Quality of Cancer RNA Samples Is Essential for Molecular Classification Based on Microarray Results Application
|
|
- Verity Wade
- 6 years ago
- Views:
Transcription
1 Quality of Cancer RNA Samples Is Essential for Molecular Classification Based on Microarray Results Application Pathology Author Jenny Xiao Agilent Technologies, Inc. Deer Creek Road MC U-7 Palo Alto, CA 9 USA Abstract There are four subgroups (normal-like, luminal, basallike, or Erb-B+/HER-) of breast cancer, as identified by gene expression profiling, which have a different prognosis and response to chemotherapy [, ]. Therefore, correct molecular identification of the subgroups is essential for breast cancer therapy. Recently, microarray-based gene expression analysis has been used for the molecular classification of breast cancer samples [] gaining widespread acceptance in its determination of subclassification of these tumors. However, isolating enough intact mrna, or even total RNA, from patients can be problematic. Degraded RNA can compromise the results and lead to misclassification. In this study, RNA samples from over breast cancer patients were compared, in a two-color microarray experiment, to a common reference sample on -mer oligo microarrays. The microarray results were then clustered into different subtypes. The quality of total RNA samples was tested using an Agilent Bioanalyzer prior to labeling and hybridization. Biochemical and molecular markers confirmed that more than 9% of the cancer samples were clustered correctly and had a clear breast cancer molecular subtype. However, some RNA samples used showed partial degradation on the Bioanalyzer trace. Their microarray results and analysis visually looked acceptable, however, instead of clustering with others of its subtype, they were clustered together, and we were able to remove or at least qualify the compromised profiles. These studies provide further proof that gene expression profiling for breast cancer classification is a valuable tool to the molecular pathologist but also suggest that researchers need to consider the potential risks of obtaining misleading classification results when RNA samples of lower quality are used. Strategies of how to avoid these pitfalls are discussed. Introduction Most researchers are aware that RNA samples of high quality are essential for good microarray experiments. For this reason, the Agilent Bioanalyzer is often used to test RNA quality prior to labeling and hybridization. The Bioanalyzer histogram of total RNA samples shows a low baseline and two clear ribosome RNA peaks (8s and 8s) indicating there is no degradation. However, it is hard to extract intact RNA from certain tissues and cell lines, for instance, pancreatic tissue is rich with RNAse which leaves the RNA susceptible to degradation. Improper handling, such as introducing RNAse contamination or storing biological samples at elevated temperature or lack of equipment in the operating rooms where biopsies are collected also put clinical samples at higher risk for degradation. Researchers must sometimes use RNA samples of lower quality in hopes of obtaining some valuable results. These results may give correct answers for the expression patterns of certain genes. However, when the microarray data are used for molecular identification purposes, it may lead to incorrect conclusions.
2 In this study, four partially degraded RNA samples were compared in a two-color microarray experiment to a common reference sample on Agilent oligonucleotide microarrays along with more than good breast cancer RNA samples. Cluster analysis has shown that instead of clustering with others of its subtype, they were all clustered together as a separate subgroup. Materials and Methods RNA Isolation Total RNA was isolated from mg of Snapfrozen Human breast tumor tissues by Qiagen RNeasy Midi Kit (Catalog Number 7). The quality of the isolated total RNA was checked using the RNA Nano LabChip kit on an Agilent Bioanalyzer (part number -7 and G9BA). Cluster Analysis The Genepix. software package was used for gridding and feature extraction. Lowess normalization algorithm was performed using University of North Carolina microarray databases. Experimental results were clustered using Eisen's gene clustering program. and TreeView.. Results and Discussion Bioanalyzer Results Seven RNA tumor samples were collected and tested on an Agilent Bioanalyzer. The Bioanalyzer histograms indicated that RNA from tumor samples,, and 7 were good quality, where RNA from tumors,,, and were degraded at different levels (Figures a g). RNA Labeling Purified total RNA samples were amplified and labeled by Agilent Low RNA Input Linear Amplification Kit (product number 8-), following the procedures described in the User's Manual. Cyanine - or Cyanine -CTP were purchased from Perkin-Elmer/NEN (NEL 8 and 8). Microarray and Hybridization Process Cyanine - and Cyanine -labeled crna were hybridized on an Agilent Human Oligo Microarray (Product number GB) following the Agilent oligonucleotide microarray hybridization user's manual using the Agilent in situ Hybridization Plus kit (product number 8-8). The hybridized microarray slides were disassembled in SSC,.% Triton X-, washed first with SSC,.% Triton X- for minutes at room temperature, then with. SSC,.% Triton X- for minutes on ice, then dried using a nitrogen-filled air gun. Processed microarray slides were then scanned by an Axon scanner.
