Biology Open (2015): doi: /bio : Supplementary information
|
|
|
- Regina Blake
- 5 years ago
- Views:
Transcription
1 Fig. S1. Verification of optimal conditions for the generation of LIF-dependent inscs Representative images (from five repeat experiments) of human primary fibroblasts undergoing reprogramming for 21 days after ectopic overexpression of either four or five factors (OCT4, KLF4, SOX2, and L-MYC, with or without NANOG), as indicated above each plate. The cells in the plates were stained for alkaline phosphatase activity.
2
3 Fig. S2. Characterization of LD-iNSCs (A) q-pcr analysis revealed that parent fibroblasts (a human endometrial fibrotic stromal cell line) with or without 2i/LIF/Dox did not express the neural progenitor markers SOX1, and PAX6. GAPDH was used as the internal control. (B) Representative fluorescence in situ hybridization (FISH) analysis for XIST mrna (red) and X chromosome (green). XIST signals in LD-iNSCs #5, #18, and #42.2; human fibroblasts; and hipscs indicate the XIST mrna coating the inactive X chromosome. (C) RT-PCR analysis of XIST mrna expression in LD-iNSC clones #5, #18, and #42.2; human fibroblasts; and hipscs. GAPDH served as the loading control. All cell lines expressed these mrnas. (D) Withdrawal of Dox and 2i/LIF caused neuronal differentiation of LD-iNSCs. This image was observed 12 weeks after withdrawal of Dox and 2i/LIF.
4 Fig. S3. q-pcr of TERT and OCT4 mrna in LD-iNSCs after withdrawal of Dox (A) Suppression of exogenous reprogramming factors by Dox removal resulted in sustained TERT mrna expression in the LD-iNSC clone #18. (B) After the removal of Dox from the medium, total (exogenous and endogenous) OCT4 mrna expression was completely lost in the LD-iNSC clone #18. Human fibroblasts served as a negative control.
5
6 Fig. S4. Characterization of LD-iNSCs as neural stem/progenitor cells (A) Immunostaining results for Ki-67 in LD-iNSCs (i) after removal of Dox (4 days) and fibroblasts, (ii) human endometrial fibrotic stromal cells and (iii) BJ foreskin fibroblasts. Cell nuclei were visualized with DAPI. Scale bar: 100 μm. (B) A phase-contrast image of established LD-iNSCs in the presence of CH, SB, and LIF in feeder-free culture conditions (scale bars, 500 μm). The right panel is a high-magnification image of cells in the inset in the left panel (scale bar, 100 μm). (C) LD-iNSCs were derived from BJ foreskin fibroblasts (left panel). These LD-iNSCs differentiated into neurons or glial cells (right panel). Scale bar: 100 μm. (D) LD-iNSC#42.2-derived motor neurons were TUJ1 positive and expressed motor neuron markers such as HB9, ISLET1, and HOXC8. Cell nuclei were visualized with DAPI. Scale bar: 100 μm.
7 Table S1. STR analysis of LD-iNSCs and human fibroblasts Locus/Clone LD-iNSC#5 LD-iNSC#18 LD-iNSC#42.2 Fiboblasts D3S TH D21S D18S Penta_E D5S D13S D7S D16S CSF1PO Penta_D AMEL X X X X vwa D8S TPOX FGA
8 Table S2. List of primers used for RT-PCR, quantitative RT-PCR, bisulfite sequencing and ChIP-qPCR. Gene Forward primer (5'-3') Reverse primer (5'-3') RT-PCR primers OCT4 GAACCGAGTGAGAGGCAACC ATCCCAAAAACCCTGGCACA NANOG GGCCTCAGCACCTACCTACCCC GATGGGAGGAGGGGAGAGGA SOX2 ATGGGTTCGGTGGTCAAGTC CCCTCCCATTTCCCTCGTTT LIN28 GGGCATCTGTAAGTGGTT GTAGGGCTGTGGATTTCT REX1 CCTAAACAGCTCGCAGAA CAGCCTTGAAAGGGACAC LEFTY1 CAACCGCACCTCCCTCAT TTCTCGGCCCACTTCATC STELLA TCCCGGGACGATTCAGGGGC TCGATTTCCCTGAGGACTGCTGC TERT GGCTCTTTTTCTACCGGAAG ACAAAGTACAGCTCAGGCGG NESTIN TCCAGGAACGGAAAATCAAG GCCTCCTCATCCCCTACTTC SOX1 CACAACTCGGAGATCAGCAA GGTACTTGTAATCCGGGTGC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT HOXA5 TCAAGACAAAGCCATTCAGGAC AAGTACTGAGCAGTATTAGCGG HOXC5 CAGAGTCATCCGAGTGTGG TCTACTGGGTTAGCCTGTAAAC XIST ACCACCACACGTCAAGCTCTT