Linking the EMBL Australia Bioinformatics Resource with the Australian National Data Service
|
|
|
- Holly Owen
- 6 years ago
- Views:
Transcription
1 Linking the EMBL Australia Bioinformatics Resource with the Australian National Data Service JEFF CHRISTIANSEN ANDS PIERRE CHAUMEIL - QFAB DOMINIQUE GORSE QFAB MARK RAGAN IMB/UQ
2 EMBL Australia Australia has become the first Associate Member of the European Molecular Biology Laboratory EMBL (2009) EMBL Australia, when fully established, will consist of two Groups at EMBL-Heidelberg and/or outstations including the European Bioinformatics Institute (EBI) a Partner Laboratory Network in Australia full participation in EMBL postdoctoral, student & training programs Secretariat (at ARMI/Monash) Additionally a mirror of the EBI database will be established to facilitate biology data access and computation access in Australia Foundation partners CSIRO, Monash, UQ, U Sydney, UWA Also represented on Council DIISRTE, ARC, NHMRC
3 EBI Database Created and managed by EMBL 30+ databases (sequence, expression, pathways, structure, taxonomy, molecular interaction, ontologies) computational tools Based in Cambridge (Hinxton) UK One
4 EMBL Australia Bioinformatics Resource A selection of EBI databases and tools mirrored to Increases ease of access to data for Australian-based users Will allow access to HPC-based computational analyses of large datasets
5 Project: Linking EMBL Australia Bioinformatics mirror and RDA
6 DNA/protein sequence publishing practices INSTRUCTIONS TO AUTHORS: GENE SEQUENCES Authors must deposit all relevant information and data into the appropriate public databases, including but not limited to one of the International Nucleotide Sequence Database Collaboration members. Note that submission into one of the following sequence database ensures that the others will also receive the sequences: GenBank, the NIH's genetics sequence database EMBL-Bank, The EMBL Nucleotide Sequence Database DDBJ, DNA Data Bank of Japan To prevent an article being delayed in publication provide all accession numbers at final submission.
7 DNA/protein sequence metadata DATA METADATA LOCUS X bp mrna linear ROD 20-MAR-1996 DEFINITION M.musculus wnt-11 mrna. ACCESSION X70800 VERSION X GI: KEYWORDS embryogenesis; glycoprotein; wnt gene. SOURCE Mus musculus (house mouse) Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Sciurognathi; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 1821) AUTHORS Christiansen,J.H., Dennis,C.L., Wicking,C.A., Monkley,S.J., Wilkinson,D.G. and Wainwright,B.J. TITLE Murine Wnt-11 and Wnt-12 have temporally and spatially restricted expression patterns during embryonic development JOURNAL Mech. Dev. 51 (2-3), (1995) PUBMED REFERENCE 2 (bases 1 to 1821) AUTHORS Wainwright,B.J. TITLE Direct Submission JOURNAL Submitted (27-JAN-1993) B.J. Wainwright, Centre for Molecular Biology & Biotechn., University of Queensland, St. Lucia, Brisbane, 4072, AUSTRALIA ORIGIN 001 gaattcgggc ctaatccgag cctgacgccg gcgggtctcg ggcggttcgg ggagagagcg 061 gactccttcc tcgctcagcc tccccggccc gacccctcct ttgtaatttg aataaaacgc 121 ctcccagccc gcgcgccgcc ttaacccgcc gccctgttct ccgtgattgc aggcggcgtg 181 cgcgcaggaa cagcagcggt ggcctgcagg cggcggagtt cggtgcggct cctgcagggt 241 gcgacccccg ggacgccggg ccgcgcgacg atgagggcgc ggccgcaggt ctgcgaggct
8 EBI Collections of Australian Interest (1) DNA/protein sequences from Australian dwelling species
9 EBI Collections of Australian Interest (1) Species as the lowest collection entry level Fully sequenced genomes Nucleotide sequences Protein sequences DNA/protein data for 364,164 species has been deposited in the EBI Species taxonomy identifies higher level groupings (EBI utilises NCBI taxonomy) e.g. Macropus rufus; Macropodia; Diprodontia; Marsupialia; Mammalia; Vertebrata; Animalia.