3 Figure a. Tumor- (Intact RNA) Figure e. Tumor- (Degraded RNA) 7 7 Figure b. Tumor- (Intact RNA) Figure f. Tumor- (Partially degraded RNA) Figure c. Tumor- (Degraded RNA) Figure g. Tumor-7 (Intact RNA) Figure d. Tumor- (Partially degraded RNA)
4 Microarray Images The seven tumor RNA samples were labeled with Cyanine -CTP in parallel regardless of their quality. A common reference sample was labeled with Cyanine - CTP. The labeled Cyanine -tumor samples were then compared with the Cyanine - reference RNA on -mer oligonucleotide microarrays. Labeled RNA sample from tumor 7 was hybridized on two replicated microarrays to test the accuracy of the cluster algorithm. All eight microarray images were very similar upon visual comparison. Two microarray images are presented as examples (Figures a and b), showing results of the intact RNA vs. the degraded RNA. Figure a. Sample (intact RNA sample) vs. Reference Figure b. Sample (degraded RNA sample) vs. Reference
5 Cluster Results After feature extraction,.txt files from the eight microarrays (seven sample pairs) were clustered together along with microarray results from other breast cancer samples. Tumor samples 7 represent different subtypes and should be respectively clustered into different regions with their proper subtypes (Figure ). Among them, Tumors 7 and 7-repeated were clustered together indicating the profiles were very similar to each other. Tumors,, 7, and 7-repeated were clustered into correct regions and had clear breast cancer molecular subtype: Tumors and are blue, representing Luminal subtype; Tumor 7 and 7-repeated are in red representing Basal-like subtype. Tumors were clustered together in black as "weak signals" instead of going to their proper subtype regions. Basal cluster Proliferation cluster Her+ cluster Luminal cluster Figure. Tumor samples 7 clustered. Note that the displays on the right are exploded sectional views of the total display shown on the left.
6 Conclusion Microarray data plays an important role in the study of breast cancer classification. The results in this study, including Bioanalyzer data, microarray images, feature extracted results, clustering results, and biological expectations, suggest that researchers need to consider the potential risks of obtaining misleading classification results. For some reasons, researchers decide that even when the RNA quality is tested to be low, they still want to proceed to microarray experiments. In this case, the classification results require confirmation by other supporting biological and clinical data. If the above information is unavailable, the microarray data should be removed from the final cluster to avoid misleading conclusions. For More Information For more information on our products and services, visit our Web site at References. T. Sorlie, C.M. Perou, R. Tibshirani, T. Aas, S. Geisler, H. Johnsen, et. al. Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proc Natl Acad Sci USA. Sep ; 98(9): T. Sorlie, R. Tibshirani, J. Parker, T. Hastie, J.S. Marron, A. Nobel, et. al. Repeated observation of breast tumor subtypes in independent gene expression data sets. Proc Natl Acad Sci USA. Jul 8; (): 88.. L. J. Van't Veer, H. Dai, et al. () Gene Expression Profiling Predicts Clinical Outcome of Breast Cancer, Nature,. Agilent Technologies Bioresearch Solutions Unit Deer Creek Rd Palo Alto, CA 9 dna_microarray@agilent.com Agilent Gene Expression Microarrays Web site Agilent Lab-on-a-Chip Web site Acknowledgements We would like to thank Dr. Charles Perou and Dr. Zhiyuan Hu at the Departments of Genetics and Pathology Lineberger Comprehensive Cancer Center, the University of North Carolina at Chapel Hill for providing all the technical data. Agilent shall not be liable for errors contained herein or for incidental or consequential damages in connection with the furnishing, performance, or use of this material. Information, descriptions, and specifications in this publication are subject to change without notice. Please register online with Agilent to receive product updates at: Agilent Technologies, Inc. Printed in the USA May, 989-8EN
Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application
Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,
More informationNew Stringent Two-Color Gene Expression Workflow Enables More Accurate and Reproducible Microarray Data
Application Note GENOMICS INFORMATICS PROTEOMICS METABOLOMICS A T C T GATCCTTC T G AAC GGAAC T AATTTC AA G AATCTGATCCTTG AACTACCTTCCAAGGTG New Stringent Two-Color Gene Expression Workflow Enables More
More informationThe Agilent Total RNA Isolation Kit
Better RNA purity. Better data. Without DNase treatment. The Agilent Total RNA Isolation Kit Now you can isolate highly purified, intact RNA without DNase treatment Introducing the Agilent Total RNA Isolation
More informationOptimizing crna fragmentation for microarray experiments using the Agilent 2100 bioanalyzer. Application Deborah Vitale.
