(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site.

Size: px
Start display at page:

Download "(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site."

Transcription

1 SUPPLEMENTRY INFORMTION SUPPLEMENTL FIGURES Figure S1. () Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site. () Western blot of ligated and unligated sciatic nerves segments from 4 individual mice. (C) Western blot of ligated and unligated proximal optic nerves segments 4 individual mice. (D) Western blot of ligated and unligated proximal optic nerves 48 hours after injury. (E) Mouse spinal cord was injured by hemisection and dissected after 24 hours. Injured and uninjured spinal cord longitudinal sections were stained with the indicated antibodies. cetylated tubulin is detected following injury (white arrow). ar, 200µm. (F) 3.5mm-long longitudinal sections of sciatic nerves were stained with the indicated antibodies. White dashed arrow indicated the ligation site. ar, 500µm. (G) The intensity of acetylated and tyrosinated tubulin was normalized to α-tubulin along the 3.5mm-long longitudinal. Figure S2. Raw data plots and linear fitted lines of the normalized intensity of acetylated tubulin over α- tubulin as a function of distance. Figure S3. () Experimental scheme and representative images of spot cultured DRG neurons. ar, 500µm. () Quantification of maximum radial length (n=11 for vehicle, n=13 for scriptaid, mean ± SEM, ***p<0.001). 1

2 Figure S4. () Cell bodies of GFP-expressing DRG neurons were fixed following the in vitro regeneration assay. ar, 400µm. () GFP intensity in axons after axotomy at 0 hour (left panel). The GFP fluorescence intensity of a square area (2.7 x 0.1mm) at 0.1mm proximal to the axotomy line was measured both vehicle and scriptaid conditions (right panel, n=8 for each, mean ± SEM). Red dotted line indicates axotomy line. ar, 200µm. (C) The GFP fluorescence intensity in uninjured axons in both vehicle and scriptaid conditions was quantified (right panel, n=8 for each, mean ± SEM). ar, 200µm. Figure S5. () Representative image illustrating loss of YFP fluorescence at the crush site spanning ~1mm. ar, 200µm. () Representative longitudinal sections of crushed sciatic nerve stained with GP-43 and SMI hours after crush. ar, 200µm. (C) Quantification of normalized GP-43 intensity. GP-43 intensity was plotted in function of the distance from crush line (white dotted line in, n=3 for each, mean ± SEM). Figure S6. () Uninjured axons of control, HDC4, HDC5 or HDC6 knock down-drg neurons. () Raw data plots of the normalized intensity of acetylated tubulin over α-tubulin in function of distance. (C) Western blot analysis of DRG infected with, HDC4, HDC5 or HDC6 lentivirus. (D) Western blot analysis of DRG infected with or shhdc6 lentivirus. HDC5 does not affect the levels of HDC6, and vice versa, HDC6 knock down does not affect HDC5. (E) Representative western blot image and quantification of HDC5 phosphorylation level following a 2 hour sciatic nerve ligation (n=7, *p<0.05, mean ± SEM). 2

3 Figure S7. () HDC1, HDC2 or HDC3 were knocked down prior to axotomy and DRG neurons stained with the indicated antibodies. ar, 100µm. () verage intensity plot of normalized acetylated tubulin (n=6 for each, mean ± SEM). (C) The average of absolute values of slopes of acetylated tubulin intensity over a µµ distance: shhdc1, -x, 1.3 ± 0.5(x10-4 ), +x, 24.4 ± 2.6(x10-4 ); shhdc2, -x, 1.6 ± 0.8(x10-4 ), +x, 26.4 ± 0.9(x10-4 ); shhdc3, -x, 3.5 ± 1.6(x10-4 ), +x, 28.9 ± 5.7(x10-4 ) (***p<0.001, mean ± SEM). Figure S8. () Endogenous HDC5 was knocked down and HDC5 levels were rescued by coinfecting DRG neurons with an shrn resistant human HDC5 (GFP-hHDC5). xotomized neurons were stained with the indicated antibodies. () verage intensity plot of normalized acetylated tubulin. and is same plot as figure 5. (n=7, mean ± SEM). (C) The average of absolute values of slopes of acetylated tubulin intensity over a µm distance:, 19.9 ± 2.1(x10-4 );, 5.0 ± 1.4(x10-4 ); +GFP-hHDC5, 18.1 ± 2.4(x10-4 ) (***p<0.001, mean ± SEM). (D) Western blot analysis of DRG neurons following HDC5 knock down or GFP-hHDC5 expression. Figure S9. () Experimental scheme of the in vitro tubulin deacetylase (TDC) assay. FLG-HDCs were immunoprecipitated from HEK293T cells and incubated with sciatic nerve extracts. The supernatants and the precipitants were analyzed by western blot. () In vitro TDC assay with FLG-HDC5, in the presence or absence of 5µM scriptaid. (C) Quantification of 3

