Appendix - I. Primer and Probe Sequences. MTUS1 gene
|
|
|
- Gary Ross
- 6 years ago
- Views:
Transcription
1
2 - I Primer and Probe Sequences MTUS1 gene MDel-F: 5' TGCATTTTTCTTCCTGTTTGG 3' (21 bases) MDel-R: 5' ATATCCTGTGCTCCTCACTGC 3' (21 bases) MEx4-F: 5' CCTTGAAAACTGCACAGTCG 3' (20 bases) MEx4-R: 5' CTCAGCTCACTGTGGGTGCT 3' (20 bases) LCE3B and LCE3C gene LCE-Del-F: 5' AATTTTGTGCTTCTGAAATCCA 3' (22 bases) LCE-Del-R: 5' ATTTCATTGAGCAGTGGTTTGT 3' (22 bases) LCE3C-F: 5' TTTGGAGCATGTTGTCAGGA 3' (20 bases) LCE3C-R: 5' AGGGTTAGGCACAGGGAACT 3' (20 bases) GSTM1 gene GSTM1-Del-F: 5' AAGACAGAGGAAGGGTGCATTTGATA 3' GSTM1-Del-R: 5' ACAGACATTCATTCCCAAAGCGACCA 3' GSM1-F2: 5' ATGAGCAGGCACAGTGAGTG 3' GSM1-R1: 5' TCTGTCAGATGCAGCTCACT 3' GSTT1 gene GSTT1-Del-F: 5' GAAGCCCAAGAATGGGTGTGTGTG 3' GSTT1-Del-R: 5' TGTCCCCATGGCCTCCAACATT 3' GST1-F2: 5' TACTGACCTGTCTTTGCCTT 3' GST1-R3: 5' CACAGAACACCTACGTGTTG 3' RNase P gene RNP-F: 5' AGATTTGGACCTGCGAGCG 3' (19 bases) RNP-R: 5' GAGCGGCTGTCTCCACAAGT 3' (20 bases) RNP: 5' VIC-TTCTGACCTGAAGGCTCTGCGCG-MGB 3' (23 bases) CCL3L1 gene CCL3L1-F: 5' TCTCCACAGCTTCCTAACCAAGA (23 bases) CCL3L1-R: 5' CTGGACCCACTCCTCACTGG (20 bases) CCL3L1: 5' FAM-AGGCCGGCAGGTCTGTGCTGA-MGB (21 bases) 141
3 FCGR3B gene FCGR3B-F: 5' CCCCTCCACCTTTTCTGGTAAG 3' (22 bases) FCGR3B-R: 5' TGGATCTGGGCTGGTCTGT 3' (19 bases) FCGR3B: 5' FAM-CTGGAGCCCTGGATCC-MGB 3' (16 bases) SULT1A1 gene SULT-F: 5' AGACATGAAGGAGGTGAGACC 3' (21 bases) SULT-R: 5' TCCAGGATCTTTTGAATCTCCC 3' (22 bases) SULT: 5' FAM- AGACATGAAGGAGGTGAGACC 3' (21 bases) 142
4 II How to make Primer-Probe (20x) mix Taqman Primer- probe concentration: Optimal concentration for primer (1x) Optimal concentration for probe (1x) 900nM 250nM Means 25 ul of reaction mix should have 900nmol x 25ul of each primer 1000ml 1000 ul = nmol per rxn (or) 22.5 pmol/rxn Similarly for Taqman probe 250nmol x 25ul 1000ml 1000 ul = nmol per rxn (or) 6.25 pmol/rxn Meaning 1.25 ul of the 20x Primer probe mix added to the 25ul reaction has 22.5 pmol of primers and 6.25 pmol of Probe. So 1ul of the 20x Taqman primer probe mix should have 18 pmol of each primer and 5 pmol of probe. (Cont d Next Page) 143
5 You are Supplied with: Primer concentration 10 nmol (Lyophilized) Probe concentration 100 um Stock 10 nmol primers: Forward Primer: Make up to 100 ul with 1x TE (0.01 M), which gives you 100 um solution (100pmol / ul) Reverse Primer: Make up to 100 ul with 1x TE (0.01 M), which gives you 100 um solution (100pmol / ul) 20x Primer probe mix: For 20x primer probe mix, we need 18pmol of each primer and 5 pmol of probe per ul. To make 100 ul of 20x Primer probe mix For primers V1 x N1 = V2 x N2 100 ul x 18 pmol = Y x 100 pmol Y = 18 ul (1800 pmol in 100 ul of 20x mix) For probe V1 x N1 = V2 x N2 100 ul x 5 pmol = Z x 100 pmol Z = 5 ul (500 pmol in 100 ul of 20x mix) To make 100 ul of 20x Primer probe mix, add 18 ul of Forward primer (100 um) 18 ul of Reverse primer (100 um) 5 ul of probe (100 um) 59 ul of 1xTE (0.01 M) Prepare 200 ul and make aliquots of 50 ul and freeze. Use 1.25 ul of the 20x Primer probe mix for your 25 ul reaction. 144