Optimizing crna fragmentation for microarray experiments using the Agilent 2100 bioanalyzer Application Deborah Vitale Introduction Oligonucleotide arrays are a powerful tool for gene expression studies.
More informationHigh Performance Labeling Kits for cdna and Oligo Microarrays
Agilent in Life Sciences > Genomics > Proteomics > Drug Discovery > Development > QA/QC High Performance Labeling Kits for cdna and Oligo Microarrays Get more from one experiment Agilent has perfected
More informationGene Expression Profiling of Prokaryotic Samples using Low Input Quick Amp WT Kit
Gene Expression Profiling of Prokaryotic Samples using Low Input Quick Amp WT Kit Application Note Authors Nilanjan Guha and Becky Mullinax Abstract Agilent s Low Input Quick Amp Labeling WT (LIQA WT)
More informationCancer Detection and Prevention 27 (2003)
Cancer Detection and Prevention 27 (2003) 405 411 Direct comparison of microarray gene expression profiles between non-amplification and a modified cdna amplification procedure applicable for needle biopsy
More informationHigh sensitivity quality control of RNA samples using the RNA 6000 Pico LabChip kit. Application. Rüdiger Salowsky Anna Henger.
High sensitivity quality control of RNA samples using the RNA 6000 Pico LabChip kit Application Rüdiger Salowsky Anna Henger Abstract This Application Note describes the use of the RNA 6000 Pico LabChip
More informationHigh sensitivity quality control of RNA samples using the RNA 6000 Pico LabChip kit. Application. Rüdiger Salowsky Anna Henger.
High sensitivity quality control of RNA samples using the RNA 6000 Pico LabChip kit Application Rüdiger Salowsky Anna Henger Abstract This Application Note describes the use of the RNA 6000 Pico LabChip
More informationDNA Microarray Technology
CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic
More informationUsing Lower Amounts of RNA for GE Microarray Experiments
Welcome to our E-Seminar: Using Lower Amounts of RNA for GE Microarray Experiments Chairperson: Rita Willis Slide 1 Labeling RNA for Microarray Experiments Outline Introduction Labeling, Amplification
More informationIntroduction to Microarray Analysis
Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray
More informationThe Agilent 2100 Bioanalyzer. RNA Integrity Number (RIN) A standardized approach for RNA integrity assessment. qpcr Symposium
The Agilent 2100 Bioanalyzer RNA Integrity Number (RIN) A standardized approach for RNA integrity assessment qpcr Symposium Leipzig, 2005 Marc Valer RNA LabChip kits Analysis of Total RNA Integrity 11
More informationEfficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application
Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application Gene Expression Authors Ilgar Abbaszade, Claudia Robbins, John
More informationAim of lecture:to get an overview of the whole process of microarrays, from study design to publication
Microarray pipeline Aim of lecture:to get an overview of the whole process of microarrays, from study design to publication Rita Holdhus Intoduction to Microarray technology September 2010 Many of the
More informationSingle Cell Copy Number Screening Using the GenetiSure Pre-Screen Kit
Single Cell Copy Number Screening Using the GenetiSure Pre-Screen Kit Uncover Aneuploidies in Embryos Application Note Authors Paula Costa Natalia Novoradovskaya Scott Basehore Stephanie Fulmer-Smentek
More informationPractical DNA Microarray Analysis: An Introduction
Technology Practical DNA Microarray Analysis: An Introduction Marc Zapatka Computational Oncology Group Dept. Theoretical Bioinformatics German Cancer Research Center 2005-11-28 Will be introduced as needed
More informationDNA Microarray Technology
2 DNA Microarray Technology 2.1 Overview DNA microarrays are assays for quantifying the types and amounts of mrna transcripts present in a collection of cells. The number of mrna molecules derived from
More informationAgilent RNA Spike-In Kit
Agilent RNA Spike-In Kit Agilent RNA Spike-In Kit Product Number 5188-5279 Introduction The Agilent RNA Spike-In Kit was developed to provide positive controls for monitoring the microarray workflow from
More informationMicroarray Experiment Design
