hydrogel was cut into two pieces, put together and adhered into one block again. d-f) Photographs of a electrical selfrecovery hydrogel serving as a conductor to light an LED before breaking, after breaking, and after bonding, respectively. The LED indicator was successfully lighted if a driving voltage of 5 V was applied. The LED indicator turned off when the hydrogel was completely cutted into two pieces and the circuit became open-circuit state (Figure S3e). The LED lamp was lit up again after self-adhesion of the hydrogel. j) I-V curve showing the electrical recovery in self-adhered CPH samples. S3

4 Figure S3. A high magnification SEM image showing interconnected globular nanoparticles morphology of the CPH S4

5 Figure S4. Cyclic voltammograms (10 mv s 1 ) of the electrochemically stable CPHs immersed in 0.1 M PBS for 2 weeks. After 1 day of incubation in PBS, we observed a decrease in the current densities for both oxidation and reduction, which may be attributed to a slight loss of dopant (TA) at early stages. However, the current response remained stable after 2 weeks of incubation in PBS. The superior electronic stability of hydrogel is most likely attributed to strong interactions between TA and PPy chains, which block the possibility of further loss of dopant molecules. S5

6 Figure S5. Cell viability of NSCs cultured on different substrates over time evaluated by a quantitative a) CCK-8 assay showing the cell viability was close to or exceeded 80% for all three hydrogels 1, 3, and 7 days after seeding, suggesting that the engineered TA-PPy gels are not cytotoxic against NSCs and qualitative b) live/dead fluorescence staining images at 24 h, showing excellent viability and firm attachment to the hydrogel surface 24 h after seeding (scale bars, 100 µm). S6

7 Figure S6. Image of CPH patch bound to spinal cord at 6 weeks after the operation. Red arrow indicated tissue infiltration into partial area of the hydrogel. Figure S7. Immunostaining of implanted CPHs showing an insignificant amount of microglia/macrophages (CD68) compared to that of the Sham group. (Scale bars, 200 µm), but SCI group have a big increase in CD 68 immunostaining levels. S7

8 Figure S8. Evaluation of CPHs hydrogel decomposition in vivo. Immunofluorescence histochemical images of the hydrogel with the surrounding tissue double-stained with Tuj1 (green) and GFAP (red) after 2 weeks and 6 weeks of implantation. Cavities formed inside the material with neurons and astrocyte infiltrates over time, which indicated that the hydrogel can be decomposable and absorbable in vivo (Blue color represents the nuclei (Hoe), scale bars =100 µm). Figure S9. Mason s trichrome staining of the transverse spinal cord sections obtained from animals 6 weeks after an SCI (scale bars, 200 µm). The red dotted lines indicated the boundary between the host spinal cord and the lesion area. S8

9 Figure S10. Representative images of Nestin-immunostaining in transverse spinal cord sections of the hydrogel groups. Nestin-positive cells were observed around or inside the regenerating nerve tissues, which is indicative of endogenous NSCs migration. Blue color represents the nuclei (Hoe) (scale bars, 200 µm). Figure S11. The possible mechanism for CPH to promote tissue regeneration is to restore the interrupted spinal circuit as a highly electroactive bridge in a hemisection model of spinal cord injury. S9

10 Table S1. The primer sequences for each primer used in the real-time RT-PCR. Genes Primer sequences Annealing temperature ( C) GAPDH Forward:AGGTCGGTGTGAACGGATTTG Reverse: GGGGTCGTTGATGGCAACA 60 Tuj1 GFAP Forward: TCACGCAGCAGATGTTCGAT Reverse: GTGGCGCGGGTCACA Forward: CCTGAGAGAGATTCGCACTCAA Reverse: CTCCTCTGTCTCTTGCATGTTACTG Video S1. Restoration of right leg (lesioned side) locomotor function at 6 weeks post-injury for mouse with sham group, SCI group (untreated) and hydrogel group during overground locomotion. In the SCI group, the mouse is almost paralyzed in the right hind leg; whereas hydrogel treatment restored locomotion function (Kept extending and swinging its right hind leg). S10