10 EBI Collections of Australian Interest (1) Identification of Australian dwelling species (native, feral, agriculturally important) Australian Plant Census (info from State Herbaria via ALA) Australian Faunal Directory (DSEWPC - info via ALA) 70,703 plant species listed (APC) 101,048 animal species listed (AFD)
11 EBI Collections of Australian Interest (1) DNA/protein sequences from Australian dwelling species DNA/protein seq for 364,164 worldwide dwelling species in EBI
12 EBI Collections of Australian Interest (1) DNA/protein sequences from Australian dwelling species DNA/protein seq for 364,164 worldwide dwelling species in EBI 171,751 Australian dwelling plants and animals
13 EBI Collections of Australian Interest (1) DNA/protein sequences from Australian dwelling species DNA/protein seq for 364,164 worldwide dwelling species in EBI 171,751 Australian dwelling plants and animals DNA/protein seq collections for 12,825 Australian dwelling plants and animals
14 EBI Collections of Australian Interest (1) DNA/protein sequences from Australian dwelling species 12,825 species and 697 assoc higher-level (e.g. genus, family, phyla) groupings. Scientific and common names included to increase discoverability 13,522 collection descriptions published to RDA DNA/protein seq collections for 12,825 Australian dwelling plants and animals
15 October
16 EBI Collections of Australian Interest (2) DNA/protein sequences submitted by Australian Research Organisations
17 EBI Collections of Australian Interest (2) Identification of Australian Research-Associated Organisations ARC (incl. linkage) grants ( ) NHMRC grants ( ) Australian Biological Research-Associated Organisations identified
18 EBI Collections of Australian Interest (2) DNA/protein sequences submitted by Australian Research Organisations DNA/protein seq submitted from 1000s of Organisations world-wide in EBI
19 EBI Collections of Australian Interest (2) DNA/protein sequences submitted by Australian Research Organisations DNA/protein seq submitted from 1000s of Organisations world-wide in EBI 201 Australian Research Organisations
20 EBI Collections of Australian Interest (2) DNA/protein sequences submitted by Australian Research Organisations DNA/protein seq submitted from 1000s of Organisations world-wide in EBI 201 Australian Research Organisations DNA/protein seq collections from 101 Australian research Organisations
21 EBI Collections of Australian Interest (2) DNA/protein sequences submitted by Australian Research Organisations 101 institutions and 8 assoc higher-level (i.e. State/Federal) groupings. 109 collection descriptions fed to RDA DNA/protein seq collections from 101 Australian research Organisations
22 Submitting to RDA descriptions of workflows performed using the NCI-SF & Bioinformatics Resource (EABR) Users Outreach Training & Support Interface Galaxy in the Cloud Yabi Bioinformatics Resource data & services RDA Metadata Resource UQ RCC NeCTAR GVL NCI SF Bioinformatics Bioinformatics Resource Initiative NeCTAR NCRIS EMBL Australia
23 Submitting to RDA descriptions of workflows performed using the NCI-SF & Bioinformatics Resource (EABR)
24 Submitting to RDA descriptions of workflows performed using the NCI-SF & Bioinformatics Resource (EABR) Yabi: NCRIS 5.16 NeAT Project Grid enabled Internet-based environment for transparent access to HPC Lead by Matthew Bellgard (CCG Director and ABF Convenor) Project Committee: CCG, ABF, ARCS, ANDS, CSIRO, VLSCI, QFAB
25 Yabi Screenshot
26 Yabi Workflow Manager
27 Acknowledgements QFAB Team Pierre Chaumeil Felicity Newell Troy Sadkowsky Dominique Gorse Jeremy Barker Cas Simons Nick Rhodes Sarah Williams CCG Group Andrew Macgregor Adam Hunter Matthew Bellgard EMBL Australia Gavin Graham Gerald Hartig David Green ANDS Group Jeff Christiansen
28 This project is supported by the Australian National Data Service (ANDS) ANDS is supported by the Australian Government through the National Collaborative Research Infrastructure Strategy Program and the Education Investment Fund (EIF) Super Science Initiative
Global Biomolecular Information Infrastructure and Australia. Graham Cameron Director The EMBL Australia Bioinformatics Resource
Global Biomolecular Information Infrastructure and Australia Graham Cameron Director The EMBL Australia Bioinformatics Resource What is bioinformatics? Methods, data, IT to exploit biomolecular information
Bioinformatics overview