Microarray Experiment Design Samples used, extract preparation and labelling: AML blasts were isolated from bone marrow by centrifugation on a Ficoll- Hypaque gradient. Total RNA was extracted using TRIzol
More informationHigh-Purity Bacterial RNA Isolated with the Agilent Total RNA Isolation Mini Kit Application
High-Purity Bacterial RNA Isolated with the Total RNA Isolation Mini Kit Application Gene Expression Author Christopher Rizzo Claudia A. Robbins Rhonda R. Taylor Technologies, Inc. 285 Centerville Road
More informationTech Note. Using the ncounter Analysis System with FFPE Samples for Gene Expression Analysis. ncounter Gene Expression. Molecules That Count
ncounter Gene Expression Tech Note Using the ncounter Analysis System with FFPE Samples for Gene Expression Analysis Introduction For the past several decades, pathologists have kept samples obtained from
More informationMATERIALS AND METHODS. Sample Collection
Universal mouse reference RNA derived from neonatal mice Xiao-Rui He, Chunlian Zhang, and Cam Patterson University of North Carolina, Chapel Hill, NC, USA BioTechniques 37:464-468 (September 2004) A reproducible,
More informationMeasuring gene expression (Microarrays) Ulf Leser
Measuring gene expression (Microarrays) Ulf Leser This Lecture Gene expression Microarrays Idea Technologies Problems Quality control Normalization Analysis next week! 2 http://learn.genetics.utah.edu/content/molecules/transcribe/
More informationMicroarrays & Gene Expression Analysis
Microarrays & Gene Expression Analysis Contents DNA microarray technique Why measure gene expression Clustering algorithms Relation to Cancer SAGE SBH Sequencing By Hybridization DNA Microarrays 1. Developed
More informationDeveloping an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL
Developing an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL James Storhoff, Ph.D. Senior Manager, Diagnostic Test Development World Cdx, Boston, Sep. 10th Molecules That
More informationBIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis
BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology Lecture 2: Microarray analysis Genome wide measurement of gene transcription using DNA microarray Bruce Alberts, et al., Molecular Biology
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationNormalization. Getting the numbers comparable. DNA Microarray Bioinformatics - #27612
Normalization Getting the numbers comparable The DNA Array Analysis Pipeline Question Experimental Design Array design Probe design Sample Preparation Hybridization Buy Chip/Array Image analysis Expression
More informationIsolation of High-Purity Total Cellular RNA from Muscle Tissues Using the Agilent Total RNA Isolation Mini Kit Application
Isolation of High-Purity Total Cellular RNA from Muscle Tissues Using the Total RNA Isolation Mini Kit Application Genomics Author Christopher Rizzo Technologies, Inc. 2850 Centerville Road Wilmington,
More informationROAD TO STATISTICAL BIOINFORMATICS CHALLENGE 1: MULTIPLE-COMPARISONS ISSUE
CHAPTER1 ROAD TO STATISTICAL BIOINFORMATICS Jae K. Lee Department of Public Health Science, University of Virginia, Charlottesville, Virginia, USA There has been a great explosion of biological data and
More informationMicroarray pipeline & Pre-processing
Microarray pipeline & Pre-processing Solveig Mjelstad Olafsrud J Express Analysis Course November 2010 Some slides adapted from Christine Stansberg thank you Christine! The microarray pipeline The goal
More informationMMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit
MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationGene expression profiling experiments:
Gene expression profiling experiments: Problems, pitfalls, and solutions. Heli Borg The Alternatives in Microarray Experiments bacteria - eucaryots non poly(a) + - poly(a) + oligonucleotide Affymetrix
More informationCopy Number Analysis of Archival FFPE Tumor Samples by Oligo Array CGH
GENOMICS INFORMATICS PROTEOMICS METABOLOMICS A T C T G A T C C T T C T G AAC GGAAC T AAT T T C AA G AAT C T G AT C C T T G A A C T A C C T T C C AAG G T G Copy Number Analysis of Archival FFPE Tumor Samples
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationPerformance verification of the automated NuGEN WT-Ovation FFPE RNA Amplification System