4 remaining level of acetylated tubulin (n=5, **p<0.01, mean ± SEM). (D) HDC6 does not coimmunoprecipitate with FLG-HDC5. (E) Experimental scheme of in vitro TDC assay with PM stimulation of HEK293T cells prior to immunoprecipitation and CIP treatment of the immunoprecipitated HDCs. Figure S10. () The level of acetylated tubulin following HDC5 or HDC6 knock down was analyzed in cultured DRG neurons in basal, non-injured conditions.. () Quantification of (n=4, **p<0.01, mean ± SEM). Figure S11. () Time-lapse acquisitions of Fluo-4M and phase contrast images of laser-axotomized DRG neurons. ar, 10µm. () Ligated and unligated sciatic nerve were treated with EGT and analyzed by western blot with the indicated antibodies. (C) DRG neurons were axotomized and stained with p-pkc and SMI-31. ar, 100µm. ar in magnified image, 50µm. (D) Representative western blot (left panel) and quantification of p-pkcµ in ligated (L) and unligated (U) sciatic nerve (right panel, n=5, **p<0.01, mean ± SEM). (E) Raw data plots of the normalized intensity of acetylated tubulin over α-tubulin in function of distance in the presence of the PKC inhibitor Go6983. Figure S12. () PKCµ was knocked down prior to axotomy and DRG neurons stained with the indicated antibodies. ar, 100µm. () verage intensity plot of normalized acetylated tubulin (n=6 for each, mean ± SEM). (C) The average of absolute values of slopes of acetylated tubulin 4

5 intensity over a µm distance: -x, 5.5 ± 1.6(x10-4 ) (n=6), +x, 9.0 ± 5.9(x10-4 ) (mean ± SEM). (D) Raw data plots of the normalized intensity of acetylated tubulin over α-tubulin as a function of distance. (E) Western blot analysis of DRG transduced by shpkcµ lentivirus. Figure S13. () Longitudinal sciatic nerves sections were stained with TUJ1, a-tubulin and S100β. () The relative intensity of α-tubulin co-localizing with the axon specific TUJ1-positive area or with the schwann cell specific S100b-positive area were measured (n=8, mean ± SEM, ***p<0.001). SUPPLEMENTL MOVIES: Movie 1. Effect of scriptaid treatment on DRG growth cone motility and morphology. ar, 10µm. Movie 2. Effect of vehicle treatment on DRG growth cone motility and morphology. bar, 10µm. Movie 3. Calcium influx induced by laser axotomy in DRG neuron. Red dot indicates laser axotomy spot. Top to bottom; Fluo-4 raw movie, intensity profile from raw movie and DIC. bar, 10µm. Movie 4. GFP-expressing control growth cone. ar, 5µm. Movie 5. GFP-expressing HDC5 knock-down growth cone. ar, 5µm. Movie 6. GFP-expressing hhdc5 overexpressed growth cone. ar, 5µm. 5

6 DRG Ligation Sciatic nerve P D Supplemental Data C c-tub Mouse1 Mouse2 Mouse3 Mouse4 U P U P U P U P c-tub Tyr-tub Mouse1 U P D Mouse2 Mouse3 Mouse4 U P D U P D U P D D c-tub Mouse1 Mouse2 U P U P E cetylated tubulin Merge Hemisection Control F nterior G Normalized intensity of c-tub (fold) Dorsal nterior Dorsal Normalized intensity of Tyr-tub (fold) c-tub Distance from ligation site (x1mm) Tyr-tub Cho et al., Figure S1 (related to figure 1)

7 Normalized intensity of -xotomy Normalized intensity of +xotomy Normalized intensity of +xotomy w/ scriptaid Cho et al., Figure S2 (related to figure 2)

8 Plating GFP Lentivirus +Vehicle or Scriptaid Fix DIV0 DIV1 DIV3 DIV6 Vehicle Scriptaid Scale bar = 500 m Maximum radial length (mm) Vehicle *** Scriptaid Cho et al., Figure S3 (related to figure 3)

9 Vehicle Scriptaid 0 hour after axotomy Vehicle Scriptaid Fluorescence intensity (.U.) Vehicle() n.s. Scriptaid() C Vehicle Un-injured axons Scriptaid Fluorescence intensity (.U.) Vehicle n.s. Scriptaid Cho et al., Figure S4 (related to figure 4)

10 Proximal Distal 2 hours after crush GP-43 GP-43/SMI-31 C Scriptaid Vehicle Normalized GP-43 intensity (fold) Distance from crush site ( m) Cho et al., Figure S5 (related to figure 4)