Bioinformatics overview Aplicações biomédicas em plataformas computacionais de alto desempenho Aplicaciones biomédicas sobre plataformas gráficas de altas prestaciones Biomedical applications in High performance
NiceProt View of Swiss-Prot: P18907
Hosted by NCSC US ExPASy Home page Site Map Search ExPASy Contact us Swiss-Prot Mirror sites: Australia Bolivia Canada China Korea Switzerland Taiwan Search Swiss-Prot/TrEMBL for horse alpha Go Clear NiceProt
EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science
EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can
QFAB Alliance. Jeremy Barker. Queensland Facility for Advanced Bioinformatics. ARC Centre of Excellence in Bioinformatics University of Queensland
Jeremy Barker Chief Executive Officer Queensland Facility for Advanced Bioinformatics QFAB Alliance ARC Centre of Excellence in Bioinformatics University of Queensland Institute for Molecular Bioscience
Types of Databases - By Scope
Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of
AAGTGCCACTGCATAAATGACCATGAGTGGGCACCGGTAAGGGAGGGTGATGCTATCTGGTCTGAAG. Protein 3D structure. sequence. primary. Interactions Mutations
Introduction to Databases Lecture Outline Shifra Ben-Dor Irit Orr Introduction Data and Database types Database components Data Formats Sample databases How to text search databases What units of information
Introduction to EMBL-EBI.
Introduction to EMBL-EBI www.ebi.ac.uk What is EMBL-EBI? Part of EMBL Austria, Belgium, Croatia, Denmark, Finland, France, Germany, Greece, Iceland, Ireland, Israel, Italy, Luxembourg, the Netherlands,
Introduction and Public Sequence Databases. BME 110/BIOL 181 CompBio Tools
Introduction and Public Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 29, 2011 Course Syllabus: Admin http://www.soe.ucsc.edu/classes/bme110/spring11 Reading: Chapters 1, 2 (pp.29-56),
Introduction to BIOINFORMATICS
Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What
European Genome phenome Archive at the European Bioinformatics Institute. Helen Parkinson Head of Molecular Archives
European Genome phenome Archive at the European Bioinformatics Institute Helen Parkinson Head of Molecular Archives What is EMBL-EBI? International, non-profit research institute Part of the European Molecular
Computational Biology and Bioinformatics
Computational Biology and Bioinformatics Computational biology Development of algorithms to solve problems in biology Bioinformatics Application of computational biology to the analysis and management
Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks
Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional
ELE4120 Bioinformatics. Tutorial 5
ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar
'Bioinformatics in academia as related to ehealth' - including the "Genomic Virtual Lab"
'Bioinformatics in academia as related to ehealth' - including the "Genomic Virtual Lab" Dr Gareth Price Head of Computational Biology Queensland Facility of Advanced Bioinformatics From Genomes to Systems
Two Mark question and Answers
1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three
Gene-centered resources at NCBI
COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving
EMBL-ABR Node Application Form
EMBL-ABR Node Application Form Table of Contents EMBL-ABR Node Application Form... 1 Part A: Summary of EMBL-ABR Node... 2 A1: Synopsis... 2 A2: Snapshot of services/activities... 4 Part B: Administrative
Chapter 2: Access to Information
Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI
Nordic Register and Biobank Data
Nordic Register and Biobank Data A basis for innovative research on health and welfare Juni Palmgren Karolinska Institutet, Stockholm Nordic conference on Real World Data Helsinki November 2016 Nordic
The University of California, Santa Cruz (UCSC) Genome Browser
The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,
BIOPLATFORMS AUSTRALIA ANNUAL REPORT 2014 WORLD CLASS INNOVATION
BIOPLATFORMS AUSTRALIA ANNUAL REPORT 2014 WORLD CLASS INNOVATION 1 CONTENTS CHAIRMANS REPORT 4 16 6 BIOPLATFORMS AUSTRALIA PROFILE 18 21 ACCESSIBILITY COLLABORATIONS AND PARTNERSHIPS GOVERNANCE 8 2013/14
Introduction to Bioinformatics for Medical Research. Gideon Greenspan TA: Oleg Rokhlenko. Lecture 1
Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il TA: Oleg Rokhlenko Lecture 1 Introduction to Bioinformatics Introduction to Bioinformatics What is Bioinformatics?
Bioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
Introduc)on to Databases and Resources Biological Databases and Resources
Introduc)on to Bioinforma)cs Online Course : IBT Introduc)on to Databases and Resources Biological Databases and Resources Learning Objec)ves Introduc)on to Databases and Resources - Understand how bioinforma)cs
Basic Bioinformatics: Homology, Sequence Alignment,
Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi
Training materials.
Training materials Ensembl training materials are protected by a CC BY license http://creativecommons.org/licenses/by/4.0/ If you wish to re-use these materials, please credit Ensembl for their creation
Elixir: European Bioinformatics Research Infrastructure. Rolf Apweiler
Elixir: European Bioinformatics Research Infrastructure Rolf Apweiler EMBL-EBI Service Mission To enable life science research and its translation to medicine, agriculture, the bioindustries and society
to proteomics data in the PRIDE database
Interactive and computational access to proteomics data in the PRIDE database Daniel RIOS PRIDE software developer PRIDE team, Proteomics Services Group PANDA group European Bioinformatics Institute Hinxton,
The Gene Ontology Annotation (GOA) project application of GO in SWISS-PROT, TrEMBL and InterPro
Comparative and Functional Genomics Comp Funct Genom 2003; 4: 71 74. Published online in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/cfg.235 Conference Review The Gene Ontology Annotation
Connecting with eresearch Services
Connecting with eresearch Services 1st April 2016 eresearch Services, INS Who are we? eresearch Services (ers) Director eresearch Services (Malcolm Wolski) QRISCloud National Relations Manager (Andrew
LARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES
1 LARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES Ezekiel Adebiyi, PhD Professor and Head, Covenant University Bioinformatics Research and CU NIH H3AbioNet node Covenant University,
Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras. Lecture - 5a Protein sequence databases
Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras Lecture - 5a Protein sequence databases In this lecture, we will mainly discuss on Protein Sequence
1000 Insect Transcriptomes Evolution - 1KITE
1KITE 1K Insect Transcriptome Evolution 1000 Insect Transcriptomes Evolution - 1KITE An Example of Handling "Big Data" Karen Meusemann, on behalf of the 1KITE Consortium CSIRO Ecosystem Sciences, Australian
ORGANISATION AND STANDARDISATION OF INFORMATION IN SWISS-PROT AND TREMBL
13 ORGANISATION AND STANDARDISATION OF INFORMATION IN SWISS-PROT AND TREMBL Michele Magrane* and Rolf Apweiler. EMBL Outstation European Bioinformatics Institute (EBI), Wellcome Trust Genome Campus, Hinxton,
B I O I N F O R M A T I C S
B I O I N F O R M A T I C S Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be SUPPLEMENTARY CHAPTER: DATA BASES AND MINING 1 What
Training materials.
Training materials - Ensembl training materials are protected by a CC BY license - http://creativecommons.org/licenses/by/4.0/ - If you wish to re-use these materials, please credit Ensembl for their creation
I have my list of differentially expressed genes, now what?
I have my list of differentially expressed genes, now what? Mirana Ramialison! Developmental Systems Biology Laboratory! Australian Regenerative Medicine Institute! #UQwinterSchool Outline 1. Background
Browsing Genes and Genomes with Ensembl
Browsing Genes and Genomes with Ensembl Emily Perry Ensembl Outreach Project Leader EMBL-EBI Objectives What is Ensembl? What type of data can you get in Ensembl? How to navigate the Ensembl browser website.