6 III Sequencing to confirm genotypes The genotyping method for detection of copy number variants has been validated by sequencing randomly selected samples. The PCR samples of MTUS1 (CNV type - exon specific deletion) and LCE3B and LCE3C (CNV - multigene deletion) were commercially sequenced at (Macrogen Inc., Seoul, Korea) using Sanger sequencing methodology. The results obtained were then analyzed. An example (MTUS1) of the methodology used for the detection of deletion is represented below. Strategy to detect MTUS1 exon4-specific deletion Figure A. A representation of the strategy used for the detection of MTUS1 deletion (Cont d Next Page)
7 Genome DNA sequence of MTUS1 (Reference sequence ID: ENSG ) Figure B. Localization of the primers used to detect MTUS1 deletion in the genomic sequence. The MTUS1 deletion (1128 bp, marked with dotted lines). Location of primers, deletion specific primers in yellow indicating the presence of deletion generating 271 bp amplicon size as a PCR product (highlighted in grey) and exon 4 specific primes in blue indicating the absence of deletion by generating 133 bp amplicon size as a PCR product (highlighted in grey). The PCR products were thus sequenced to confirm the deletion in MTUS1. (Cont d Next Page) 146
8 MTUS1 PCR products A B Figure C: The chromatogram of the PCR products obtained for MTUS1 genotyping. 147
Plasma EGFR T790M ctdna status is associated with clinical outcome in. advanced NSCLC patients with acquired EGFR-TKI resistance
Plasma EGFR T790M ctdna status is associated with clinical outcome in advanced NSCLC patients with acquired EGFR-TKI resistance 1# D Zheng; 2# X Ye; 3 MZ Zhang; 2 Y Sun; 1 JY Wang; 1 J Ni; 1 HP Zhang;
Designing TaqMan MGB Probe and Primer Sets for Gene Expression Using Primer Express Software Version 2.0
Designing TaqMan MGB Probe and Primer Sets for Gene Expression Using Primer Express Software Version 2.0 Overview This tutorial details how a TaqMan MGB Probe can be designed over a specific region of
GENOTYPING BY PCR PROTOCOL FORM MUTANT MOUSE REGIONAL RESOURCE CENTER North America, International
Please provide the following information required for genetic analysis of your mutant mice. Please fill in form electronically by tabbing through the text fields. The first 2 pages are protected with gray
PrimePCR Assay Validation Report
Gene Information Gene Name keratin 78 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT78 Human This gene is a member of the type II keratin gene family
Loss of Native Allele Protocol for KOMP-Regeneron derived ESC lines January 9 th 2009
Loss of Native Allele Protocol for KOMP-Regeneron derived ESC lines January 9 th 2009 I. Alkaline DNA extraction in 96 well format Solutions 50mM NaOH 1M Tris-HCl ph 8.0 1. Grow ES cells in a 96-well TC
Supplemental Figure 1.
