Quality of Cancer RNA Samples Is Essential for Molecular Classification Based on Microarray Results Application

Size: px
Start display at page:

Download "Quality of Cancer RNA Samples Is Essential for Molecular Classification Based on Microarray Results Application"

Transcription

1 Quality of Cancer RNA Samples Is Essential for Molecular Classification Based on Microarray Results Application Pathology Author Jenny Xiao Agilent Technologies, Inc. Deer Creek Road MC U-7 Palo Alto, CA 9 USA Abstract There are four subgroups (normal-like, luminal, basallike, or Erb-B+/HER-) of breast cancer, as identified by gene expression profiling, which have a different prognosis and response to chemotherapy [, ]. Therefore, correct molecular identification of the subgroups is essential for breast cancer therapy. Recently, microarray-based gene expression analysis has been used for the molecular classification of breast cancer samples [] gaining widespread acceptance in its determination of subclassification of these tumors. However, isolating enough intact mrna, or even total RNA, from patients can be problematic. Degraded RNA can compromise the results and lead to misclassification. In this study, RNA samples from over breast cancer patients were compared, in a two-color microarray experiment, to a common reference sample on -mer oligo microarrays. The microarray results were then clustered into different subtypes. The quality of total RNA samples was tested using an Agilent Bioanalyzer prior to labeling and hybridization. Biochemical and molecular markers confirmed that more than 9% of the cancer samples were clustered correctly and had a clear breast cancer molecular subtype. However, some RNA samples used showed partial degradation on the Bioanalyzer trace. Their microarray results and analysis visually looked acceptable, however, instead of clustering with others of its subtype, they were clustered together, and we were able to remove or at least qualify the compromised profiles. These studies provide further proof that gene expression profiling for breast cancer classification is a valuable tool to the molecular pathologist but also suggest that researchers need to consider the potential risks of obtaining misleading classification results when RNA samples of lower quality are used. Strategies of how to avoid these pitfalls are discussed. Introduction Most researchers are aware that RNA samples of high quality are essential for good microarray experiments. For this reason, the Agilent Bioanalyzer is often used to test RNA quality prior to labeling and hybridization. The Bioanalyzer histogram of total RNA samples shows a low baseline and two clear ribosome RNA peaks (8s and 8s) indicating there is no degradation. However, it is hard to extract intact RNA from certain tissues and cell lines, for instance, pancreatic tissue is rich with RNAse which leaves the RNA susceptible to degradation. Improper handling, such as introducing RNAse contamination or storing biological samples at elevated temperature or lack of equipment in the operating rooms where biopsies are collected also put clinical samples at higher risk for degradation. Researchers must sometimes use RNA samples of lower quality in hopes of obtaining some valuable results. These results may give correct answers for the expression patterns of certain genes. However, when the microarray data are used for molecular identification purposes, it may lead to incorrect conclusions.

2 In this study, four partially degraded RNA samples were compared in a two-color microarray experiment to a common reference sample on Agilent oligonucleotide microarrays along with more than good breast cancer RNA samples. Cluster analysis has shown that instead of clustering with others of its subtype, they were all clustered together as a separate subgroup. Materials and Methods RNA Isolation Total RNA was isolated from mg of Snapfrozen Human breast tumor tissues by Qiagen RNeasy Midi Kit (Catalog Number 7). The quality of the isolated total RNA was checked using the RNA Nano LabChip kit on an Agilent Bioanalyzer (part number -7 and G9BA). Cluster Analysis The Genepix. software package was used for gridding and feature extraction. Lowess normalization algorithm was performed using University of North Carolina microarray databases. Experimental results were clustered using Eisen's gene clustering program. and TreeView.. Results and Discussion Bioanalyzer Results Seven RNA tumor samples were collected and tested on an Agilent Bioanalyzer. The Bioanalyzer histograms indicated that RNA from tumor samples,, and 7 were good quality, where RNA from tumors,,, and were degraded at different levels (Figures a g). RNA Labeling Purified total RNA samples were amplified and labeled by Agilent Low RNA Input Linear Amplification Kit (product number 8-), following the procedures described in the User's Manual. Cyanine - or Cyanine -CTP were purchased from Perkin-Elmer/NEN (NEL 8 and 8). Microarray and Hybridization Process Cyanine - and Cyanine -labeled crna were hybridized on an Agilent Human Oligo Microarray (Product number GB) following the Agilent oligonucleotide microarray hybridization user's manual using the Agilent in situ Hybridization Plus kit (product number 8-8). The hybridized microarray slides were disassembled in SSC,.% Triton X-, washed first with SSC,.% Triton X- for minutes at room temperature, then with. SSC,.% Triton X- for minutes on ice, then dried using a nitrogen-filled air gun. Processed microarray slides were then scanned by an Axon scanner.