CTATCCTCAAGTGCTAGAGTGCCAG GAPDH ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA q-pcr primers OCT4 TGTACTCCTCGGTCCCTTTC TCCAGGTTTTCTTTCCCTAGC NANOG CAGTCTGGACACTGGCTGAA CTCGCTGATTAGGCTCCAAC REX1 AACGGGCAAAGACAAGACAC GCTGACAGGTTCTATTTCCGC TERT GGAGCAAGTTGCAAAGCATTG TCCCACGACGTAGTCCATGTT GAPDH TGTTGCCATCAATGACCCCTT CTCCACGACGTACTCAGCG ChIP-qPCR primers OCT4 AAAGCAATCCTTCTGCTCCA TAACATAGCAAGGCCCCATC Bisulfite sequencing primers OCT4 ATTTGTTTTTTGGGTAGTTAAAGGT CCTAAACTCCCCTTCAAAATCTATT NANOG TGGTTAGGTTGGTTTTAAATTTTTG AACCCACCCTTATAAATTCTCAATTA REX1 GGTTTAAAAGGGTAAATGTGATTATATTTA CAAACTACAACCACCCATCAAC
SUPPLEMENTARY INFORMATION
Supplementary Figure S1 Colony-forming efficiencies using transposition of inducible mouse factors. (a) Morphologically distinct growth foci appeared from rtta-mefs 6-8 days following PB-TET-mFx cocktail
Human induced Pluripotent Stem Cell (ipsc) Line: GM23225*B
Certificate of Analysis NIGMS Human tic Cell Repository Human induced Pluripotent Stem Cell (ipsc) Line: GM23225*B Diagnosis Mutation Reprogramming method Publication(s) describing ipsc line establishment
Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State
Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State Soonbong Baek, 1 Xiaoyuan Quan, 1 Soochan Kim, 2 Christopher Lengner, 3 Jung- Keug Park, 4 and Jongpil Kim 1* 1 Lab
SUPPLEMENTARY INFORMATION
doi:.38/nature08267 Figure S: Karyotype analysis of ips cell line One hundred individual chromosomal spreads were counted for each of the ips samples. Shown here is an spread at passage 5, predominantly
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2239 Hepatocytes (Endoderm) Foreskin fibroblasts (Mesoderm) Melanocytes (Ectoderm) +Dox rtta TetO CMV O,S,M,K & N H1 hes H7 hes H9 hes H1 hes-derived EBs H7 hes-derived EBs H9 hes-derived
NIA Aging Cell Repository
Certificate of Analysis NIA Aging Cell Repository Human induced Pluripotent Stem Cell (ipsc) Line: AG25370*B Diagnosis Alzheimer Disease, Familial, Type 4 Mutation Reprogramming method Publication(s) describing
A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs
Supplementary Information A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs Bahram Valamehr, Ramzey Abujarour, Megan Robinson, Thuy Le, David Robbins,
Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells
Supplementary Data Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Mouse induced pluripotent stem cells (ipscs) were cultured
Supplementary Figure 1 Characterization of OKSM-iNSCs
Supplementary Figure 1 Characterization of OKSM-iNSCs (A) Gene expression levels of Sox1 and Sox2 in the indicated cell types by microarray gene expression analysis. (B) Dendrogram cluster analysis of
Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like
Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like morphology in co-culture with mouse embryonic feeder fibroblasts
Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured
Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured in 90-Pa 3D fibrin gels for 5 days in the presence
Supplementary Fig. 1. A, Upper panel shows schematic molecular representation of mutation- and SNP-replacement with FANCA-c-HDAdV in FANCA-corrected
Supplementary Fig. 1. A, Upper panel shows schematic molecular representation of mutation- and SNP-replacement with FANCA-c-HDAdV in FANCA-corrected FA-iPSC line (C-FA-iPSCs). Lower panels show the sequencing
Protocol Using the Reprogramming Ecotropic Retrovirus Set: Mouse OSKM to Reprogram MEFs into ips Cells
STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblast (MEF) cells into induced pluripotent stem (ips) cells in a 6-well format. Transduction
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Generation of NSCs from hpscs in SDC medium.