Supplemental Data. Charron et al. Dynamic landscapes of four histone modifications during de-etiolation in Arabidopsis. Plant Cell (2009). 10.1105/tpc.109.066845 Supplemental Figure 1. Immunodetection
Procomcure Biotech. PCR Reagents
Procomcure Biotech PCR Reagents valid for 2018 VitaTaq DNA Polymerase is a standard Taq DNA polymerase suitable for all common PCR applications like colonypcr, cloning applications, high-throughput PCR
Targeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales
Targeted Sequencing Using Droplet-Based Microfluidics Keith Brown Director, Sales brownk@raindancetech.com Who we are: is a Provider of Microdroplet-based Solutions The Company s RainStorm TM Technology
Ramp1 EPD0843_4_B11. EUCOMM/KOMP-CSD Knockout-First Genotyping
EUCOMM/KOMP-CSD Knockout-First Genotyping Introduction The majority of animals produced from the EUCOMM/KOMP-CSD ES cell resource contain the Knockout-First-Reporter Tagged Insertion allele. As well as
Usp14 EPD0582_2_G09. EUCOMM/KOMP-CSD Knockout-First Genotyping
EUCOMM/KOMP-CSD Knockout-First Genotyping Introduction The majority of animals produced from the EUCOMM/KOMP-CSD ES cell resource contain the Knockout-First-Reporter Tagged Insertion allele. As well as
A novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase
A novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase tag insertion at the 3 end using CRISPR-Cas9 genome editing technique Sambuddha Basu 1, 3, Levi Adams 1, 3, Subhrangshu
Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b)
Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) A schematic overview of the production and amplification of a single pirna from a transposon transcript. The
TaqPath ProAmp Master Mixes
PRODUCT BULLETIN es es Applied Biosystems TaqPath ProAmp Master Mixes are versatile master mixes developed for high-throughput genotyping and copy number variation (CNV) analysis protocols that require
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID protein kinase N1 PKN1 Human The protein encoded by this gene belongs to the protein
Instructions for Use Life Science Kits & Assays
Instructions for Use Life Science Kits & Assays Product specifications 1 Product specifications The innumix qpcr MasterMix Probe has been developed for fast, highly reproducible real-time PCR and has been
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID protein phosphatase, Mg2+/Mn2+ dependent, 1A PPM1A Human The protein encoded by
Real-Time PCR Applications and Genomic Assays. Absolute Quantification. Is there any (amplifiable) DNA? How much DNA is there?
Real-Time PCR Applications and Genomic Assays Absolute Quantification Is there any (amplifiable) DNA? How much DNA is there? 2 Microorganism Quantitation Type Viruses Bacteria Fungi Parasites Examples
PrimePCR Assay Validation Report
Gene Information Gene Name keratin associated protein 9-2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRTAP9-2 Human This protein is a member of the keratin-associated
PrimePCR Assay Validation Report
Gene Information Gene Name minichromosome maintenance complex component 8 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID MCM8 Human The protein encoded by
PrimePCR Assay Validation Report
Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha
PrimePCR Assay Validation Report
Gene Information Gene Name SRY (sex determining region Y)-box 6 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SOX6 Human This gene encodes a member of the
Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
PrimePCR Assay Validation Report
Gene Information Gene Name keratin 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT3 Human The protein encoded by this gene is a member of the keratin
Amplicon size (bp) E ± SD
Development of a probe-based qpcr assay for the detection of constitutional and somatic deletions in the NF1 gene. Application to genetic testing and tumor analysis. Terribas E, Garcia-Linares C, Lázaro
CRISPR Ribonucleoprotein (RNP) User Manual
CRISPR Ribonucleoprotein (RNP) User Manual Description This user manual describes how to use GenScript s CRISPR Ribonucleoprotein (RNP) products for targeted genome editing. The RNP system is comprised
PrimePCR Assay Validation Report