3 Figure a. Tumor- (Intact RNA) Figure e. Tumor- (Degraded RNA) 7 7 Figure b. Tumor- (Intact RNA) Figure f. Tumor- (Partially degraded RNA) Figure c. Tumor- (Degraded RNA) Figure g. Tumor-7 (Intact RNA) Figure d. Tumor- (Partially degraded RNA)

4 Microarray Images The seven tumor RNA samples were labeled with Cyanine -CTP in parallel regardless of their quality. A common reference sample was labeled with Cyanine - CTP. The labeled Cyanine -tumor samples were then compared with the Cyanine - reference RNA on -mer oligonucleotide microarrays. Labeled RNA sample from tumor 7 was hybridized on two replicated microarrays to test the accuracy of the cluster algorithm. All eight microarray images were very similar upon visual comparison. Two microarray images are presented as examples (Figures a and b), showing results of the intact RNA vs. the degraded RNA. Figure a. Sample (intact RNA sample) vs. Reference Figure b. Sample (degraded RNA sample) vs. Reference

5 Cluster Results After feature extraction,.txt files from the eight microarrays (seven sample pairs) were clustered together along with microarray results from other breast cancer samples. Tumor samples 7 represent different subtypes and should be respectively clustered into different regions with their proper subtypes (Figure ). Among them, Tumors 7 and 7-repeated were clustered together indicating the profiles were very similar to each other. Tumors,, 7, and 7-repeated were clustered into correct regions and had clear breast cancer molecular subtype: Tumors and are blue, representing Luminal subtype; Tumor 7 and 7-repeated are in red representing Basal-like subtype. Tumors were clustered together in black as "weak signals" instead of going to their proper subtype regions. Basal cluster Proliferation cluster Her+ cluster Luminal cluster Figure. Tumor samples 7 clustered. Note that the displays on the right are exploded sectional views of the total display shown on the left.

6 Conclusion Microarray data plays an important role in the study of breast cancer classification. The results in this study, including Bioanalyzer data, microarray images, feature extracted results, clustering results, and biological expectations, suggest that researchers need to consider the potential risks of obtaining misleading classification results. For some reasons, researchers decide that even when the RNA quality is tested to be low, they still want to proceed to microarray experiments. In this case, the classification results require confirmation by other supporting biological and clinical data. If the above information is unavailable, the microarray data should be removed from the final cluster to avoid misleading conclusions. For More Information For more information on our products and services, visit our Web site at References. T. Sorlie, C.M. Perou, R. Tibshirani, T. Aas, S. Geisler, H. Johnsen, et. al. Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proc Natl Acad Sci USA. Sep ; 98(9): T. Sorlie, R. Tibshirani, J. Parker, T. Hastie, J.S. Marron, A. Nobel, et. al. Repeated observation of breast tumor subtypes in independent gene expression data sets. Proc Natl Acad Sci USA. Jul 8; (): 88.. L. J. Van't Veer, H. Dai, et al. () Gene Expression Profiling Predicts Clinical Outcome of Breast Cancer, Nature,. Agilent Technologies Bioresearch Solutions Unit Deer Creek Rd Palo Alto, CA 9 dna_microarray@agilent.com Agilent Gene Expression Microarrays Web site Agilent Lab-on-a-Chip Web site Acknowledgements We would like to thank Dr. Charles Perou and Dr. Zhiyuan Hu at the Departments of Genetics and Pathology Lineberger Comprehensive Cancer Center, the University of North Carolina at Chapel Hill for providing all the technical data. Agilent shall not be liable for errors contained herein or for incidental or consequential damages in connection with the furnishing, performance, or use of this material. Information, descriptions, and specifications in this publication are subject to change without notice. Please register online with Agilent to receive product updates at: Agilent Technologies, Inc. Printed in the USA May, 989-8EN

Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application

Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,

More information

New Stringent Two-Color Gene Expression Workflow Enables More Accurate and Reproducible Microarray Data