TECHNICAL REPORT Performance verification of the automated NuGEN WT-Ovation FFPE RNA Amplification System FFPE specimens are routinely collected in clinical environments and are a rich source of well documented
More informationAnalysis of DNA sequence copy number in archival formalin-fixed, paraffinembedded. Dione K. Bailey Anniek De Witte October 9, 2007
Analysis of DNA sequence copy number in archival formalin-fixed, paraffinembedded (FFPE) tumor samples by oligo array CGH Dione K. Bailey Anniek De Witte October 9, 2007 Agenda Oligo acgh Review Problems
More informationRNA extraction from tissue - using Bioruptor (Standard/Plus) and RNA extraction kit
RNA extraction from tissue - using Bioruptor (Standard/Plus) and RNA extraction kit Introduction Isolation of intact RNA is essential for many techniques used in gene expression analysis. Efficient disruption
More informationEstablishment and verification of mirnas expression molecules for breast cancer and its distant metastasis Yanhong Gao Associate Professor
Establishment and verification of mirnas expression molecules for breast cancer and its distant metastasis Yanhong Gao Associate Professor Department of Clinical Biochemistry Chinese PLA General Hospital
More informationPuritan Report for Batch PC Lot# 3127, Blue Pink and Yellow. Swabs were received for testing on May 22, 2012
Puritan Report for Batch 25-806 2PC Lot# 3127, Blue Pink and Yellow Prepared by the University of Maine DNA Sequencing Facility/ Patty Singer, June 8, 2012 Swabs were received for testing on May 22, 2012
More informationProduct Specifications & Manual
Product Specifications & Manual Custom Oligo Synthesis, antisense oligos, RNA oligos, chimeric oligos, Fluorescent dye labeled oligos, Molecular Beacons, sirna, phosphonates Affinity Ligands, 2-5 linked
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationProteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer.
Proteomics And Cancer Biomarker Discovery Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar Overview Proteomics Cancer Aims Tools Data Base search Challenges Summary 1 Overview
More informationBackground Analysis and Cross Hybridization. Application
Background Analysis and Cross Hybridization Application Pius Brzoska, Ph.D. Abstract Microarray technology provides a powerful tool with which to study the coordinate expression of thousands of genes in
More informationTECH NOTE Stranded NGS libraries from FFPE samples
TECH NOTE Stranded NGS libraries from FFPE samples Robust performance with extremely degraded FFPE RNA (DV 200 >25%) Consistent library quality across a range of input amounts (5 ng 50 ng) Compatibility
More informationDNA Microarrays and Clustering of Gene Expression Data
DNA Microarrays and Clustering of Gene Expression Data Martha L. Bulyk mlbulyk@receptor.med.harvard.edu Biophysics 205 Spring term 2008 Traditional Method: Northern Blot RNA population on filter (gel);
More informationMammaPrint and BluePrint Breast Cancer Recurrence and Molecular Subtyping Kit Package Insert
Agendia NV. MammaPrint and BluePrint Breast Cancer Recurrence and Molecular Subtyping Kit Package Insert Targeted sequencing of RNA from formalin-fixed, paraffin-embedded tissue sections to assess breast
More informationOutline. Analysis of Microarray Data. Most important design question. General experimental issues
Outline Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization Introduction to microarrays Experimental design Data normalization Other data transformation Exercises George Bell,
More informationPlease purchase PDFcamp Printer on to remove this watermark. DNA microarray
DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of
More informationProduct Specifications & Manual
Product Specifications & Manual Custom Oligo Synthesis, antisense oligos, RNA oligos, chimeric oligos, Fluorescent dye labeled oligos, Molecular Beacons, sirna, phosphonates Affinity Ligands, 2-5 linked
More informationRapid Method for the Purification of Total RNA from Formalin- Fixed Paraffin-Embedded (FFPE) Tissue Samples
Application Note 17 RNA Sample Preparation Rapid Method for the Purification of Total RNA from Formalin- Fixed Paraffin-Embedded (FFPE) Tissue Samples M. Melmogy 1, V. Misic 1, B. Lam, PhD 1, C. Dobbin,
More informationDNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT.