Gene Information Gene Name integrin, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID ITGA1 Human This gene encodes the alpha 1 subunit of integrin
Human TNF qpcr primer pair
Shipping and Storage information Catalog No. Amount Reaction number of 25-μl volume Shipping and Storage Package tube 2 nmol 200 lyophilized powder 1 Information of the target gene and primers Species
TQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 2 TQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 5
www.smobio.com Product Information ExcelTaq series 2X Q-PCR Master Mix (SYBR, no ROX) TQ1100 200 RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 2 TQ1101 500 RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x
Precise quantification of Ion Torrent libraries on the QuantStudio 3D Digital PCR System
APPLICATION NOTE QuantStudio 3D Digital PCR System Precise quantification of Ion Torrent libraries on the QuantStudio 3D Digital PCR System Introduction The template preparation step in the next-generation
2X Q-PCR Master Mix 1 ml x 2 (SYBR, ROX) Storage Aliquot to avoid multiple freeze-thaw cycles Protect from light -20 C for 12 months
www.smobio.com Product Information ExcelTaq series 2X Q-PCR Master Mix (SYBR, ROX) TQ1110 200 RXN 2X Q-PCR Master Mix 1 ml x 2 (SYBR, ROX) Storage Aliquot to avoid multiple freeze-thaw cycles Protect from
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID glyceraldehyde-3-phosphate dehydrogenase GAPDH Human The product of this gene catalyzes
A Recommended Procedure for Real-Time Quantitative TaqMan PCR for Roundup Ready Canola RT73 Monsanto Biotechnology Regulatory Sciences
Page 1 of 7 Overview Purpose & Scope This procedure describes an event-specific real-time TaqMan PCR method for determination of the relative content of Roundup Ready canola RT73 (hereafter referred to
PrimePCR Assay Validation Report
Gene Information Gene Name major histocompatibility complex, class II, DR beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID HLA-DRB1 Human HLA-DRB1 belongs
PrimePCR Assay Validation Report
Gene Information Gene Name 3-hydroxybutyrate dehydrogenase, type 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID BDH1 Human This gene encodes a member of
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID peptidylglycine alpha-amidating monooxygenase PAM Human This gene encodes a multifunctional
PrimePCR Assay Validation Report
Gene Information Gene Name laminin, beta 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID LAMB3 Human The product encoded by this gene is a laminin that
QIAGEN Supplementary Protocol
Triplex to 5-plex real-time PCR analysis using the QuantiFast Pathogen PCR +IC Kit on the Rotor-Gene Q This protocol describes how to use the QuantiFast Pathogen PCR +IC Kit to perform real-time PCR analysis
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID caspase 9, apoptosis-related cysteine peptidase CASP9 Human This gene encodes a
Internal controls for real-time PCR-based pathogen identification
Internal controls for real-time PCR-based pathogen identification QIAGEN Dr. Lillian Roth Lead Scientist Veterinary R&D Team Global R&D Competence Center Applied Testing QIAGEN webinar June 1, 2011 Introduction
PrimePCR Assay Validation Report
Gene Information Gene Name bestrophin 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID BEST3 Human BEST3 belongs to the bestrophin family of anion channels
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase
LATE-PCR. Linear-After-The-Exponential
LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,
Droplet Digital PCR: QX100 System. QX100 Droplet Digital PCR System
Droplet Digital PCR: QX1 System QX1 Droplet Digital PCR System A Breakthrough in Quantitative PCR The QX1 Droplet Digital PCR system is the third generation of PCR technology. Droplet Digital PCR (ddpcr
PrimePCR Assay Validation Report
Gene Information Gene Name glutathione S-transferase alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID GSTA1 Human Cytosolic and membrane-bound forms
Nature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Workflow for multimodal analysis using sc-gem on a programmable microfluidic device (Fluidigm). 1) Cells are captured and lysed, 2) RNA from lysed single cell is reverse-transcribed