Supplementary Figure 1 Generation of NSCs from hpscs in SDC medium. (a) Q-PCR of pluripotent markers (OCT4, NANOG), neural markers (SOX1, PAX6, N-Cadherin), markers for the other germ layers (T, EOMES,
SUPPLEMENTARY FIG. S9. Morphology and DNA staining of cipsc-differentiated trophoblast cell-like cell. Scale bar: 100 mm. SUPPLEMENTARY FIG. S10.
Supplementary Data SUPPLEMENTARY FIG. S1. Lentivirus-infected canine fibroblasts show YFP expression. (A, B) Uninfected canine skin fibroblasts (CSFs); (C, D) infected CSFs; (E, F) uninfected CTFs; (G,
hipscs were derived from human skin fibroblasts (CRL-2097) by ectopic
Generation and characterization of hipscs hipscs were derived from human skin fibroblasts (CRL-2097) by ectopic expression of OCT4, SOX2, KLF4, and C-MYC as previously described 1. hipscs showed typical
Nature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION DOI: 1.138/NMAT3777 Biophysical regulation of epigenetic state and cell reprogramming Authors: Timothy L. Downing 1,2, Jennifer Soto 1,2, Constant Morez 2,3,, Timothee Houssin
Supplementary Table 1. Primary antibodies used in this study.
Supplementary Table 1. Primary antibodies used in this study. Antibodies Mouse monoclonal Antibody(Ab) Working dilution Oct4 1:2 Pax6 1:1 Company Notes 1 Santa Cruz Biotechnology Use only Cy3 2nd antibody
Gene name forward primer 5->3 reverse primer 5->3 product GCCCATA. Nfatc1 AGGTGCAGCCCAAGTCTCAC GTGGCCATCTGGAGCCTTC CTGT GATGC GCT ACCAA
Supplementary able 1 is presenting the PCR primer list used. ene name forward primer 5->3 reverse primer 5->3 product size cdna VE-Cadherin AACCCAAAAA CACCCCAAAAC 260bp CCA CCCAA PECAM-1 CACCACAA CCCCCACC
Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,
Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time
Protocol Reprogramming MEFs using the Dox Inducible Reprogramming Lentivirus Set: Mouse OKSM
STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblasts (MEFs) into induced pluripotent stem (ips) cells in a 6-well format. Transduction
Authors: Takuro Horii, Masamichi Yamamoto, Sumiyo Morita, Mika Kimura, Yasumitsu Nagao, Izuho Hatada *
SUPPLEMENTARY INFORMATION Title: p53 Suppresses Tetraploid Development in Mice Authors: Takuro Horii, Masamichi Yamamoto, Sumiyo Morita, Mika Kimura, Yasumitsu Nagao, Izuho Hatada * Supplementary Methods
Supplementary Figure S1. The tetracycline-inducible CRISPR system. A) Hela cells stably
Supplementary Information Supplementary Figure S1. The tetracycline-inducible CRISPR system. A) Hela cells stably expressing shrna sequences against TRF2 were examined by western blotting. shcon, shrna
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11070 Supplementary Figure 1 Purification of FLAG-tagged proteins. a, Purification of FLAG-RNF12 by FLAG-affinity from nuclear extracts of wild-type (WT) and two FLAG- RNF12 transgenic
Rapid differentiation of human pluripotent stem cells into functional motor neurons by
Supplementary Information Rapid differentiation of human pluripotent stem cells into functional motor neurons by mrnas encoding transcription factors Sravan Kumar Goparaju, Kazuhisa Kohda, Keiji Ibata,
Components Neural induction basal medium (Cat. # ) 100 ml x 5 Neural induction medium supplement 50x (Cat. # ) 2 ml x 5
HPSC Neural Induction Medium (PSCNIM) Catalog #5931 Introduction Human embryonic stem cells (hesc) and induced pluripotent stem cells (hipsc) possess the capability of differentiating into all derivatives
Protocol Reprogramming Human Fibriblasts using the Dox Inducible Reprogramming Polycistronic Lentivirus Set: Human 4F2A LoxP
STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of BJ Human Fibroblasts (BJ cells) into induced pluripotent stem (ips) cells in a 6-well format. Transduction efficiency
Nature Methods: doi: /nmeth Supplementary Figure 1. Extrinsic Signaling during Reprogramming.