DNA/RNA MICROARRAYS This protocol is based on the EDVOTEK protocol DNA/RNA Microarrays. 10 groups of students NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. 1. EXPERIMENT OBJECTIVE The objective of this
More informationIsolation of total nucleic acids from FFPE tissues using FormaPure DNA
APPLICATION NOTE Isolation of total nucleic acids from FFPE tissues using FormaPure DNA Jung Hoon Doh, Ph.D. Senior Application Scientist Beckman Coulter Life Sciences, Indianapolis, IN USA Summary Extensive
More informationIsoFluxTM. System. The next generation of CTC Analysis is here
IsoFluxTM System The next generation of CTC Analysis is here Product Overview IsoFlux System The next generation of circulating tumor cell analysis is here The IsoFlux System enriches intact rare cells
More informationProduct Specifications & Manual
Product Specifications & Manual Oligo dt primers, random primers, sequencing primers Custom Oligo Synthesis, antisense oligos, RNA oligos, chimeric oligos, Affinity Ligands, 2-5 linked Oligos Oligo dt
More informationT7-Based RNA Amplification Protocol (in progress)
T7-Based RNA Amplification Protocol (in progress) Jacqueline Ann Lopez (modifications) Amy Cash & Justen Andrews INTRODUCTION T7 RNA Amplification, a technique originally developed in the laboratory of
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationThe essentials of microarray data analysis
The essentials of microarray data analysis (from a complete novice) Thanks to Rafael Irizarry for the slides! Outline Experimental design Take logs! Pre-processing: affy chips and 2-color arrays Clustering
More informationLABORATORY FUNDAMENTALS IN BIOLOGICAL ENGINEERING. Leona Samson. MODULE 2 EXPRESSION ENGINEERING Lecture # 3.
20.109 LABORATORY FUNDAMENTALS IN BIOLOGICAL ENGINEERING MODULE 2 EXPRESSION ENGINEERING Lecture # 3 Leona Samson March 31 st 2009 Snapshot of the next four weeks We will eliminate the expression of various
More informationRapid Method for the Purification of Total RNA from Formalin-Fixed Paraffin-Embedded (FFPE) Tissue Samples
Application Note 17 RNA Sample Preparation Rapid Method for the Purification of Total RNA from Formalin-Fixed Paraffin-Embedded (FFPE) Tissue Samples M. Melmogy 1, V. Misic 1, B. Lam, PhD 1, C. Dobbin,
More informationMicroarrays The technology
Microarrays The technology Goal Goal: To measure the amount of a specific (known) DNA molecule in parallel. In parallel : do this for thousands or millions of molecules simultaneously. Main components
More informationIntroduction to microarray technology and data analysis
Introduction to microarray technology and data analysis Aron C. Eklund eklund@cbs.dtu.dk Cancer Systems Biology group Center for Biological Sequence Analysis Technical University of Denmark Introduction
More informationTechnical Note. GeneChip 3 IVT PLUS Reagent Kit vs. GeneChip 3 IVT Express Reagent Kit Comparison. Introduction:
Technical Note GeneChip 3 IVT PLUS Reagent Kit vs. GeneChip 3 IVT Express Reagent Kit Comparison Introduction: Affymetrix has launched a new 3 IVT PLUS Reagent Kit which creates hybridization ready target
More informationAnalysis of genetically modified soya using the Agilent 2100 bioanalyzer. Application. Steve Garrett Özge Arun John Dooley.