Puritan Report for Batch PC Lot# 3127, Blue Pink and Yellow. Swabs were received for testing on May 22, 2012
Puritan Report for Batch 25-806 2PC Lot# 3127, Blue Pink and Yellow Prepared by the University of Maine DNA Sequencing Facility/ Patty Singer, June 8, 2012 Swabs were received for testing on May 22, 2012
Genomic DNA was extracted from 3 to 5 ml of blood collected in EDTA blood collection tubes
Supplementary information Methods DNA and RNA extraction Genomic DNA was extracted from to ml of blood collected in EDTA blood collection tubes using the Gentra Puregene Blood kit (Qiagen, California,
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Schwarz UI, Ritchie MD, Bradford Y, et al. Genetic determinants
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID Glyceraldehyde-3-phosphate dehydrogenase Gapdh Rat This gene encodes a member of
BioBank TM cdna Kit. Instructions for the use of BioBank TM cdna in real-time PCR. BioBank control cdna
BioBank TM cdna Kit Instructions for the use of BioBank TM cdna in real-time PCR BB BioBank control cdna Contents Introduction 3 Kit Contents 4 Reagents and Equipment to Be Supplied by User 4 PrimerDesign
PrimePCR Assay Validation Report
Gene Information Gene Name ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID ATP2A2 Human This gene
High-throughput genotyping of CRISPR/Cas9-mediated mutants using fluorescent
High-throughput genotyping of CRISPR/Cas9-mediated mutants using fluorescent PCR-capillary gel electrophoresis Muhammad Khairul RAMLEE, Tingdong YAN, Alice M. S. CHEUNG, Charles CHUAH, Shang LI Figure
Student Learning Outcomes (SLOS)
Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID mcf.2 transforming sequence-like Mcf2l Mouse Description Not Available C130040G20Rik,
Kayhan Azadmanesh MD, Ph.D. Virology Department
Principles of molecular tests Kayhan Azadmanesh MD, Ph.D. Virology Department Pasteur Institute t of Iran 1 DNA molecule (1954) 2 Southern Blot (1975) 3 We needed to know the sequence of the genes and
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID myeloperoxidase MPO Human Myeloperoxidase (MPO) is a heme protein synthesized during
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID PARK2 co-regulated PACRG Human This gene encodes a protein that is conserved across
Supplementary Figure 1
Supplementary Figure 1 Concept of barcoding to suppress error in sequencing. Each template DNA molecule is barcoded with a random and unique sequence (marked as red, turquoise and green). All PCR generated
Puro. Knockout Detection (KOD) Kit
Puro Knockout Detection (KOD) Kit Cat. No. CC-03 18 Oct. 2016 Contents I. Kit Contents and Storage II. Product Overview III. Methods Experimental Outline Genomic DNA Preparation Obtain Hybrid DNA Digest
PrimePCR Assay Validation Report
Gene Information Gene Name peptidylprolyl isomerase A (cyclophilin A) Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID PPIA Human This gene encodes a member
Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines
Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping
Rotor-Gene Multiplex Handbook
Second Edition July 2011 Rotor-Gene Multiplex Handbook Rotor-Gene Multiplex PCR Kit Rotor-Gene Multiplex RT-PCR Kit For fast multiplex real-time PCR, two-step RT-PCR, and one-step RT-PCR using sequence-specific
Sequencing and PCR. Training: Ion S5 and S5 XL Systems workflow training
Training: Ion S5 and S5 XL Systems workflow training This interactive course focuses on the Ion S5 and Ion S5 XL Systems operation and the Ion AmpliSeq workflow on the Ion Chef System for sequencing. The
Event COT102 Cotton. Real-time, Event-specific Polymerase Chain Reaction Method
Event COT102 Cotton Real-time, Event-specific Polymerase Chain Reaction Method Syngenta Crop Protection, LLC 3054 East Cornwallis Road PO Box 12257 Research Triangle Park, NC 27709-2257, USA For technical
Annex 6.2 CDC real-time measles RT-PCR protocol targeting measles N gene (75 nt region)
Annex 6.2 CDC real-time measles RT-PCR protocol targeting measles N gene (75 nt region) NOTE: This document is intended to provide basic test method details and is not an SOP. Laboratories need to develop