Introduction to BIOINFORMATICS
COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/
Gene-centered databases and Genome Browsers
COURSE OF BIOINFORMATICS a.a. 2015-2016 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about
Gene-centered databases and Genome Browsers
COURSE OF BIOINFORMATICS a.a. 2016-2017 Gene-centered databases and Genome Browsers We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about
Minimum Information About a Microarray Experiment (MIAME) Successes, Failures, Challenges
Opinion TheScientificWorldJOURNAL (2009) 9, 420 423 TSW Development & Embryology ISSN 1537-744X; DOI 10.1100/tsw.2009.57 Minimum Information About a Microarray Experiment (MIAME) Successes, Failures, Challenges
Fundamentals of Clinical Genomics
Fundamentals of Clinical Genomics Wellcome Genome Campus Hinxton, Cambridge, UK 17-19 January 2018 Lectures and Workshops to be held in the Rosalind Franklin Pavilion Lunch and Dinner to be held in the
Big picture and history
Big picture and history (and Computational Biology) CS-5700 / BIO-5323 Outline 1 2 3 4 Outline 1 2 3 4 First to be databased were proteins The development of protein- s (Sanger and Tuppy 1951) led to the
Molecular Biology of the Cell ed. By Bruce Albert et al. (free online through ncbi books)
Lecture 20 continued: Drosophila embryogenesis Embrygenesis Four classes of genes: Maternal genes Gap genes Pair-rule genes Segment polarity genes Homeotic genes Read 826-837Fig. D18- D27; 19.2; 19.16
Bioinformatics for Cell Biologists
Bioinformatics for Cell Biologists 15 19 March 2010 Developmental Biology and Regnerative Medicine (DBRM) Schedule Monday, March 15 09.00 11.00 Introduction to course and Bioinformatics (L1) D224 Helena
Planning a national bioinformatics infrastructure investment
Planning a national bioinformatics infrastructure investment 1 Infrastructure? 2 Research infrastructure? 3 Research infrastructure? 4 What is Bioinformatics Infrastructure? What is Bioinformatics Infrastructure?
Data Retrieval from GenBank
Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
Computational Molecular Biology Intro. Alexander (Sacha) Gultyaev
Computational Molecular Biology Intro Alexander (Sacha) Gultyaev a.p.goultiaev@liacs.leidenuniv.nl Biopolymer sequences DNA: double-helical nucleic acid. Monomers: nucleotides C, A, T, G. RNA: (single-stranded)
FROM THE CHAIRMAN MR JOHN GRANT AM
FROM THE CHAIRMAN MR JOHN GRANT AM by advanced bioinformatics. This soft infrastructure will then be centralised and made available to all our statistics show a 21 per cent increase in fee related services
2cqc. Lichtarge lab Evolutionary trace report by report maker August 6, INTRODUCTION CONTENTS. 2 CHAIN 2CQCA 2.
Pages 1 5 2cqc Evolutionary trace report by report maker August 6, 2010 4.3.3 DSSP 4 4.3.4 HSSP 4 4.3.5 LaTex 4 4.3.6 Muscle 4 4.3.7 Pymol 5 4.4 Note about ET Viewer 5 4.5 Citing this work 5 4.6 About
I nternet Resources for Bioinformatics Data and Tools
~i;;;;;;;'s :.. ~,;;%.: ;!,;s163 ~. s :s163:: ~s ;'.:'. 3;3 ~,: S;I:;~.3;3'/////, IS~I'//. i: ~s '/, Z I;~;I; :;;; :;I~Z;I~,;'//.;;;;;I'/,;:, :;:;/,;'L;;;~;'~;~,::,:, Z'LZ:..;;',;';4...;,;',~/,~:...;/,;:'.::.
Worksheet for Bioinformatics
Worksheet for Bioinformatics ACTIVITY: Learn to use biological databases and sequence analysis tools Exercise 1 Biological Databases Objective: To use public biological databases to search for latest research
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map
Genome Resources. Genome Resources. Maj Gen (R) Suhaib Ahmed, HI (M)
Maj Gen (R) Suhaib Ahmed, I (M) The human genome comprises DNA sequences mostly contained in the nucleus. A small portion is also present in the mitochondria. The nuclear DNA is present in chromosomes.
