Biology 445K Winter 2007 DNA Fingerprinting

Transcription

1 Biology 445K Winter 2007 DNA Fingerprinting For Friday 3/9 lab: in your lab notebook write out (in bullet style NOT paragraph style) the steps for BOTH the check cell DNA prep and the hair follicle DNA prep (pgs 4&5). EACH student will do both preps. Photocopy notebook pages and turn in to CT at beginning of lab. For each prep you will be using 400µl of extraction buffer. Read about PCR, DNA fingerprinting and Hardy-Weinberg in your genetics text. Work the problems 1-5 before Wednesday March 12. Put in lab notebook AND hand in photocopy A handout describing the PCR portion of this experiment will be distributed on FRIDAY Go to this link to see a PCR animation: Choosing primers: Links to the above sites as well as to DNA fingerprinting sites are posted on the Biol 445K web site DNA FINGERPRINTING WITH PCR uses PCR to analyze highly variable microsatellite or minisatellite [aka VNTR (variable numbers of tandem repeats)] loci to determine DNA identity (as in forensic blood tests) or to determine parentage of an individual. Minisatellite sites are highly polymorphic* regions of the genome that consist of repeated sequences. The repeat size is usually base pairs long and the number of repeats varies from less than ten to several dozen. These sites, which are scattered throughout the genome, are usually anonymous markers in the sense that the repeat number does not affect the phenotype of the individual and isn t associated with the functioning of a gene. *Recall that a polymorphic locus is typically defined as any gene or locus (site on a chromosome) that has more than one variation present within a population. This definition is of limited usefulness because at high levels of resolution (i.e. looking 1

2 at the DNA level at a very large number of individuals) most genes or loci will fit this definition. So, generally speaking, a gene or locus is polymorphic if the rarer allele(s) is (are) not too rare -- not less than 1% of the total copies in the population. Using DNA fingerprinting to exclude vs. to prove: Excluding identity: one set of mismatched genetic markers is sufficient Proving identity or proving parentage is another matter: the experimenter must examine a number of highly polymorphic loci in the genome and do probability calculations to estimate the likelihood of random matches (involves important concepts in population genetics relating to allele frequencies). D1S80 VNTR locus: The VNTR (minisatellite) locus D1S80 is located on the distal portion of the short arm of chromosome 1. This site is highly polymorphic with respect to the number of 16 base pair (bp) repeat units present between the priming sites. This locus has been used in population genetic studies, identification of extensively burned fire victims, identification of human remains and other forensic studies. #1 5 GAAACTGGCCTCCAAACACTGCCCGCCG 3 #2 5 GTCTTGTTGGAGATGCACGTGCCCCTTGC 3 The PCR bands generated with these primers represent codominant allelic products that typically range from ~300 bp s to ~800 bp s, depending on the number of 16-bp repeat units. In accordance with standard protocol the shortest allele is designated allele 1 (with 18 repeats) and each allele containing an additional repeat is designated as 2, 3, 4, etc. Examine the table shown on the next page. Note that 13 different alleles of this site were present in a sample of 94 Caucasians from the United States. A total of 28 alleles of this site have been observed, so this table is incomplete. 2

3 The D1S80 repeat unit is 16 base pairs (bp) in length and alleles range from approximately 350 to 1,000 bp. 3

4 PCR Template preparation: Each student will prep DNA from a hair follicle and from cheek cells. 4

5 Work the problems 1-5 before Wednesday March 12 TO HAND IN at beginning of class. 1. Refer to your genetics text. How many different genotypes are possible for a locus with 13 alleles? What is the general formula used for this calculation? 2. How many different heterozygous genotypes are possible at this locus? 5

6 Populations genetics and frequency estimations: There are two reasons a pair of DNA profiles (examining multiple VNTR sites) would match: the profiles came from the same individual the profiles came from two different individuals who share the same alleles at all VNTR sites tested. To address the latter possibility, a conservative statistical estimate is made as to how frequently the DNA profile in question might occur in a given population. 3. Consider a match between two profiles in which only the D1S80 site was examined. One DNA sample was from a forensic specimen (ie. blood or semen). The other was from an individual accused of the crime. If the forensic specimen was homozygous for allele 1, what is the chance that an individual picked at random from the population would be of the same genotype? if the specimen was heterozygous for alleles 13 and 11? [Assume the U.S. population meets the conditions of the Hardy-Weinberg equilibrium] 4. VNTR loci tested in DNA fingerprinting are on different chromosomes and so therefore show independent assortment. Consider estimates that incorporate data 6

7 from more than one polymorphic site. After the individual frequencies for each VNTR gene pair are calculated, they can be multipled together. In other words, the product rule of probability can be used to determine that likelihood of chance match when more than one site is examined. Fill in the table below: Calculating a DNA profile frequency Allele frequency Frequency of Combined Locus band 1/band 2 genotype (HW) frequency / / / / The cycling conditions for your PCR reactions are as follows. Step Time Temperature 1 10 min. 94 o C 2 1 min. 94 o C 3 1 min. 65 o C 4 1 min. 72 o C 5 Repeat more times 6 10 min 15 o C 7 Hold 4 o C a. For each step, briefly indicate what is occurring in the reaction at each step. b. What is the theoretical amplification achieved in this reaction? c. The annealing temperature typically depends on the stability of the templateprimer hybrid. What parameters would affect this stability? d. What is a primer dimer? 7