1. The AGI (Arabidospis Genome Initiative) convention gene names or AtRTPrimer ID should
We will show how users can select their desired types of primer-pairs, as we explain each of forms indicated by the blue-filled rectangles of Figure 1. Figure 1 Front-end webpage for searching desired
Real-time RT-PCR Protocol for the Detection of A(H7N9) Influenza Virus
Real-time RT-PCR Protocol for the Detection of A(H7N9) Influenza Virus 8 April 2013 The WHO Collaborating Center for Reference and Research on Influenza at the, Beijing, China, has made available attached
PrimePCR Assay Validation Report
Gene Information Gene Name heat shock 10kDa protein 1 (chaperonin 10) Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID HSPE1 Human This gene encodes a major
Annex 6.5 CDC real-time rubella RT-PCR protocol targeting rubella p150 gene (154 nt region)
Annex 6.5 CDC real-time rubella RT-PCR protocol targeting rubella p150 gene (154 nt region) NOTE: This document is intended to provide basic test method details and is not an SOP. Laboratories need to
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID STE20-related kinase adaptor alpha STRADA Human The protein encoded by this gene
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID Peptidyl-glycine alpha-amidating monooxygenase Peptidylglycine alpha-hydroxylating
TaqMan Assays for genetic variation research. Superior performance reliable, robust solutions
TaqMan Assays for genetic variation research Superior performance reliable, robust solutions Genetic variation: decoding the blueprint for biodiversity Research on genetic variation in animals and plants
A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish
Developmental Cell Supplemental Information A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish Julien Ablain, Ellen M. Durand, Song Yang, Yi Zhou, and Leonard I. Zon % larvae
SUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL MATERIALS AND METHODS Generation of TSPOΔ/Δ murine embryonic fibroblasts Embryos were harvested from 13.5-day pregnant TSPOfl/fl mice. After dissection to eviscerate and remove the
PrimePCR Assay Validation Report
Gene Information Gene Name keratin 5 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT5 Human The protein encoded by this gene is a member of the keratin
Deletion of Indian hedgehog gene causes dominant semi-lethal Creeper trait in chicken
1 Supplementary information 2 3 4 5 6 7 Deletion of Indian hedgehog gene causes dominant semi-lethal Creeper trait in chicken 8 9 10 11 12 Sihua Jin 1, Feng Zhu 1, Yanyun Wang 1, Guoqiang Yi 1, Junying
HELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H)
![HELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H)](/thumbs/87/95094490.jpg "HELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H)")
HELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H) Quantitative In vitro diagnostics Instruction manual Cat. No: 8001-25/50/100 tests Compatible with: Agilent, Bio-Rad, Applied Bio systems
Molecular Biology and Functional Genomic Core Facility
Molecular Biology and Functional Genomic Core Facility General Presentation Dr Odile Neyret Core Manager Myriam Rondeau Research Assistant Agnès Dumont Research Assistant Institut de recherche clinique
foodproof SL GMO Maize Multiplex Detection Kit
For food testing purposes. FOR IN VITRO USE ONLY. foodproof SL GMO Maize Multiplex Detection Kit (MON88017, NK603, MIR162) - 5 Nuclease - Version 1, November 2014 PCR kit for the qualitative detection
#K0262 For 1000 reactions of 25 µl Lot Exp.. Store at -20 C in the dark. V
PRODUCT INFORMATION Thermo Scientific Maxima Probe qpcr Master Mix (2X), ROX Solution provided #K0262 For 1000 reactions of 25 µl Lot Exp.. Store at -20 C in the dark. V CERTIFICATE OF ANALYSIS The absence
Instructions for Use Life Science Kits & Assays
Instructions for Use Life Science Kits & Assays Product specifications 1 Product specifications The innumix qpcr SyGreen Sensitive has been developed for fast, highly reproducible real-time PCR and has
foodproof SL GMO Maize Multiplex Detection Kit
For food testing purposes. FOR IN VITRO USE ONLY. foodproof SL GMO Maize Multiplex Detection Kit (MON89034, CBH351, Bt176) - 5 Nuclease - Version 1, November 2014 PCR kit for the qualitative detection