New Stringent Two-Color Gene Expression Workflow Enables More Accurate and Reproducible Microarray Data Application Note GENOMICS INFORMATICS PROTEOMICS METABOLOMICS A T C T GATCCTTC T G AAC GGAAC T AATTTC AA G AATCTGATCCTTG AACTACCTTCCAAGGTG New Stringent Two-Color Gene Expression Workflow Enables More

More information

The Agilent Total RNA Isolation Kit

The Agilent Total RNA Isolation Kit Better RNA purity. Better data. Without DNase treatment. The Agilent Total RNA Isolation Kit Now you can isolate highly purified, intact RNA without DNase treatment Introducing the Agilent Total RNA Isolation

More information

Optimizing crna fragmentation for microarray experiments using the Agilent 2100 bioanalyzer. Application Deborah Vitale.

Optimizing crna fragmentation for microarray experiments using the Agilent 2100 bioanalyzer. Application Deborah Vitale. Optimizing crna fragmentation for microarray experiments using the Agilent 2100 bioanalyzer Application Deborah Vitale Introduction Oligonucleotide arrays are a powerful tool for gene expression studies.

More information

High Performance Labeling Kits for cdna and Oligo Microarrays

High Performance Labeling Kits for cdna and Oligo Microarrays Agilent in Life Sciences > Genomics > Proteomics > Drug Discovery > Development > QA/QC High Performance Labeling Kits for cdna and Oligo Microarrays Get more from one experiment Agilent has perfected

More information

Gene Expression Profiling of Prokaryotic Samples using Low Input Quick Amp WT Kit

Gene Expression Profiling of Prokaryotic Samples using Low Input Quick Amp WT Kit Gene Expression Profiling of Prokaryotic Samples using Low Input Quick Amp WT Kit Application Note Authors Nilanjan Guha and Becky Mullinax Abstract Agilent s Low Input Quick Amp Labeling WT (LIQA WT)

More information

Cancer Detection and Prevention 27 (2003)

Cancer Detection and Prevention 27 (2003) Cancer Detection and Prevention 27 (2003) 405 411 Direct comparison of microarray gene expression profiles between non-amplification and a modified cdna amplification procedure applicable for needle biopsy

More information

High sensitivity quality control of RNA samples using the RNA 6000 Pico LabChip kit. Application. Rüdiger Salowsky Anna Henger.

High sensitivity quality control of RNA samples using the RNA 6000 Pico LabChip kit. Application. Rüdiger Salowsky Anna Henger. High sensitivity quality control of RNA samples using the RNA 6000 Pico LabChip kit Application Rüdiger Salowsky Anna Henger Abstract This Application Note describes the use of the RNA 6000 Pico LabChip

More information

High sensitivity quality control of RNA samples using the RNA 6000 Pico LabChip kit. Application. Rüdiger Salowsky Anna Henger.

High sensitivity quality control of RNA samples using the RNA 6000 Pico LabChip kit. Application. Rüdiger Salowsky Anna Henger. High sensitivity quality control of RNA samples using the RNA 6000 Pico LabChip kit Application Rüdiger Salowsky Anna Henger Abstract This Application Note describes the use of the RNA 6000 Pico LabChip

More information

DNA Microarray Technology

DNA Microarray Technology CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic

More information

Using Lower Amounts of RNA for GE Microarray Experiments

Using Lower Amounts of RNA for GE Microarray Experiments Welcome to our E-Seminar: Using Lower Amounts of RNA for GE Microarray Experiments Chairperson: Rita Willis Slide 1 Labeling RNA for Microarray Experiments Outline Introduction Labeling, Amplification

More information

Introduction to Microarray Analysis

Introduction to Microarray Analysis Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray

More information

The Agilent 2100 Bioanalyzer. RNA Integrity Number (RIN) A standardized approach for RNA integrity assessment. qpcr Symposium

The Agilent 2100 Bioanalyzer. RNA Integrity Number (RIN) A standardized approach for RNA integrity assessment. qpcr Symposium The Agilent 2100 Bioanalyzer RNA Integrity Number (RIN) A standardized approach for RNA integrity assessment qpcr Symposium Leipzig, 2005 Marc Valer RNA LabChip kits Analysis of Total RNA Integrity 11

More information

Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application

Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application Gene Expression Authors Ilgar Abbaszade, Claudia Robbins, John