11 -xotomy cetylated tubulin Merge -xotomy +xotomy shhdc6 shhdc4 C No virus shhdc4 HDC4 No virus HDC5 No virus shhdc6 HDC6 shhdc4 shhdc6 Normalized intensity (fold) (cetylated tubulin / ) Normalized intensity (fold) (cetylated tubulin / ) Normalized intensity (fold) (cetylated tubulin / ) Normalized intensity (fold) (cetylated tubulin / ) D shhdc6 HDC6 shhdc6 HDC5 E p-hdc5 HDC5 Mouse 1 Mouse 2 U L U L Normalized intensity (fold) Unligation * Ligation Cho et al., Figure S6 (related to figure 5)

12 cetylated tubulin Merge Supplemental Data shhdc1 - xotomy + xotomy verage intensity of shhdc1 -xotomy +xotomy shhdc2 - xotomy + xotomy verage intensity of shhdc2 -xotomy +xotomy shhdc3 + xotomy - xotomy C *** verage intensity of shhdc3 -xotomy +xotomy *** *** shhdc1 shhdc2 shhdc3 Cho et al., Figure S7 (related to figure 5)

13 cetylated tubulin Merge + hhdc5 D verage intensity of +GFP-hHDC5 +GFP-hHDC5 HDC5 C n.s *** *** +GFP-hHDC5 Cho et al., Figure S8 (related to figure 5)

14 FLG-HDC5 immunoprecipitated from 293T lysates Sciatic nerve extract Ppt Sup Scriptaid FLG-HDC Ppt. Sup. c-tub nti-flg C ** n.s. ** D IP : IgG nti-flg Input(10%) HDC6 Relative intensity FLG-HDC5 - FLG-HDC5 + FLG-HDC5 E FLG-HDC5 transfection HEK293T Cells were stimulated by 10 PM or vehicle Cells were lysed in uffer (-phosphatase inhibitor) or uffer (+phosphatase inhibitor) Immunoprecipitated with anti-flg antibody Magnetic beads were incubated with S or CIP Sciatic nerve extract in TDC assay buffer was incubated with prepared beads in RT eads and supernatants were separated and subjected into SDS-PGE Cho et al., Figure S9 (related to figure 5)

15 shhdc6 cetylated tubulin ** Normalized intensity (fold) shhdc6 Cho et al., Figure S10 (related to figure 6)

16 Fluo-4 Phase contrast +EGT U L c-tub Tyr-tub +55 (Sec) C p-pkc p-pkc/smi-31 Maginified D -xotomy Mouse 1 Mouse 2 U L U L p-pkc PKC Fold ** +xotomy U L xotomy E +Gö6983 Normalized intensity of -xotomy Normalized intensity of +xotomy Cho et al., Figure S11 (related to figure 7)

17 cetylated tubulin Merge PKC knock down +xotomy -xotomy * verage intensity of -xotomy (n=6) +xotomy (n=6) C -x n.s +x D PKC kcock down Normalized intensity of -xotomy Normalized intensity of +xotomy E No virus shpkc PKC Cho et al., Figure S12 (related to figure 7)

18 TUJ1 Relative intensity of (fold) *** S100 Merge xon Schwann cell Cho et al., Figure S13 (related to figure 7K)

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

Supplemental Information. Loss of MicroRNA-7 Regulation Leads. to a-synuclein Accumulation and. Dopaminergic Neuronal Loss In Vivo

Supplemental Information. Loss of MicroRNA-7 Regulation Leads. to a-synuclein Accumulation and. Dopaminergic Neuronal Loss In Vivo YMTHE, Volume 25 Supplemental Information Loss of MicroRNA-7 Regulation Leads to a-synuclein Accumulation and Dopaminergic Neuronal Loss In Vivo Kirsty J. McMillan, Tracey K. Murray, Nora Bengoa-Vergniory,

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using

More information

GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts

GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts Current Biology, Volume 24 Supplemental Information GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts Wei Zhou, Jin Chang, Xin Wang, Masha G. Savelieff, Yinyin Zhao, Shanshan

More information

Protocol for induction of expression and cell lysate production

Protocol for induction of expression and cell lysate production Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected

More information

by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL

by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL Supplementary Materials and methods Neuronal cultures and transfection The hippocampus was dissected from E8 rat embryos, dissociated, and neurons plated onto glass coverslips coated with poly-ornithine

More information

over time using live cell microscopy. The time post infection is indicated in the lower left corner.

over time using live cell microscopy. The time post infection is indicated in the lower left corner. Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Movie 1 Description: Fusion of NBs. BSR cells were infected

More information

Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation

Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation 1 2 3 4 5 SUPPLEMENTAL DATA Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation Magalí Nazar, Juan Pablo Nicola, María Laura

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. ZBTB20 expression in the developing DRG. ZBTB20 expression in the developing DRG was detected by immunohistochemistry using anti-zbtb20 antibody 9A10 on

More information

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab. / 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG

More information

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- #1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals

More information

A Role for Nogo Receptor in Macrophage Clearance from Injured Peripheral Nerve

A Role for Nogo Receptor in Macrophage Clearance from Injured Peripheral Nerve Article A Role for Nogo Receptor in Macrophage Clearance from Injured Peripheral Nerve Elizabeth J. Fry, 1 Carole Ho, 2,3 and Samuel David 1, * 1 Center for Research in Neuroscience, The McGill University

More information

Supplementary Figure 1 Activated B cells are subdivided into three groups

Supplementary Figure 1 Activated B cells are subdivided into three groups Supplementary Figure 1 Activated B cells are subdivided into three groups according to mitochondrial status (a) Flow cytometric analysis of mitochondrial status monitored by MitoTracker staining or differentiation

More information

Center Drive, University of Michigan Health System, Ann Arbor, MI

Center Drive, University of Michigan Health System, Ann Arbor, MI Leukotriene B 4 -induced reduction of SOCS1 is required for murine macrophage MyD88 expression and NFκB activation Carlos H. Serezani 1,3, Casey Lewis 1, Sonia Jancar 2 and Marc Peters-Golden 1,3 1 Division

More information

Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila

Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila Cell Supplemental Information Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila Bo Liu, Yonggang Zheng, Feng Yin, Jianzhong Yu, Neal Silverman, and Duojia Pan Supplemental Experimental

More information

Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and

Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic

More information

Immunofluorescence images of different core histones and different histone exchange assay.

Immunofluorescence images of different core histones and different histone exchange assay. Molecular Cell, Volume 51 Supplemental Information Enhanced Chromatin Dynamics by FACT Promotes Transcriptional Restart after UV-Induced DNA Damage Christoffel Dinant, Giannis Ampatziadis-Michailidis,

More information

MSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC.

MSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC. MSD Immuno-Dot-Blot Assays Example: High Throughput Western Blots Replacements Traditional Western Blots High content Molecular weight and immunoreactivity Labor and protein intensive Inherently low throughput

More information

ab Hypoxic Response Human Flow Cytometry Kit

ab Hypoxic Response Human Flow Cytometry Kit ab126585 Hypoxic Response Human Flow Cytometry Kit Instructions for Use For measuring protein levels by flow cytometry: hypoxia-inducible factor 1-alpha (HIF1A) and BCL2/adenovirus E1B 19 kda proteininteracting

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility

Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility Cell Chemical Biology, Volume 24 Supplemental Information A Versatile Tool for Live-Cell Imaging and Super-Resolution Nanoscopy Studies of HIV-1 Env Distribution and Mobility Volkan Sakin, Janina Hanne,

More information

*Corresponding author. Tel: ;

*Corresponding author. Tel: ; 1 SUPPLEMENTARY DATA 2 3 4 5 6 7 8 9 10 11 Integrin 2 1 in nonactivated conformation can induce focal adhesion kinase signaling Maria Salmela 1, Johanna Jokinen 1,2, Silja Tiitta 1, Pekka Rappu 1, Holland

More information

Supplementary Figure 1. Isolation of GFPHigh cells.

Supplementary Figure 1. Isolation of GFPHigh cells. Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding

More information

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental

More information

Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto

Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics

More information

This Document Contains:

This Document Contains: This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular

More information

RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) ELISA Kit

RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) ELISA Kit RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) ELISA Kit Catalog #: PEL-Stat3-Y705 User Manual Last revised August 10, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified

More information

Supplemental Movie Legend.

Supplemental Movie Legend. Supplemental Movie Legend. Transfected T cells were dropped onto SEE superantigen-pulsed Raji B cells (approximate location indicated by circle). Maximum-intensity projections from Z-stacks (17 slices,

More information

Identification of Microprotein-Protein Interactions via APEX Tagging

Identification of Microprotein-Protein Interactions via APEX Tagging Supporting Information Identification of Microprotein-Protein Interactions via APEX Tagging Qian Chu, Annie Rathore,, Jolene K. Diedrich,, Cynthia J. Donaldson, John R. Yates III, and Alan Saghatelian

More information

TECHNICAL BULLETIN. MEK Activity Assay Kit. Product Code CS0490 Storage Temperature 20 C

TECHNICAL BULLETIN. MEK Activity Assay Kit. Product Code CS0490 Storage Temperature 20 C MEK Activity Assay Kit Product Code CS0490 Storage Temperature 20 C TECHNICAL BULLETIN Product Description The MAP kinase kinases (MAPKK, mitogen-activated protein kinase kinase, also termed MEK) are a

More information

RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) and Total STAT3 ELISA Kit

RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) and Total STAT3 ELISA Kit RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) and Total STAT3 ELISA Kit Catalog #: PEL-Stat3-Y705-T User Manual Last revised October 10, 2017 Caution: Extraordinarily useful information enclosed ISO