Supplementary Figure 1 Extrinsic Signaling during Reprogramming. a, In human pluripotent stem cells, exogenously- (medium) and endogenously-promoted (cell-secreted) FGF and TGF- pathways sustain the master
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11435 Supplementary Figures Figure S1. The scheme of androgenetic haploid embryonic stem (ahes) cells derivation. WWW.NATURE.COM/NATURE 1 RESEARCH SUPPLEMENTARY INFORMATION Figure S2.
Protocol Reprogramming Human Fibroblasts into ips Cells using the Stemgent Reprogramming Lentivirus Set: Human OKSM
STEMGENT Page 1 Reprogramming Lentivirus Set: Human OKSM OVERVIEW The following procedure describes the reprogramming of BJ Human Fibroblasts (BJ cells) to induced pluripotent stem (ips) cells using the
Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene
Developmental Cell, Volume 25 Supplemental Information Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, Wei Li, Ching Shang, Richard M. Chen,
Chemically defined conditions for human ipsc derivation and culture
Nature Methods Chemically defined conditions for human ipsc derivation and culture Guokai Chen, Daniel R Gulbranson, Zhonggang Hou, Jennifer M Bolin, Victor Ruotti, Mitchell D Probasco, Kimberly Smuga-Otto,
Supplementary Figure S1: (A) Schematic representation of the Jarid2 Flox/Flox
Supplementary Figure S1: (A) Schematic representation of the Flox/Flox locus and the strategy used to visualize the wt and the Flox/Flox mrna by PCR from cdna. An example of the genotyping strategy is
Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector.
Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector. (a) Western blotting analysis and (b) qpcr analysis of eif6 expression in HEK293 T cells transfected with either
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10202 Supplementary Figure 1: Rapid generation of neurons from human ES cells. a, Phase contrast image of feeder-free culture of human ES cells infected with Brn2, Ascl1, Myt1l (BAM)
Nature Immunology: doi: /ni Supplementary Figure 1. Construction of lnckdm2b RFP reporter and lnckdm2b-knockout mice.
Supplementary Figure 1 Construction of lnckdm2b RFP reporter and lnckdm2b-knockout mice. (a) ILC3s (Lin CD45 lo CD90 hi ) were isolated from small intestines, followed by immunofluorescence staining. LncKdm2b
Embryonic germ cell formation. Maintainance of pluripotency
hvasa 2.5 kb promoter egfp 3 UTR(1kb) 1. Stable integration of germ cell reporter into hescs 2. Adherent differentiation and FACS isolation for VASA:GFP+ cells 4. Silencing or overexpression of the human
SUPPLEMENTARY INFORMATION
a before amputation regeneration regenerated limb DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS developmental origin: lateral plate mesoderm presomitic mesoderm
Supplementary Information
Silva et al, 2006 Supplementary Information Nanog promotes transfer of pluripotency after cell fusion Supplementary Methods Antibodies RT-PCR analysis Trichostatin A and 5-azacytidine treatment Imaging
Supplementary Information
Supplementary Information Supplementary Figures Supplementary Figure 1. qrt-pcr analysis of the expression of candidate factors including SOX2, MITF, PAX3, DLX5, FOXD3, LEF1, MSX1, PAX6, SOX2 and SOX9
Disease Clinical features Genotype
Disease Clinical features Genotype Alpha 1 Antitrypsin deficiency (A1ATD) Patient 1 65 year old caucasian male, liver transplant recipient, explant biopsy confirmed A1ATD induced liver cirrhosis Patient
Protocol Using a Dox-Inducible Polycistronic m4f2a Lentivirus to Reprogram MEFs into ips Cells
STEMGENT Page 1 OVERVIEW The following protocol describes the transduction and reprogramming of one well of Oct4-GFP mouse embryonic fibroblasts (MEF) using the Dox Inducible Reprogramming Polycistronic
PI3K/mTORC2 regulates TGFβ/Activin signalling by modulating Smad2/3
Supplementary Information PI3K/mTORC2 regulates TGFβ/Activin signalling by modulating Smad2/3 activity via linker phosphorylation Jason S.L. Yu, 1 Thamil Selvee Ramasamy, 1,2 Nick Murphy, 1 Marie Holt,
Supplementary Figure 1.