More information

Aim of lecture:to get an overview of the whole process of microarrays, from study design to publication

Aim of lecture:to get an overview of the whole process of microarrays, from study design to publication Microarray pipeline Aim of lecture:to get an overview of the whole process of microarrays, from study design to publication Rita Holdhus Intoduction to Microarray technology September 2010 Many of the

More information

Single Cell Copy Number Screening Using the GenetiSure Pre-Screen Kit

Single Cell Copy Number Screening Using the GenetiSure Pre-Screen Kit Single Cell Copy Number Screening Using the GenetiSure Pre-Screen Kit Uncover Aneuploidies in Embryos Application Note Authors Paula Costa Natalia Novoradovskaya Scott Basehore Stephanie Fulmer-Smentek

More information

Practical DNA Microarray Analysis: An Introduction

Practical DNA Microarray Analysis: An Introduction Technology Practical DNA Microarray Analysis: An Introduction Marc Zapatka Computational Oncology Group Dept. Theoretical Bioinformatics German Cancer Research Center 2005-11-28 Will be introduced as needed

More information

DNA Microarray Technology

DNA Microarray Technology 2 DNA Microarray Technology 2.1 Overview DNA microarrays are assays for quantifying the types and amounts of mrna transcripts present in a collection of cells. The number of mrna molecules derived from

More information

Agilent RNA Spike-In Kit

Agilent RNA Spike-In Kit Agilent RNA Spike-In Kit Agilent RNA Spike-In Kit Product Number 5188-5279 Introduction The Agilent RNA Spike-In Kit was developed to provide positive controls for monitoring the microarray workflow from

More information

Microarray Experiment Design

Microarray Experiment Design Microarray Experiment Design Samples used, extract preparation and labelling: AML blasts were isolated from bone marrow by centrifugation on a Ficoll- Hypaque gradient. Total RNA was extracted using TRIzol

More information

High-Purity Bacterial RNA Isolated with the Agilent Total RNA Isolation Mini Kit Application

High-Purity Bacterial RNA Isolated with the Agilent Total RNA Isolation Mini Kit Application High-Purity Bacterial RNA Isolated with the Total RNA Isolation Mini Kit Application Gene Expression Author Christopher Rizzo Claudia A. Robbins Rhonda R. Taylor Technologies, Inc. 285 Centerville Road

More information

Tech Note. Using the ncounter Analysis System with FFPE Samples for Gene Expression Analysis. ncounter Gene Expression. Molecules That Count

Tech Note. Using the ncounter Analysis System with FFPE Samples for Gene Expression Analysis. ncounter Gene Expression. Molecules That Count ncounter Gene Expression Tech Note Using the ncounter Analysis System with FFPE Samples for Gene Expression Analysis Introduction For the past several decades, pathologists have kept samples obtained from

More information

MATERIALS AND METHODS. Sample Collection

MATERIALS AND METHODS. Sample Collection Universal mouse reference RNA derived from neonatal mice Xiao-Rui He, Chunlian Zhang, and Cam Patterson University of North Carolina, Chapel Hill, NC, USA BioTechniques 37:464-468 (September 2004) A reproducible,

More information

Measuring gene expression (Microarrays) Ulf Leser

Measuring gene expression (Microarrays) Ulf Leser Measuring gene expression (Microarrays) Ulf Leser This Lecture Gene expression Microarrays Idea Technologies Problems Quality control Normalization Analysis next week! 2 http://learn.genetics.utah.edu/content/molecules/transcribe/

More information

Microarrays & Gene Expression Analysis

Microarrays & Gene Expression Analysis Microarrays & Gene Expression Analysis Contents DNA microarray technique Why measure gene expression Clustering algorithms Relation to Cancer SAGE SBH Sequencing By Hybridization DNA Microarrays 1. Developed

More information

Developing an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL

Developing an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL Developing an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL James Storhoff, Ph.D. Senior Manager, Diagnostic Test Development World Cdx, Boston, Sep. 10th Molecules That

More information

BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis

BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology Lecture 2: Microarray analysis Genome wide measurement of gene transcription using DNA microarray Bruce Alberts, et al., Molecular Biology

More information

3.1.4 DNA Microarray Technology

3.1.4 DNA Microarray Technology 3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

Normalization. Getting the numbers comparable. DNA Microarray Bioinformatics - #27612