More information

Supplemental Material for

Supplemental Material for Supplemental Material for TXI TELNGIECTSI MUTTED (TM)-MEDITED DN DMGE RESPONSE IN OXIDTIVE STRESS-INDUCED VSCULR ENDOTHELIL CELL SENESCENCE Hong Zhan 1, Toru Suzuki 1,2, Kenichi izawa 1, Kiyoshi Miyagawa,

More information

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems

More information

The ubiquitin ligase Rnf6 regulates local LIM kinase 1 levels in axonal growth cones

The ubiquitin ligase Rnf6 regulates local LIM kinase 1 levels in axonal growth cones The ubiquitin ligase Rnf6 regulates local LIM kinase 1 levels in axonal growth cones Baris Tursun, 1,5 Anne Schlüter, 1,5 Marvin A. Peters, 1 Birte Viehweger, 1 Heather P. Ostendorff, 1 Juliana Soosairajah,

More information

NEURONAL CELL CULTURE MATRIX FOR BETTER MAINTENANCE AND SURVIVAL OF NEURONAL CELL CULTURES IN TISSUE CULTURE.

NEURONAL CELL CULTURE MATRIX FOR BETTER MAINTENANCE AND SURVIVAL OF NEURONAL CELL CULTURES IN TISSUE CULTURE. NEURONAL CELL CULTURE MATRIX FOR BETTER MAINTENANCE AND SURVIVAL OF NEURONAL CELL CULTURES IN TISSUE CULTURE. D. R. Aguirre, N. DiMassa, Chrystal Johnson, H. Eran, R. Perez, C.V.R. Sharma, M.V.R. Sharma,

More information

Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice

Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice Belal A. Mohamed, Amal Z. Barakat, Torsten Held, Manar Elkenani, Christian Mühlfeld, Jörg Männer, and Ibrahim M. Adham

More information

Acetylated Microtubules Are Preferentially Bundled Leading to Enhanced

Acetylated Microtubules Are Preferentially Bundled Leading to Enhanced Biophysical Journal, Volume 113 Supplemental Information Acetylated Microtubules Are Preferentially Bundled Leading to Enhanced Kinesin-1 Motility Linda Balabanian, Christopher L. Berger, and Adam G. Hendricks

More information

RayBio Phospho- Stat 3 (Tyr705) ELISA Kit

RayBio Phospho- Stat 3 (Tyr705) ELISA Kit RayBio Phospho- Stat 3 (Tyr705) ELISA Kit For Measuring Phosphorylated Stat3 (Tyr705) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Stat3 (Tyr705) ELISA Kit Protocol (Cat#:

More information

IMMUNOPRECIPITATION TROUBLESHOOTING TIPS

IMMUNOPRECIPITATION TROUBLESHOOTING TIPS IMMUNOPRECIPITATION TROUBLESHOOTING TIPS Creative Diagnostics Abstract Immunoprecipitation (IP) is the technique of precipitating a protein antigen out of solution using an antibody that specifically binds

More information

Rejuvenation of the muscle stem cell population restores strength to injured aged muscles

Rejuvenation of the muscle stem cell population restores strength to injured aged muscles Rejuvenation of the muscle stem cell population restores strength to injured aged muscles Benjamin D Cosgrove, Penney M Gilbert, Ermelinda Porpiglia, Foteini Mourkioti, Steven P Lee, Stephane Y Corbel,

More information

NEW! CHOgro Expression System

NEW! CHOgro Expression System NEW! CHOgro Expression System At Mirus Bio, we know it s all about expression. Introducing the new CHOgro Expression System, a transient transfection platform that finally gets high protein titers with

More information

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure Cell-Based ELISA Kit for detecting phospho-stat3 (ptyr 705 ) in cultured cell lines adequate for 96 assays (1 96 well plate) Catalog Number RAB0444 Storage Temperature 20 C TECHNICAL BULLETIN Product Description

More information

The microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and

The microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and SUPPLEMENTARY INFORMATION: The microtubule-associated tau protein has intrinsic acetyltransferase activity Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and Virginia M.Y. Lee Cohen

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1: Vector maps of TRMPV and TRMPVIR variants. Many derivatives of TRMPV have been generated and tested. Unless otherwise noted, experiments in this paper use

More information

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric*

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* Catalog # Kit Size SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* AS-55550 One 96-well strip plate This kit is optimized to detect human/mouse/rat alpha-synuclein

More information

hfab Rhodamine Housekeeping Antibodies

hfab Rhodamine Housekeeping Antibodies hfab Rhodamine Housekeeping Antibodies Catalog # Description 12004163 Anti-Actin hfab Rhodamine Antibody, 200 µl 12004164 Anti-Actin hfab Rhodamine Antibody, 40 µl 12004165 Anti-Tubulin hfab Rhodamine

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/323/5910/124/dc1 Supporting Online Material for Regulation of Neuronal Survival Factor MEF2D by Chaperone-Mediated Autophagy Qian Yang, Hua She, Marla Gearing, Emanuela