Translating Biological Data Sets Into Linked Data
Translating Biological Data Sets Into Linked Data Mark Tomko Simmons College, Boston MA The Broad Institute of MIT and Harvard, Cambridge MA September 28, 2011 Overview Why study biological data? UniProt
Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup
Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup 1. Introduction The data produced by IHEC is illustrated in Figure 1. Figure 1. The space of epigenomic
MS bioinformatics analysis for proteomics. Protein anotations
MS bioinformatics analysis for proteomics Protein anotations UCO - Córdoba Organized by: ProteoRed, EUPA and Seprot Alberto Medina January, 23rd 2009 Summary Introduction Some issues Software: Fatigo -
Experiences in implementing large-scale biomedical workflows on the cloud: Challenges in transitioning to the clinical domain
Experiences in implementing large-scale biomedical workflows on the cloud: Challenges in transitioning to the clinical domain Sehrish KANWAL a,1, Andrew LONIE a, Richard O. SINNOTT a Charlotte ANDERSON
Evolutionary Genetics. LV Lecture with exercises 6KP. Databases
Evolutionary Genetics LV 25600-01 Lecture with exercises 6KP Databases HS2018 Bioinformatics - R R Assignment The Minimalistic Approach!2 Bioinformatics - R Possible Exam Questions for R: Q1: The function
Introduction on Several Popular Nucleic Acids Databases
Introduction on Several Popular Nucleic Acids Databases Changmin Liao Library, China West Normal University, Nanchong City, P. R. liaochangminlxh@yahoo.com.cn Abstract-Nucleic acids are major biological
The EMBL-Bioinformatics and Data-Intensive Informatics
The EMBL-Bioinformatics and Data-Intensive Informatics Graham Cameron EMBL-EBI What is the EMBL-EBI? Non-profit organization Part of the European Molecular Biology Laboratory Based on the Wellcome Trust
EMBL-EBI and pan-national scale bioinformatics: Relevance to Australia
EMBL-EBI and pan-national scale bioinformatics: Relevance to Australia Paul Flicek Vertebrate Genomics, European Molecular Biology Laboratory Wellcome Trust Sanger Institute European Molecular Biology
Engineering Genetic Circuits
Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art
Protein Bioinformatics Part I: Access to information
Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures
DEVELOPING WEB TOOLS FOR DATA MINING AND ANALYSIS OF SAGE
DEVELOPING WEB TOOLS FOR DATA MINING AND ANALYSIS OF SAGE Kristin Wheeler BBSI, University of Pittsburgh Grambling State University Panayiotis Benos,Ph.d Center for Computational Biology & Bioinformatics
Genetics and Bioinformatics
Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s
This software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part
This software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part of the author's official duties as a United States Government
New services of the EMBL Data Library
7990 Oxford University Press Nucleic Acids Research, Vol. 18, No. 15 4319 New services of the EMBL Data Library Rainer Fuchs, Peter Stoehr, Peter Rice 1, Roy Omond 1 and Graham Cameron The EMBL Data Library
What is Bioinformatics?
What is Bioinformatics? Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. - NCBI The ultimate goal of the field is
Biotechnology Explorer
Biotechnology Explorer C. elegans Behavior Kit Bioinformatics Supplement explorer.bio-rad.com Catalog #166-5120EDU This kit contains temperature-sensitive reagents. Open immediately and see individual
So we have a Digital repository in CSIRO now what? John Morrissey and Liam O Brien
So we have a Digital repository in CSIRO now what? John Morrissey and Liam O Brien Today s Agenda The DAP today Challenging times for building new eresearch capability Top down planning activities working
Genome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
Resource sharing in European Commission funded research
Resource sharing in European Commission funded research European Commission DG Research Directorate for Health Research 1 Rome 22 May 2009 Patrik Kolar Head of Unit Genomics and Systems Biology Implementation
This practical aims to walk you through the process of text searching DNA and protein databases for sequence entries.
PRACTICAL 1: BLAST and Sequence Alignment The EBI and NCBI websites, two of the most widely used life science web portals are introduced along with some of the principal databases: the NCBI Protein database,
O C. 5 th C. 3 rd C. the national health museum
Elements of Molecular Biology Cells Cells is a basic unit of all living organisms. It stores all information to replicate itself Nucleus, chromosomes, genes, All living things are made of cells Prokaryote,
BLASTing through the kingdom of life
Information for students Instructions: In short, you will copy one of the sequences from the data set, use blastn to identify it, and use the information from your search to answer the questions below.