Normalization. Getting the numbers comparable. DNA Microarray Bioinformatics - #27612 Normalization Getting the numbers comparable The DNA Array Analysis Pipeline Question Experimental Design Array design Probe design Sample Preparation Hybridization Buy Chip/Array Image analysis Expression

More information

Isolation of High-Purity Total Cellular RNA from Muscle Tissues Using the Agilent Total RNA Isolation Mini Kit Application

Isolation of High-Purity Total Cellular RNA from Muscle Tissues Using the Agilent Total RNA Isolation Mini Kit Application Isolation of High-Purity Total Cellular RNA from Muscle Tissues Using the Total RNA Isolation Mini Kit Application Genomics Author Christopher Rizzo Technologies, Inc. 2850 Centerville Road Wilmington,

More information

ROAD TO STATISTICAL BIOINFORMATICS CHALLENGE 1: MULTIPLE-COMPARISONS ISSUE

ROAD TO STATISTICAL BIOINFORMATICS CHALLENGE 1: MULTIPLE-COMPARISONS ISSUE CHAPTER1 ROAD TO STATISTICAL BIOINFORMATICS Jae K. Lee Department of Public Health Science, University of Virginia, Charlottesville, Virginia, USA There has been a great explosion of biological data and

More information

Microarray pipeline & Pre-processing

Microarray pipeline & Pre-processing Microarray pipeline & Pre-processing Solveig Mjelstad Olafsrud J Express Analysis Course November 2010 Some slides adapted from Christine Stansberg thank you Christine! The microarray pipeline The goal

More information

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

Gene expression profiling experiments:

Gene expression profiling experiments: Gene expression profiling experiments: Problems, pitfalls, and solutions. Heli Borg The Alternatives in Microarray Experiments bacteria - eucaryots non poly(a) + - poly(a) + oligonucleotide Affymetrix

More information

Copy Number Analysis of Archival FFPE Tumor Samples by Oligo Array CGH

Copy Number Analysis of Archival FFPE Tumor Samples by Oligo Array CGH GENOMICS INFORMATICS PROTEOMICS METABOLOMICS A T C T G A T C C T T C T G AAC GGAAC T AAT T T C AA G AAT C T G AT C C T T G A A C T A C C T T C C AAG G T G Copy Number Analysis of Archival FFPE Tumor Samples

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

Performance verification of the automated NuGEN WT-Ovation FFPE RNA Amplification System

Performance verification of the automated NuGEN WT-Ovation FFPE RNA Amplification System TECHNICAL REPORT Performance verification of the automated NuGEN WT-Ovation FFPE RNA Amplification System FFPE specimens are routinely collected in clinical environments and are a rich source of well documented

More information

Analysis of DNA sequence copy number in archival formalin-fixed, paraffinembedded. Dione K. Bailey Anniek De Witte October 9, 2007

Analysis of DNA sequence copy number in archival formalin-fixed, paraffinembedded. Dione K. Bailey Anniek De Witte October 9, 2007 Analysis of DNA sequence copy number in archival formalin-fixed, paraffinembedded (FFPE) tumor samples by oligo array CGH Dione K. Bailey Anniek De Witte October 9, 2007 Agenda Oligo acgh Review Problems

More information

RNA extraction from tissue - using Bioruptor (Standard/Plus) and RNA extraction kit

RNA extraction from tissue - using Bioruptor (Standard/Plus) and RNA extraction kit RNA extraction from tissue - using Bioruptor (Standard/Plus) and RNA extraction kit Introduction Isolation of intact RNA is essential for many techniques used in gene expression analysis. Efficient disruption

More information

Establishment and verification of mirnas expression molecules for breast cancer and its distant metastasis Yanhong Gao Associate Professor

Establishment and verification of mirnas expression molecules for breast cancer and its distant metastasis Yanhong Gao Associate Professor Establishment and verification of mirnas expression molecules for breast cancer and its distant metastasis Yanhong Gao Associate Professor Department of Clinical Biochemistry Chinese PLA General Hospital

More information

Puritan Report for Batch PC Lot# 3127, Blue Pink and Yellow. Swabs were received for testing on May 22, 2012

Puritan Report for Batch PC Lot# 3127, Blue Pink and Yellow. Swabs were received for testing on May 22, 2012 Puritan Report for Batch 25-806 2PC Lot# 3127, Blue Pink and Yellow Prepared by the University of Maine DNA Sequencing Facility/ Patty Singer, June 8, 2012 Swabs were received for testing on May 22, 2012

More information

Product Specifications & Manual

Product Specifications & Manual Product Specifications & Manual Custom Oligo Synthesis, antisense oligos, RNA oligos, chimeric oligos, Fluorescent dye labeled oligos, Molecular Beacons, sirna, phosphonates Affinity Ligands, 2-5 linked

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Proteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer.

Proteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer. Proteomics And Cancer Biomarker Discovery Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar Overview Proteomics Cancer Aims Tools Data Base search Challenges Summary 1 Overview

More information

Background Analysis and Cross Hybridization. Application

Background Analysis and Cross Hybridization. Application Background Analysis and Cross Hybridization Application Pius Brzoska, Ph.D. Abstract Microarray technology provides a powerful tool with which to study the coordinate expression of thousands of genes in

More information

TECH NOTE Stranded NGS libraries from FFPE samples

TECH NOTE Stranded NGS libraries from FFPE samples TECH NOTE Stranded NGS libraries from FFPE samples Robust performance with extremely degraded FFPE RNA (DV 200 >25%) Consistent library quality across a range of input amounts (5 ng 50 ng) Compatibility

More information

DNA Microarrays and Clustering of Gene Expression Data

DNA Microarrays and Clustering of Gene Expression Data DNA Microarrays and Clustering of Gene Expression Data Martha L. Bulyk mlbulyk@receptor.med.harvard.edu Biophysics 205 Spring term 2008 Traditional Method: Northern Blot RNA population on filter (gel);

More information

MammaPrint and BluePrint Breast Cancer Recurrence and Molecular Subtyping Kit Package Insert

MammaPrint and BluePrint Breast Cancer Recurrence and Molecular Subtyping Kit Package Insert Agendia NV. MammaPrint and BluePrint Breast Cancer Recurrence and Molecular Subtyping Kit Package Insert Targeted sequencing of RNA from formalin-fixed, paraffin-embedded tissue sections to assess breast

More information

Outline. Analysis of Microarray Data. Most important design question. General experimental issues

Outline. Analysis of Microarray Data. Most important design question. General experimental issues Outline Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization Introduction to microarrays Experimental design Data normalization Other data transformation Exercises George Bell,

More information

Please purchase PDFcamp Printer on to remove this watermark. DNA microarray

Please purchase PDFcamp Printer on  to remove this watermark. DNA microarray DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of

More information

Product Specifications & Manual

Product Specifications & Manual Product Specifications & Manual Custom Oligo Synthesis, antisense oligos, RNA oligos, chimeric oligos, Fluorescent dye labeled oligos, Molecular Beacons, sirna, phosphonates Affinity Ligands, 2-5 linked

More information

Rapid Method for the Purification of Total RNA from Formalin- Fixed Paraffin-Embedded (FFPE) Tissue Samples

Rapid Method for the Purification of Total RNA from Formalin- Fixed Paraffin-Embedded (FFPE) Tissue Samples Application Note 17 RNA Sample Preparation Rapid Method for the Purification of Total RNA from Formalin- Fixed Paraffin-Embedded (FFPE) Tissue Samples M. Melmogy 1, V. Misic 1, B. Lam, PhD 1, C. Dobbin,

More information

DNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT.

DNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. DNA/RNA MICROARRAYS This protocol is based on the EDVOTEK protocol DNA/RNA Microarrays. 10 groups of students NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. 1. EXPERIMENT OBJECTIVE The objective of this

More information

Isolation of total nucleic acids from FFPE tissues using FormaPure DNA

Isolation of total nucleic acids from FFPE tissues using FormaPure DNA APPLICATION NOTE Isolation of total nucleic acids from FFPE tissues using FormaPure DNA Jung Hoon Doh, Ph.D. Senior Application Scientist Beckman Coulter Life Sciences, Indianapolis, IN USA Summary Extensive

More information

IsoFluxTM. System. The next generation of CTC Analysis is here

IsoFluxTM. System. The next generation of CTC Analysis is here IsoFluxTM System The next generation of CTC Analysis is here Product Overview IsoFlux System The next generation of circulating tumor cell analysis is here The IsoFlux System enriches intact rare cells

More information

Product Specifications & Manual

Product Specifications & Manual Product Specifications & Manual Oligo dt primers, random primers, sequencing primers Custom Oligo Synthesis, antisense oligos, RNA oligos, chimeric oligos, Affinity Ligands, 2-5 linked Oligos Oligo dt