More information

Chicken EpithelialGut CellLines 1

Chicken EpithelialGut CellLines 1 Chicken EpithelialGut CellLines 1 Content 01 Introduction p 3 02 Characterization p 5 03 Infection and inhibition p 6 04 Protein expression system p 8 05 NutriProof p 10 06 Contact p 12 01...which came

More information

ab GFP ELISA Kit Instructions for Use For the quantitative measurement of GFP protein expression

ab GFP ELISA Kit Instructions for Use  For the quantitative measurement of GFP protein expression ab117992 GFP ELISA Kit Instructions for Use For the quantitative measurement of GFP protein expression This product is for research use only and is not for diagnostic use. intended www.abcam.com Table

More information

PhosphoTracer STAT3 Total ELISA Kit

PhosphoTracer STAT3 Total ELISA Kit ab119651 PhosphoTracer STAT3 Total ELISA Kit Instructions for Use For the semi-quantitative measurement of STAT3 Total concentrations in cell culture extracts This product is for research use only and

More information

Supplemental Information. Boundary Formation through a Direct. Threshold-Based Readout. of Mobile Small RNA Gradients

Supplemental Information. Boundary Formation through a Direct. Threshold-Based Readout. of Mobile Small RNA Gradients Developmental Cell, Volume 43 Supplemental Information Boundary Formation through a Direct Threshold-Based Readout of Mobile Small RNA Gradients Damianos S. Skopelitis, Anna H. Benkovics, Aman Y. Husbands,

More information

Tropix Chemiluminescent Kits and Reagents For Cell Biology Applications

Tropix Chemiluminescent Kits and Reagents For Cell Biology Applications PRODUCT FAMILY BULLETIN Tropix Chemiluminescent Kits and Reagents Tropix Chemiluminescent Kits and Reagents For Cell Biology Applications Introduction to Chemiluminescence Chemiluminescence is the conversion

More information

Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132

Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132 Neuron, Volume 65 Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132 Dieter Edbauer, Joel R. Neilson, Kelly A. Foster, Chi-Fong Wang, Daniel P. Seeburg, Matthew

More information

Kinase Reaction and Alkylation Protocol

Kinase Reaction and Alkylation Protocol Kinase Reaction and Alkylation Protocol Protocol for the treatment of substrates prior to detection by Thiophosphate Ester antibodies This product is for research use only and is not intended for diagnostic

More information

TECHNICAL BULLETIN. Catalog Number RAB0012 Storage Temperature 20 C

TECHNICAL BULLETIN. Catalog Number RAB0012 Storage Temperature 20 C Phospho-Akt (pser 473 )/pan-akt ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) and pan-akt in cell and tissue lysates Catalog Number RAB0012 Storage Temperature 20 C TECHNICAL

More information

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure Cell-Based ELISA Sampler Kit for detecting phospho-erk1/2 (pthr 202 /ptyr 204 ), phospho-jnk (pthr 183 /ptyr 185 ), and phospho-p38 MAPK (pthr 180 /ptyr 182 ) in cultured cell lines adequate for 192 assays

More information

A Calcium-Dependent Switch in a CREST-BRG1 Complex Regulates Activity-Dependent Gene Expression

A Calcium-Dependent Switch in a CREST-BRG1 Complex Regulates Activity-Dependent Gene Expression Article A Calcium-Dependent Switch in a CREST-BRG1 Complex Regulates Activity-Dependent Gene Expression Zilong Qiu 1 and Anirvan Ghosh 1, * 1 Neurobiology Section, Division of Biological Sciences, University

More information

unc-33/crmp and ankyrin organize microtubules and localize kinesin to polarize

unc-33/crmp and ankyrin organize microtubules and localize kinesin to polarize Supplementary Information unc-33/crmp and ankyrin organize microtubules and localize kinesin to polarize axon-dendrite sorting Tapan A. Maniar 1, Miriam Kaplan 1, George J. Wang 2, Kang Shen 2, Li Wei

More information

Multiplex Fluorescence Assays for Adherence Cells without Trypsinization

Multiplex Fluorescence Assays for Adherence Cells without Trypsinization Multiplex Fluorescence Assays for Adherence Cells without Trypsinization The combination of a bright field and three fluorescent channels allows the Celigo to perform many multiplexed assays. A gating

More information

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1 Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 4.52E-18 PDK1 6.77E-18 CSRP2 4.42E-17 PFKP 1.23E-14 MSH2 3.79E-13 NARF_A 5.56E-13 ADFP 5.56E-13 FAM13A1 1.56E-12 FAM29A_A 1.22E-11 CA9 1.54E-11

More information

Nature Methods: doi: /nmeth Supplementary Figure 1. Retention of RNA with LabelX.