Genome Informatics. Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, Kiyoko F. Aoki-Kinoshita
Genome Informatics Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, 2008 Kiyoko F. Aoki-Kinoshita Introduction Genome informatics covers the computer- based modeling and data processing
Ensembl and ENA. High level overview and use cases. Denise Carvalho-Silva. Ensembl Outreach Team
Ensembl and ENA High level overview and use cases Denise Carvalho-Silva Ensembl Outreach Team On behalf of Ensembl and ENA teams European Molecular Biology Laboratories Euroepan Bioinformatics Institute
Access to Information from Molecular Biology and Genome Research
Future Needs for Research Infrastructures in Biomedical Sciences Access to Information from Molecular Biology and Genome Research DG Research: Brussels March 2005 User Community for this information is
Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility
2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,
Building a Generic Virtual Research Environment Framework for Multiple Earth and Space Science Domains and a Diversity of Users
Building a Generic Virtual Research Environment Framework for Multiple Earth and Space Science Domains and a Diversity of Users Lesley Wyborn 1, Ryan Fraser 2, Ben Evans 1, Carsten Friedrich 2, Jens Klump
Databases in Bioinformatics. Molecular Databases. Molecular Databases. NCBI Databases. BINF 630: Bioinformatics Methods
Databases in Bioinformatics BINF 630: Bioinformatics Methods Iosif Vaisman Email: ivaisman@gmu.edu Molecular Databases Molecular Databases Nucleic acid sequences: GenBank, DNA Data Bank of Japan, EMBL
Introduction to iplant Collaborative Jinyu Yang Bioinformatics and Mathematical Biosciences Lab
Introduction to iplant Collaborative Jinyu Yang Bioinformatics and Mathematical Biosciences Lab May/27 th /2016 About iplant What is iplant Collaborative? 1. A virtual organization 2. Created by a cooperative
ACCELERATING GENOMIC ANALYSIS ON THE CLOUD. Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia to analyze thousands of genomes
ACCELERATING GENOMIC ANALYSIS ON THE CLOUD Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia to analyze thousands of genomes Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia
Introduction to 'Omics and Bioinformatics
Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current
Deakin Research Online
Deakin Research Online This is the published version: Church, Philip, Goscinski, Andrzej, Wong, Adam and Lefevre, Christophe 2011, Simplifying gene expression microarray comparative analysis., in BIOCOM
BLASTing through the kingdom of life
Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the main database of nucleotide sequences at the National Center for Biotechnology
Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology
Bioinformatics Model Answers Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Page 1 of 15 Previous years questions asked. 1. Describe the software used in bioinformatics 2. Name four
Databases in genomics
Databases in genomics Search in biological databases: The most common task of molecular biologist researcher, to answer to the following ques7ons:! Are they new sequences deposited in biological databases
Introduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
COMPUTER RESOURCES II:
COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer
Computers in Biology and Bioinformatics
Computers in Biology and Bioinformatics 1 Biology biology is roughly defined as "the study of life" it is concerned with the characteristics and behaviors of organisms, how species and individuals come
FUNCTIONAL BIOINFORMATICS
Molecular Biology-2018 1 FUNCTIONAL BIOINFORMATICS PREDICTING THE FUNCTION OF AN UNKNOWN PROTEIN Suppose you have found the amino acid sequence of an unknown protein and wish to find its potential function.
Download the Lectin sequence output from
Computer Analysis of DNA and Protein Sequences Over the Internet Part I. IN CLASS Download the Lectin sequence output from http://stan.cropsci.uiuc.edu/courses/cpsc265/ Open these in BioEdit (free software).
Biomedical Informatics in BIG DATA Era
Biomedical Informatics in BIG DATA Era Yang C. Fann, Ph.D. Director, Intramural IT and Bioinformatics Program National Institute of Neurological Disorders and Stroke Disclaimer The opinions or assertions
State strategies for bioinformatics in BRICs and the UK. Professor Brian Salter
State strategies for bioinformatics in BRICs and the UK Professor Brian Salter This new facility is the embodiment of our investment in big data and bioinformatics. We are not only ensuring that people
DNAFSMiner: A Web-Based Software Toolbox to Recognize Two Types of Functional Sites in DNA Sequences
DNAFSMiner: A Web-Based Software Toolbox to Recognize Two Types of Functional Sites in DNA Sequences Huiqing Liu Hao Han Jinyan Li Limsoon Wong Institute for Infocomm Research, 21 Heng Mui Keng Terrace,