Supplementary Figure 1. (A) UCSC Genome Browser view of region immediately downstream of the NEUROG3 start codon. All candidate grna target sites which meet the G(N 19 )NGG constraint are aligned to illustrate
Sundari Chetty, Felicia Walton Pagliuca, Christian Honore, Anastasie Kweudjeu, Alireza Rezania, and Douglas A. Melton
A simple tool to improve pluripotent stem cell differentiation Sundari Chetty, Felicia Walton Pagliuca, Christian Honore, Anastasie Kweudjeu, Alireza Rezania, and Douglas A. Melton Supplementary Information
Supplementary Figure 1. Retinogenesis during human embryonic development and in 3-D retinal cups (RCs) derived from hipsc. a, Main steps leading to
Supplementary Figure 1. Retinogenesis during human embryonic development and in 3-D retinal cups (RCs) derived from hipsc. a, Main steps leading to the formation of the human retina in vivo. b, Diagram
Nature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Workflow for multimodal analysis using sc-gem on a programmable microfluidic device (Fluidigm). 1) Cells are captured and lysed, 2) RNA from lysed single cell is reverse-transcribed
Jing Liao, Chun Cui, Siye Chen, Jiangtao Ren, Jijun Chen, Yuan Gao, Hui Li, Nannan Jia, Lu Cheng, Huasheng Xiao, and Lei Xiao
Cell Stem Cell, Volume 4 Supplemental Data Generation of Induced Pluripotent Stem Cell Lines from Adult Rat Cells Jing Liao, Chun Cui, Siye Chen, Jiangtao Ren, Jijun Chen, Yuan Gao, Hui Li, Nannan Jia,
SUPPLEMENTAL METHODS Reverse transcriptase PCR (RT-PCR) and quantitative real-time PCR (Q-RT-PCR) RNA was isolated with TRIZOL (Invitrogen), and
SUPPLEMENTAL METHODS Reverse transcriptase PCR (RT-PCR) and quantitative real-time PCR (Q-RT-PCR) RNA was isolated with TRIZOL (Invitrogen), and first strand cdna was synthesized using 1 μg of RNA and
Supplementary Table S1
Primers used in RT-qPCR, ChIP and Bisulphite-Sequencing. Quantitative real-time RT-PCR primers Supplementary Table S1 gene Forward primer sequence Reverse primer sequence Product TRAIL CAACTCCGTCAGCTCGTTAGAAAG
Supplementary Information
Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2017 Seidel et al. 2016 Page 1 of 13 In vitro field potential monitoring on multi-micro electrode array
TITLE: Induced Pluripotent Stem Cells as Potential Therapeutic Agents in NF1
AD Award Number: W81XWH-10-1-0181 TITLE: Induced Pluripotent Stem Cells as Potential Therapeutic Agents in NF1 PRINCIPAL INVESTIGATOR: Jonathan Chernoff, M.D., Ph.D. CONTRACTING ORGANIZATION: Institute
Directed Differentiation of Human Induced Pluripotent Stem Cells. into Fallopian Tube Epithelium
Directed Differentiation of Human Induced Pluripotent Stem Cells into Fallopian Tube Epithelium Nur Yucer 1,2, Marie Holzapfel 2, Tilley Jenkins Vogel 2, Lindsay Lenaeus 1, Loren Ornelas 1, Anna Laury
Supplemental Information. Direct Reprogramming of Fibroblasts. via a Chemically Induced XEN-like State
Cell Stem Cell, Volume 21 Supplemental Information Direct Reprogramming of Fibroblasts via a Chemically Induced XEN-like State Xiang Li, Defang Liu, Yantao Ma, Xiaomin Du, Junzhan Jing, Lipeng Wang, Bingqing
Supplemental Information
Cell Stem Cell, Volume 15 Supplemental Information Generation of Naive Induced Pluripotent Stem Cells from Rhesus Monkey Fibroblasts Riguo Fang, Kang Liu, Yang Zhao, Haibo Li, Dicong Zhu, Yuanyuan Du,
Supplementary information for: Ten-Eleven Translocation-2 (Tet2) Is Involved in Myogenic Differentiation of Skeletal Myoblast Cells in
Supplementary information for: Ten-Eleven Translocation-2 (Tet2) Is Involved in Myogenic Differentiation of Skeletal Myoblast Cells in Vitro Xia Zhong*, Qian-Qian Wang*, Jian-Wei Li, Yu-Mei Zhang, Xiao-Rong