Nature Methods: doi: /nmeth Supplementary Figure 1. Retention of RNA with LabelX. Supplementary Figure 1 Retention of RNA with LabelX. (a) Epi-fluorescence image of single molecule FISH (smfish) against GAPDH on HeLa cells expanded without LabelX treatment. (b) Epi-fluorescence image

More information

Normalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation 5

Normalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation 5 Normalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation Application Note Authors Yoonseok Kam 1, Ned Jastromb 1, Joe Clayton, Paul Held, and Brian P. Dranka 1 1 Agilent

More information

Genetically targeted all-optical electrophysiology with a transgenic Credependent

Genetically targeted all-optical electrophysiology with a transgenic Credependent Genetically targeted all-optical electrophysiology with a transgenic Credependent Optopatch mouse Short title: Transgenic Optopatch mouse Shan Lou 1, Yoav Adam 1, Eli N. Weinstein 1,4, Erika Williams 2,

More information

IMMUNOPRECIPITATION (IP)

IMMUNOPRECIPITATION (IP) 1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us

More information

mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet

mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Details

More information

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with

More information

SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency

SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Molecular Cell, Volume 52 Supplemental Information SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Kengo Homma, Takao Fujisawa, Naomi Tsuburaya, Namiko

More information

Applications involving the ViroCyt Virus Counter in the production of various recombinant proteins

Applications involving the ViroCyt Virus Counter in the production of various recombinant proteins Applications involving the ViroCyt Virus Counter in the production of various recombinant proteins Chris Kemp Kempbio, Inc. Frederick, MD USA chris.kemp@kempbioinc.com Presentation Summary Kempbio, Inc.

More information

Supplementary Figure. S1

Supplementary Figure. S1 Supplementary Figure. S1 Supplementary Figure S1. Correlation of phagocytic ability measured with YG and YO beads. Fresh human monocytes (2 10 6 /ml) were labelled with APC conjugated anti CD14 mab alone

More information

RayBio Phospho- Akt (Ser473) ELISA Kit

RayBio Phospho- Akt (Ser473) ELISA Kit RayBio Phospho- Akt (Ser473) ELISA Kit For Measuring Phosphorylated Akt (Ser473) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Akt (Ser473) ELISA Kit Protocol (Cat#: PEL-Akt-S473-001)

More information

ab GAPDH SimpleStep ELISA Kit

ab GAPDH SimpleStep ELISA Kit ab176642 GAPDH SimpleStep ELISA Kit Instructions for Use For the semi-quantitative measurement of GAPDH in Human and mouse cell lysates. This product is for research use only and is not intended for diagnostic

More information

For the semi-quantitative measurement of GAPDH concentrations in cell culture extracts

For the semi-quantitative measurement of GAPDH concentrations in cell culture extracts ab119627 PhosphoTracer GAPDH ELISA Kit Instructions for Use For the semi-quantitative measurement of GAPDH concentrations in cell culture extracts This product is for research use only and is not intended

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/4/157/ra4/dc1 Supplementary Materials for Genome-Wide RNAi Screen Reveals Disease-Associated Genes That Are Common to Hedgehog and Wnt Signaling Leni S. Jacob,

More information

In-Cell Western Kits I and II

In-Cell Western Kits I and II Odyssey and Aerius Infrared Imaging Systems In-Cell Western Assay Kits I and II Published November, 2006. The most recent version of this protocol is posted at http://biosupport.licor.com/protocols.jsp

More information

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807 INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended

More information

Supporting Information

Supporting Information Supporting Information Shao et al. 10.1073/pnas.1504837112 SI Materials and Methods Immunofluorescence and Immunoblotting. For immunofluorescence, cells were fixed with 4% paraformaldehyde and permeabilized

More information

7.06 Problem Set #3, Spring 2005

7.06 Problem Set #3, Spring 2005 7.06 Problem Set #3, Spring 2005 1. The Drosophila compound eye is composed of about 800 units called ommatidia. Each ommatidium contains eight photoreceptor neurons (R1 through R8), which develop in a

More information

ENCODE RBP Antibody Characterization Guidelines

ENCODE RBP Antibody Characterization Guidelines ENCODE RBP Antibody Characterization Guidelines Approved on November 18, 2016 Background An integral part of the ENCODE Project is to characterize the antibodies used in the experiments. This document

More information

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline

More information

NTM486-04, NTM174-04,

NTM486-04, NTM174-04, Transfection of transformed human trabecular meshwork TM5, and primary human NTM210-05, NTM486-04, NTM174-04, and NTM153-00 cells with Metafectene Easy Adnan Dibas1A,C, Ming Jiang1A,C, Thomas Yorio1A,C.