More information

T7-Based RNA Amplification Protocol (in progress)

T7-Based RNA Amplification Protocol (in progress) T7-Based RNA Amplification Protocol (in progress) Jacqueline Ann Lopez (modifications) Amy Cash & Justen Andrews INTRODUCTION T7 RNA Amplification, a technique originally developed in the laboratory of

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

The essentials of microarray data analysis

The essentials of microarray data analysis The essentials of microarray data analysis (from a complete novice) Thanks to Rafael Irizarry for the slides! Outline Experimental design Take logs! Pre-processing: affy chips and 2-color arrays Clustering

More information

LABORATORY FUNDAMENTALS IN BIOLOGICAL ENGINEERING. Leona Samson. MODULE 2 EXPRESSION ENGINEERING Lecture # 3.

LABORATORY FUNDAMENTALS IN BIOLOGICAL ENGINEERING. Leona Samson. MODULE 2 EXPRESSION ENGINEERING Lecture # 3. 20.109 LABORATORY FUNDAMENTALS IN BIOLOGICAL ENGINEERING MODULE 2 EXPRESSION ENGINEERING Lecture # 3 Leona Samson March 31 st 2009 Snapshot of the next four weeks We will eliminate the expression of various

More information

Rapid Method for the Purification of Total RNA from Formalin-Fixed Paraffin-Embedded (FFPE) Tissue Samples

Rapid Method for the Purification of Total RNA from Formalin-Fixed Paraffin-Embedded (FFPE) Tissue Samples Application Note 17 RNA Sample Preparation Rapid Method for the Purification of Total RNA from Formalin-Fixed Paraffin-Embedded (FFPE) Tissue Samples M. Melmogy 1, V. Misic 1, B. Lam, PhD 1, C. Dobbin,

More information

Microarrays The technology

Microarrays The technology Microarrays The technology Goal Goal: To measure the amount of a specific (known) DNA molecule in parallel. In parallel : do this for thousands or millions of molecules simultaneously. Main components

More information

Introduction to microarray technology and data analysis

Introduction to microarray technology and data analysis Introduction to microarray technology and data analysis Aron C. Eklund eklund@cbs.dtu.dk Cancer Systems Biology group Center for Biological Sequence Analysis Technical University of Denmark Introduction

More information

Technical Note. GeneChip 3 IVT PLUS Reagent Kit vs. GeneChip 3 IVT Express Reagent Kit Comparison. Introduction:

Technical Note. GeneChip 3 IVT PLUS Reagent Kit vs. GeneChip 3 IVT Express Reagent Kit Comparison. Introduction: Technical Note GeneChip 3 IVT PLUS Reagent Kit vs. GeneChip 3 IVT Express Reagent Kit Comparison Introduction: Affymetrix has launched a new 3 IVT PLUS Reagent Kit which creates hybridization ready target

More information

Analysis of genetically modified soya using the Agilent 2100 bioanalyzer. Application. Steve Garrett Özge Arun John Dooley.

Analysis of genetically modified soya using the Agilent 2100 bioanalyzer. Application. Steve Garrett Özge Arun John Dooley. Analysis of genetically modified soya using the Agilent 2100 bioanalyzer Application Steve Garrett Özge Arun John Dooley Abstract In this Application Note we describe how the Agilent 2100 bioanalyzer was

More information

Novel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc.

Novel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc. Novel methods for RNA and DNA- Seq analysis using SMART Technology Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc. Agenda Enabling Single Cell RNA-Seq using SMART Technology SMART

More information

Comparison of 3 labeling and amplification protocols: for total RNA labeling, amplification, and Affymetrix GeneChip expression (last updated 9/26/05)

Comparison of 3 labeling and amplification protocols: for total RNA labeling, amplification, and Affymetrix GeneChip expression (last updated 9/26/05) Comparison of 3 labeling and amplification protocols: for total RNA labeling, amplification, and Affymetrix GeneChip expression (last updated 9/26/05) Purpose: to compare 3 of the commercially available

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction

More information

Microarrays: since we use probes we obviously must know the sequences we are looking at!