Detecting Rare Genomic Copies or Events
Detecting Rare Genomic Copies or Events Integrated DNA Technologies Nick Downey, PhD Common Diagnostics Challenges Detecting targets early with accuracy Detecting different strains (e.g., antibiotic resistance)
Module1TheBasicsofRealTimePCR Monday, March 19, 2007
Objectives Slide notes: Page 1 of 41 Module 1: The Basics Of Real Time PCR Slide notes: Module 1: The Basics of real time PCR Page 2 of 41 Polymerase Chain Reaction Slide notes: Here is a review of PCR,
PrimePCR Assay Validation Report
Gene Information Gene Name cholinergic receptor, nicotinic, alpha 9 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID CHRNA9 Human This gene is a member of
PrimePCR Assay Validation Report
Gene Information Gene Name transforming growth factor, beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID TGFB1 Human This gene encodes a member of the
MRC-Holland MLPA. Description version 12; 16 March 2015
P128-C1 Cytochrome P450 mix Lot C1-1014. As compared to version B2 (lot B2-0811), nine reference s have been replaced and one CYP2D6 has been removed. This SALSA mix is for basic research and intended
CSS451 Spring 2010 Polymerase Chain Reaction Laboratory
CSS451 Spring 2010 Polymerase Chain Reaction Laboratory The purpose of the polymerase chain reaction (PCR) is to amplify specific segments of DNA. If one knows the DNA sequence of regions of DNA that flank
Supporting Information
Supporting Information Park et al. 10.1073/pnas.1410555111 5 -TCAAGTCCATCTACATGGCC-3 5 -CAGCTGCCCGGCTACTACTA-3 5 -TGCAGCTGCCCGGCTACTAC-3 5 -AAGCTGGACATCACCTCCCA-3 5 -TGACAGGAACACCTACAAGT-3 5 -AAGGCACCTTTCTGTCTCCA-3
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID coagulation factor XIII, A1 polypeptide F13A1 Human This gene encodes the coagulation
DNA Genotyping from Human FFPE Samples Reliable and Reproducible
DNA Genotyping from Human FFPE Samples Reliable and Reproducible Use this optimized protocol to obtain reliable and reproducible SNP Genotyping data from those difficult human FFPE samples. 1 FFPE DNA Isolation
CENTER FOR CELL & GENE THERAPY VECTOR DEVELOPMENT LABORATORY, 10 TH FLOOR, ALKEK BUILDING ONE BAYLOR PLAZA, HOUSTON, TEXAS 77030
1. Purpose 1.1. The purpose of this protocol is to detect host cell DNA contamination in purified viral vector preparations. 1.2. This procedure is routinely performed in the Vector Development Laboratory
Supplementary Figure S1. The tetracycline-inducible CRISPR system. A) Hela cells stably
Supplementary Information Supplementary Figure S1. The tetracycline-inducible CRISPR system. A) Hela cells stably expressing shrna sequences against TRF2 were examined by western blotting. shcon, shrna
02 Agenda Item 03 Agenda Item
01 Agenda Item 02 Agenda Item 03 Agenda Item SOLiD 3 System: Applications Overview April 12th, 2010 Jennifer Stover Field Application Specialist - SOLiD Applications Workflow for SOLiD Application Application
Applications and Uses. (adapted from Roche RealTime PCR Application Manual)
What Can You Do With qpcr? Applications and Uses (adapted from Roche RealTime PCR Application Manual) What is qpcr? Real time PCR also known as quantitative PCR (qpcr) measures PCR amplification as it
Real-Time PCR Validations
Real-Time PCR Validations Relative gene expression Example experiment: I have 2 samples: untreated and treated. Question: What happens to the expression of gene X when I treat the cells? Answer: Expressed
Supplementary Information
Supplementary Information Super-resolution imaging of fluorescently labeled, endogenous RNA Polymerase II in living cells with CRISPR/Cas9-mediated gene editing Won-Ki Cho 1, Namrata Jayanth 1, Susan Mullen
PrimePCR Assay Validation Report
Gene Information Gene Name cytochrome P450, family 2, subfamily C, polypeptide 9 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID CYP2C9 Human This gene encodes
MASSEY GENOME SERVICE SEPTEMBER 2014 NEWSLETTER
MASSEY GENOME SERVICE SEPTEMBER 2014 NEWSLETTER Welcome to the September 2014 issue of the Massey Genome Service (MGS) Newsletter. ILLUMINA MiSEQ NEXT GENERATION SEQUENCING A reminder, all enquiries regarding