SCIENTIFIC PROGRAM. Stem Cell Differentiation Training Course. Naples, October An event organized by: with the support of: 7 th edition
SCIENTIFIC PROGRAM Naples, October 23-26 2012 Stem Cell Differentiation Training Course 7 th edition An event organized by: Stem Cell Fate Lab, IGB Euroclone S.p.A. with the support of: Informatics Core,
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature06403 Supplementary Information: Nanog safeguards pluripotency and mediates germline development Supplementary Tables SUPPLEMENTARY INFORMATION mrna Forward primer Reverse primer Annealing
Advances and New Technologies in Forensic DNA
Advances and New Technologies in Forensic DNA Nader Pourmand, PhD Department of Biomolecular Engineering, University of California, Santa Cruz Branch Migratio 3 nbp 6 3 5 3 5 bp 14 bp 23 5 3 5 3 5 Bioluminescence
SUPPLEMENTARY INFORMATION
Correction notice Disease-corrected haematopoietic progenitors from Fanconi anaemia induced pluripotent stem cells Ángel Raya, Ignasi Rodríguez-Pizà, Guillermo Guenechea, Rita Vassena, Susana Navarro,
The p53-puma axis suppresses ipsc generation
The p53-puma axis suppresses ipsc generation Yanxin Li, Haizhong Feng, Haihui Gu, Dale W. Lewis, Youzhong Yuan, Lei Zhang, Hui Yu, Peng Zhang, Haizi Cheng, Weimin Miao, Weiping Yuan, Shi-Yuan Cheng, Susanne
Artificial niche microarrays for probing single-stem-cell fate in high throughput
Nature Methods Artificial niche microarrays for probing single-stem-cell fate in high throughput Samy Gobaa, Sylke Hoehnel, Marta Roccio, Andrea Negro, Stefan Kobel & Matthias P Lutolf Supplementary Figure
DNA FINGERPRINTING MADE EASY FOR FORENSICS
DNA FINGERPRINTING MADE EASY FOR FORENSICS Presented by Eilene Lyons The St. Louis Community College Florissant Valley Biotechnology Program Some slides are from a downloaded PPT presentation from The
Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency.
Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. (a) Transfection of different concentration of GAS5-overexpressing
T-iPSC. Gra-iPSC. B-iPSC. TTF-iPSC. Supplementary Figure 1. Nature Biotechnology: doi: /nbt.1667
a T-iPSC Gra-iPSC B-iPSC TTF-iPSC Ectoderm Endoderm Mesoderm b Nature Biotechnology: doi:.38/nbt.667 Supplementary Figure Klf4 transgene expression Oct4 transgene expression.7 Fold GAPDH.6.5.4.3 Fold GAPDH
Anexo a la solicitud de depósito de la línea celular. Annexes to the deposited cell line. RP1-FiPS4F1
Anexo a la solicitud de depósito de la línea celular Annexes to the deposited cell line RP1-FiPS4F1 1 Marcadores de pluripotencia/ Pluripotency markers i) In situ staining for TRA-1-81 (bright field BF
Supplementary Information
Supplementary Information Supplementary Figure 1. ZBTB20 expression in the developing DRG. ZBTB20 expression in the developing DRG was detected by immunohistochemistry using anti-zbtb20 antibody 9A10 on
Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and
Determining positive selection gates for LRCs and nonlrcs Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and shape of the Gaussian distributions. For
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Effect of timing of DE dissociation and RA concentration on lung field specification in hpscs. (a) Effect of duration of endoderm induction on expression of
Supplemental Table/Figure Legends
MiR-26a is required for skeletal muscle differentiation and regeneration in mice Bijan K. Dey, Jeffrey Gagan, Zhen Yan #, Anindya Dutta Supplemental Table/Figure Legends Suppl. Table 1: Effect of overexpression
Nature Biotechnology: doi: /nbt.4166
Supplementary Figure 1 Validation of correct targeting at targeted locus. (a) by immunofluorescence staining of 2C-HR-CRISPR microinjected embryos cultured to the blastocyst stage. Embryos were stained