More information

* This work was supported, in whole or in part, by National Institutes of Health Grants HL56850 and AG S EXPERIMENTAL PROCEDURES

* This work was supported, in whole or in part, by National Institutes of Health Grants HL56850 and AG S EXPERIMENTAL PROCEDURES THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 285, NO. 10, pp. 6937 6951, March 5, 2010 2010 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. p66 shc Inhibits Insulin-like

More information

- NaCr. + NaCr. α H3K4me2 α H3K4me3 α H3K9me3 α H3K27me3 α H3K36me3 H3 H2A-2B H4 H3 H2A-2B H4 H3 H2A-2B H4. α Kcr. (rabbit) α Kac.

- NaCr. + NaCr. α H3K4me2 α H3K4me3 α H3K9me3 α H3K27me3 α H3K36me3 H3 H2A-2B H4 H3 H2A-2B H4 H3 H2A-2B H4. α Kcr. (rabbit) α Kac. + NaCr NaCr + NaCr NaCr Peptides 10ng 50ng 250ng K α Pan (mouse) Pan (mouse) 10ng 50ng 250ng α Pan (rabbit) C 10ng 50ng 250ng α Pan (mouse) 0 1.25 2.5 5 10 20 40 (mm) NaCr 24h α Pan (rabbit) α K4me2 α

More information

NEW INSIGHTS. NEW DISCOVERIES. Real-time automated measurements of cell health, movement and function inside your incubator.

NEW INSIGHTS. NEW DISCOVERIES. Real-time automated measurements of cell health, movement and function inside your incubator. THE NEXT GENERATION HAS ARRIVED IncuCyte S3 Live-Cell Analysis System Real-time automated measurements of cell health, movement and function inside your incubator. NEW INSIGHTS. NEW DISCOVERIES. See what

More information

Overview. Introduction - Background. Introduction - Background. Introduction - Aims. Transgenic Mice Generated

Overview. Introduction - Background. Introduction - Background. Introduction - Aims. Transgenic Mice Generated Overview Wallerian Degeneration of Injured Axons and Synapses is Delayed by a Ube4b/Nmnat Chimeric Gene Mack T, Reiner M, Beirowski B, Weiqian M, Emanuelli M, Wagner D, Thomson D, Gillingwater T, Court

More information

Supplement Figure 1. Characterization of the moab. (A) A series of moabs that are anti-hαiib-specific were tested for their ability to bind to

Supplement Figure 1. Characterization of the moab. (A) A series of moabs that are anti-hαiib-specific were tested for their ability to bind to Supplement Figure 1. Characterization of the 312.8 moab. (A) A series of moabs that are anti-hαiib-specific were tested for their ability to bind to platelets. The black line represents the 312.8 moab

More information

TransIT -Lenti Transfection Reagent

TransIT -Lenti Transfection Reagent Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6600 INTRODUCTION Lentivirus is an enveloped, single-stranded RNA virus from the Retroviridae family capable of infecting

More information

EGFR (Phospho-Ser695)

EGFR (Phospho-Ser695) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely

More information

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative

More information

Muscle Induces Neuronal Expression of Acetylcholinesterase in Neuron-Muscle Co-culture

Muscle Induces Neuronal Expression of Acetylcholinesterase in Neuron-Muscle Co-culture THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 278, No. 46, Issue of November 14, pp. 45435 45444, 2003 2003 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Muscle Induces

More information

SUPPLEMENTAL MATERIALS

SUPPLEMENTAL MATERIALS SUPPLEMENL MERILS Eh-seq: RISPR epitope tagging hip-seq of DN-binding proteins Daniel Savic, E. hristopher Partridge, Kimberly M. Newberry, Sophia. Smith, Sarah K. Meadows, rian S. Roberts, Mark Mackiewicz,

More information

FlashPlate File #15. High Throughput Screening. J. Watson SmithKline Beecham Pharmaceuticals, UK.

FlashPlate File #15. High Throughput Screening. J. Watson SmithKline Beecham Pharmaceuticals, UK. Drug Discovery Research Clinical Screening High Throughput Screening FlashPlate File #15 Use of Novel FlashPlate Technology to Measure camp Accumulation in Chinese Hamster Ovary Cells Expressing Human

More information

Please read manual carefully before starting experiment

Please read manual carefully before starting experiment RayBio Cell-Based Phosphorylation ELISA Kit - Preliminary For the semi-quantitative detection of both phosphorylated and pan human, mouse or rat proteins in adherent whole cell lines. User Manual (Revised

More information

Supporting Information

Supporting Information Supporting Information Wiley-VCH 26 69451 Weinheim, Germany A new homogenous assay for studying mira maturation Brian Patrick Davies and Christoph Arenz General Information For MALDI-TF measurements a

More information

AlphaLISA SureFire Ultra

AlphaLISA SureFire Ultra AlphaLISA SureFire Ultra p-vegf Receptor 2 (Tyr1175) Assay Kit Manual Assay Points Catalog # 500 ALSU-PVGFR-A500 10 000 ALSU-PVGFR-A10K 50 000 ALSU-PVGFR-A50K For Research Use Only. Not for use in Diagnostic

More information