Analysis of genetically modified soya using the Agilent 2100 bioanalyzer Application Steve Garrett Özge Arun John Dooley Abstract In this Application Note we describe how the Agilent 2100 bioanalyzer was
More informationNovel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc.
Novel methods for RNA and DNA- Seq analysis using SMART Technology Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc. Agenda Enabling Single Cell RNA-Seq using SMART Technology SMART
More informationComparison of 3 labeling and amplification protocols: for total RNA labeling, amplification, and Affymetrix GeneChip expression (last updated 9/26/05)
Comparison of 3 labeling and amplification protocols: for total RNA labeling, amplification, and Affymetrix GeneChip expression (last updated 9/26/05) Purpose: to compare 3 of the commercially available
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction
More informationMicroarrays: since we use probes we obviously must know the sequences we are looking at!
These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction
More informationDNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center
DNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center Why DNA Chips? Functional genomics: get information about genes that is unavailable from sequence
More informationINTRODUCTION. The Technology of Microarrays January Hanne Jarmer
INTRODUCTION The Technology of Microarrays January 2009 - Hanne Jarmer The Concept gene mrna gene specific DNA probes labeled target Spotted arrays High-density arrays 13-16 micron features ~60 micron
More informationZytoLight SPEC HER2/TOP2A/CEN 17
ZytoLight SPEC HER2/TOP2A/CEN 17 Triple Color Probe Z-2093-200 Z-2093-50 20 (0.2 ml) 5 (0.05 ml) For the detection of the human HER2 gene, the human TOP2A gene, and alpha-satellites of chromosome 17 by
More informationGene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays
Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Application Note Authors Bahram Arezi, Nilanjan Guha and Anne Bergstrom Lucas Agilent Technologies Inc. Santa
More informationAutomation of Lexogen s QuantSeq 3 mrna-seq Library Prep Kits on the Biomek FX p NGS Workstation
Automation of Lexogen s QuantSeq 3 mrna-seq Library Prep Kits on the Biomek FX p NGS Workstation The Lexogen QuantSeq 3 mrna-seq Library Prep Kits for Illumina (FWD and REV) produce ready-to-sequence libraries
More informationAgilent Genomic Workbench 7.0
Agilent Genomic Workbench 7.0 Product Overview Guide Agilent Technologies Notices Agilent Technologies, Inc. 2012, 2015 No part of this manual may be reproduced in any form or by any means (including electronic
More informationCOS 597c: Topics in Computational Molecular Biology. DNA arrays. Background
COS 597c: Topics in Computational Molecular Biology Lecture 19a: December 1, 1999 Lecturer: Robert Phillips Scribe: Robert Osada DNA arrays Before exploring the details of DNA chips, let s take a step
More informationGuidelines Analysis of RNA Quantity and Quality for Next-Generation Sequencing Projects
Title: Protocol number: Guidelines Analysis of RNA Quantity and Quality for Next-Generation Sequencing Projects GAF S002 Version: Version 4 Date: December 17 th 2015 Author: P. van der Vlies, C.C. van
More informationIntroduction to microarray technology and data analysis
Introduction to microarray technology and data analysis Aron C. Eklund eklund@cbs.dtu.dk Cancer Systems Biology group Center for Biological Sequence Analysis Technical University of Denmark Introduction
More informationOutline. Array platform considerations: Comparison between the technologies available in microarrays
Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of
More informationPOET REPORT Perspectives on Emerging Technology
POET REPORT Perspectives on Emerging Technology In Vitro Diagnostic Multivariate Assays (IVDMIAs) September, 2009 Developed by the CAP s Technology Assessment Committee College of American Pathologists
More informationAgilent s Microarray Platform: How High-Fidelity DNA Synthesis Maximizes the Dynamic Range of Gene Expression Measurements
Agilent s Microarray Platform: How High-Fidelity DNA Synthesis Maximizes the Dynamic Range of Gene Expression Measurements Author Emily LeProust, Ph.D. Agilent Technologies A key factor controlling the
More informationAdnaTest EMT-2/StemCell Add-on Ovarian-2 Detect
AdnaTest EMT-2/StemCell Add-on Ovarian-2 Detect PCR-expression analysis of ovarian cancer associated gene expression in enriched tumor cells For research use only Manual T-1-537-PO-2 Contents Order Information...