Genetic Identity. Steve Harris SPASH - Biotechnology
Genetic Identity Steve Harris SPASH - Biotechnology Comparison of Organisms ORGANISM GENES BASE PAIRS Lambda Phage 40 50,000 E.coli 400 5,000,000 Yeast 13,000 15,000,000 Human 20,000 3,000,000,000 (3 billion)
Formation of Embryonic Bodies to Produce Neural Stem Cells from ipscs Using the Corning Spheroid Microplate
Formation of Embryonic Bodies to Produce Neural Stem Cells from ipscs Using the Corning Spheroid Microplate Application Note Wesley Hung and Joanne Hsu Corning Research Center Taiwan, Science & Technology
Supplementary Figure 1. Mouse genetic models used for identification of Axin2-
Supplementary Figure 1. Mouse genetic models used for identification of Axin2- expressing cells and their derivatives. Schematic representations illustrate genetic cell labeling strategies to identify
Nanog-Luc. R-Luc. 40 HA-Klf Relative protein level of Klf USP21. Vector USP2 USP21 *** *** *** ***
:Flag Relative protein level of Relative protein level of : Flag Vec 21LV 21SV 2 : HA HA- HA- HA- HA-Klf4 Relative mrna expression Relative protein level of Relative protein level of Relative protein level
Supplementary Data. Supplementary Table S1.
Supplementary Data Supplementary Table S1. Primer Sequences for Real-Time Reverse Transcription-Polymerase Chain Reaction Gene Forward 5?3 Reverse 3?5 Housekeeping gene 36B4 TCCAGGCTTTGGGCATCA CTTTATCAGCTGCACATCACTCAGA
Supporting Information
Supporting Information Soft Conducting Polymer Hydrogels Cross-Linked and Doped by Tannic Acid for Spinal Cord Injury Repair Lei Zhou, 1, 2, # Lei Fan, 1, 2, 3, # Xin Yi, 1,2 Zhengnan Zhou, 4 Can liu,
Supplementary Figure 1.
Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed
Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number
Table S1. Components for knockout serum replacer medium (KSR medium) (500 ml) Component Supplier Catalogue number Stock Concentration Final concentration Volume used Advanced DMEM/F12 Invitrogen 12634010-78%
Supplementary Materials and Methods:
Supplementary Materials and Methods: Preclinical chemoprevention experimental design Mice were weighed and each mammary tumor was manually palpated and measured with digital calipers once a week from 4
Supplemental Information
Cell Stem Cell, Volume 12 Supplemental Information Human ipsc-derived Oligodendrocyte Progenitor Cells Can Myelinate and Rescue a Mouse Model of Congenital Hypomyelination Su Wang, Janna Bates, Xiaojie
Supplementary Data. Supplementary Figures. (A) Mock BV (B) (C) Transduction efficiency (%)
Supplementary Data Supplementary Figures (A) Mock BV (B) Transduction efficiency (%) 70 60 50 40 30 20 10 0 Mock BV (C) Transduction efficiency (%) 70 60 50 40 30 20 10 0 0 100 MOI 250 500 Fig. S1. BV
a previous report, Lee and colleagues showed that Oct4 and Sox2 bind to DXPas34 and Xite
SUPPLEMENTARY INFORMATION doi:1.138/nature9496 a 1 Relative RNA levels D12 female ES cells 24h Control sirna 24h sirna Oct4 5 b,4 Oct4 Xist (wt) Xist (mut) Tsix 3' (wt) Tsix 5' (wt) Beads Oct4,2 c,2 Xist
DNA typing of human cell lines: historical perspective Yvonne Reid, PhD Collection/Research Scientist ATCC Cell Biology
DNA typing of human cell lines: historical perspective Yvonne Reid, PhD Collection/Research Scientist ATCC Cell Biology Outline Molecular techniques for the authentication of human cell lines Mechanism
Distinctive features of single nucleotide alterations in induced pluripotent stem cells with different types of DNA repair deficiency disorders
Supplementary Information Distinctive features of single nucleotide alterations in induced pluripotent stem cells with different types of DN repair deficiency disorders Kohji Okamura, Hironari Sakaguchi,