More informationAgilent SurePrint G3 Human Catalog CGH Microarrays
Agilent SurePrint G3 Human Catalog CGH Microarrays Product Note The new Agilent 1M CGH array combines the excellent probe design and performance characteristics of the Agilent acgh platforms with a million
More information3. Microarrays: experimental design, statistical analysis and gene clustering
WUEMED Drought Course 3. Microarrays: experimental design, statistical analysis and gene clustering John Bennett International Rice Research Institute Los Baños, Philippines 3.1: Experimental overview
More informationHigh-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours
High-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours Application Note Authors Paula Costa and Anniek De Witte Agilent Technologies, Inc. Santa Clara, CA USA Abstract As
More informationLECTURE 6 Jeremy Squire Future directions: the human genome project and automation in molecular diagnostics
LECTURE 6 Jeremy Squire Future directions: the human genome project and automation in molecular diagnostics In this lecture we will focus on the importance of cancer genomics or the application of the
More informationTHE INSTITUTE FOR GENOMIC RESEARCH Standard Operating Procedure SOP #: M022 REVISION LEVEL:.1 EFFECTIVE DATE: 04/12/04
PAGE: 1 of 13 SOP #: M022 REVISION LEVEL:.1 EFFECTIVE DATE: 04/12/04 AUTHOR: Nicholas Marko PRIMARY REVIEWERS: Renee Rubio, Bryan Frank 1. PURPOSE This protocol describes the procedure for amplifying RNA
More informationAdnaTest BreastCancerDetect
AdnaTest BreastCancerDetect RT-PCR Kit for detection of breast cancer associated gene expression in enriched tumor cells For research use only Manual T-1-509 Contents Order Information... 3 Purpose...
More informationResearch Powered by Agilent s GeneSpring
Research Powered by Agilent s GeneSpring Agilent Technologies, Inc. Carolina Livi, Bioinformatics Segment Manager Research Powered by GeneSpring Topics GeneSpring (GS) platform New features in GS 13 What
More informationQuality assurance of RNA derived from laser microdissected tissue samples obtained by the PALM MicroBeam System using the RNA 6000 Pico LabChip kit.
Quality assurance of RN derived from laser microdissected tissue samples obtained by the PLM MicroBeam System using the RN 6 Pico LabChip kit. pplication Marcus Gassmann bstract Gene expression profiling
More informationExpressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes
Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional
More informationDeoxyribonucleic Acid DNA
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationImage Analysis. Based on Information from Terry Speed s Group, UC Berkeley. Lecture 3 Pre-Processing of Affymetrix Arrays. Affymetrix Terminology
Image Analysis Lecture 3 Pre-Processing of Affymetrix Arrays Stat 697K, CS 691K, Microbio 690K 2 Affymetrix Terminology Probe: an oligonucleotide of 25 base-pairs ( 25-mer ). Based on Information from
More informationIntroduction to Bioinformatics. Fabian Hoti 6.10.
Introduction to Bioinformatics Fabian Hoti 6.10. Analysis of Microarray Data Introduction Different types of microarrays Experiment Design Data Normalization Feature selection/extraction Clustering Introduction
More informationCodeLink Human Whole Genome Bioarray
CodeLink Human Whole Genome Bioarray 55,000 human gene targets on a single bioarray The CodeLink Human Whole Genome Bioarray comprises one of the most comprehensive coverages of the human genome, as it
More informationSWISS MADE: Standardized WithIn Class Sum of Squares to evaluate methodologies and dataset elements.
See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/42834054 SWISS MADE: Standardized WithIn Class Sum of Squares to evaluate methodologies and
More information