Supplementary Information to Accompany. Precision Modulation of Neurodegenerative Disease-Related Gene Expression in Human ipsc-derived Neurons
Supplementary Information to Accompany Precision Modulation of Neurodegenerative Disease-Related Gene Expression in Human ipsc-derived Neurons Sabrina Mahalia Heman-Ackah 1,2,3,*, Andrew Roger Bassett
Supplementary Figure 1. ips_3y+mir-302b. ips_3y+mir-372. ips_3y+mir-302b + mir-372. ips_4y. ips_4y+mir-302b. ips_4y + mir-372
Supplementary Figure 1 ips_3y+mir-32b ips_3y+ ips_3y+mir-32b + ips_4y ips_4y+mir-32b ips_4y + Nature Biotechnology: doi:1.138/nb.t.1862 TRA-1-6 DAPI Oct3/4 Supplementary Figure 1: ips cells derived from
supplementary information
DOI: 10.1038/ncb2116 Figure S1 CDK phosphorylation of EZH2 in cells. (a) Comparison of candidate CDK phosphorylation sites on EZH2 with known CDK substrates by multiple sequence alignments. (b) CDK1 and
Detection of Histone Modifications at Specific Gene Loci in Single Cells in Histological Sections
Detection of Histone Modifications at Specific Gene Loci in Single Cells in Histological Sections Delphine Gomez; Laura L Shankman; Anh T Nguyen; Gary K Owens. Supplementary Figures 1-13 Supplementary
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic
Supplemental Figure 1
Supplemental Figure 1 A B 50 * 40 30 20 10 0 NeurofilamentM/βactin Relative expression control D neurogenic cond. PPARγ/ Relative expression C PPARγ Hprt OilRedO adipogenic cond. control 125 * 100 75 50
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb37 a mrna relative expression 1.3 1..8.5.3. CTR NGPS OCT4 SOX2 KLF4 c-myc b BANF1 mrna levels 1.2 1..8.6.4.2. plko.1 shbanf1 c Tra-1-6+ colonies 3 1 plko.1 shbanf1 d BANF1 locus Plasmid donor
Supplemental Information
Supplemental Information Induction of site-specific chromosome translocations in embryonic stem cells by CRISPR/Cas9 Authors Junfeng Jiang*, 1, 2, Li Zhang*, 2, 3, Xingliang Zhou*, 2, Xi Chen 2, Guanyi
5.4 PERIODONTAL LIGAMENT STEM CELL (PDLSC) ISOLATION. Having validated that the isolated PDL stromal cells possessed the major phenotypic
5.4 PERIODONTAL LIGAMENT STEM CELL (PDLSC) ISOLATION Having validated that the isolated PDL stromal cells possessed the major phenotypic characteristics of their tissue of origin, we next focused on identifying
To investigate the heredity of the WFP gene, we selected plants that were homozygous
Supplementary information Supplementary Note ST-12 WFP allele is semi-dominant To investigate the heredity of the WFP gene, we selected plants that were homozygous for chromosome 1 of Nipponbare and heterozygous
Apocynin suppression of NADPH oxidase reverses the aging process in mesenchymal stem cells. to promote osteogenesis and increase bone mass
Apocynin suppression of NADPH oxidase reverses the aging process in mesenchymal stem cells to promote osteogenesis and increase bone mass Jinlong Sun 1,2,4,a, Leiguo Ming 2,3,5,a, Fengqing Shang 2, Lijuan
Human Induced Pluripotent Stem Cells
Applied StemCell, Inc. (866) 497-4180 www.appliedstemcell.com Datasheet Human Induced Pluripotent Stem Cells Product Information Catalog Number Description Tissue Age Sex Race Clinical information Quantity
(a) Scheme depicting the strategy used to generate the ko and conditional alleles. (b) RT-PCR for
Supplementary Figure 1 Generation of Diaph3 ko mice. (a) Scheme depicting the strategy used to generate the ko and conditional alleles. (b) RT-PCR for different regions of Diaph3 mrna from WT, heterozygote
Int. J. Mol. Sci. 2016, 17, 1259; doi: /ijms
S1 of S5 Supplementary Materials: Fibroblast-Derived Extracellular Matrix Induces Chondrogenic Differentiation in Human Adipose-Derived Mesenchymal Stromal/Stem Cells in Vitro Kevin Dzobo, Taegyn Turnley,