Microarrays: since we use probes we obviously must know the sequences we are looking at! These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction

More information

DNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center

DNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center DNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center Why DNA Chips? Functional genomics: get information about genes that is unavailable from sequence

More information

INTRODUCTION. The Technology of Microarrays January Hanne Jarmer

INTRODUCTION. The Technology of Microarrays January Hanne Jarmer INTRODUCTION The Technology of Microarrays January 2009 - Hanne Jarmer The Concept gene mrna gene specific DNA probes labeled target Spotted arrays High-density arrays 13-16 micron features ~60 micron

More information

ZytoLight SPEC HER2/TOP2A/CEN 17

ZytoLight SPEC HER2/TOP2A/CEN 17 ZytoLight SPEC HER2/TOP2A/CEN 17 Triple Color Probe Z-2093-200 Z-2093-50 20 (0.2 ml) 5 (0.05 ml) For the detection of the human HER2 gene, the human TOP2A gene, and alpha-satellites of chromosome 17 by

More information

Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays

Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Application Note Authors Bahram Arezi, Nilanjan Guha and Anne Bergstrom Lucas Agilent Technologies Inc. Santa

More information

Automation of Lexogen s QuantSeq 3 mrna-seq Library Prep Kits on the Biomek FX p NGS Workstation

Automation of Lexogen s QuantSeq 3 mrna-seq Library Prep Kits on the Biomek FX p NGS Workstation Automation of Lexogen s QuantSeq 3 mrna-seq Library Prep Kits on the Biomek FX p NGS Workstation The Lexogen QuantSeq 3 mrna-seq Library Prep Kits for Illumina (FWD and REV) produce ready-to-sequence libraries

More information

Agilent Genomic Workbench 7.0

Agilent Genomic Workbench 7.0 Agilent Genomic Workbench 7.0 Product Overview Guide Agilent Technologies Notices Agilent Technologies, Inc. 2012, 2015 No part of this manual may be reproduced in any form or by any means (including electronic

More information

COS 597c: Topics in Computational Molecular Biology. DNA arrays. Background

COS 597c: Topics in Computational Molecular Biology. DNA arrays. Background COS 597c: Topics in Computational Molecular Biology Lecture 19a: December 1, 1999 Lecturer: Robert Phillips Scribe: Robert Osada DNA arrays Before exploring the details of DNA chips, let s take a step

More information

Guidelines Analysis of RNA Quantity and Quality for Next-Generation Sequencing Projects

Guidelines Analysis of RNA Quantity and Quality for Next-Generation Sequencing Projects Title: Protocol number: Guidelines Analysis of RNA Quantity and Quality for Next-Generation Sequencing Projects GAF S002 Version: Version 4 Date: December 17 th 2015 Author: P. van der Vlies, C.C. van

More information

Introduction to microarray technology and data analysis

Introduction to microarray technology and data analysis Introduction to microarray technology and data analysis Aron C. Eklund eklund@cbs.dtu.dk Cancer Systems Biology group Center for Biological Sequence Analysis Technical University of Denmark Introduction

More information

Outline. Array platform considerations: Comparison between the technologies available in microarrays

Outline. Array platform considerations: Comparison between the technologies available in microarrays Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of

More information

POET REPORT Perspectives on Emerging Technology

POET REPORT Perspectives on Emerging Technology POET REPORT Perspectives on Emerging Technology In Vitro Diagnostic Multivariate Assays (IVDMIAs) September, 2009 Developed by the CAP s Technology Assessment Committee College of American Pathologists

More information

Agilent s Microarray Platform: How High-Fidelity DNA Synthesis Maximizes the Dynamic Range of Gene Expression Measurements

Agilent s Microarray Platform: How High-Fidelity DNA Synthesis Maximizes the Dynamic Range of Gene Expression Measurements Agilent s Microarray Platform: How High-Fidelity DNA Synthesis Maximizes the Dynamic Range of Gene Expression Measurements Author Emily LeProust, Ph.D. Agilent Technologies A key factor controlling the

More information

AdnaTest EMT-2/StemCell Add-on Ovarian-2 Detect

AdnaTest EMT-2/StemCell Add-on Ovarian-2 Detect AdnaTest EMT-2/StemCell Add-on Ovarian-2 Detect PCR-expression analysis of ovarian cancer associated gene expression in enriched tumor cells For research use only Manual T-1-537-PO-2 Contents Order Information...

More information

Agilent SurePrint G3 Human Catalog CGH Microarrays

Agilent SurePrint G3 Human Catalog CGH Microarrays Agilent SurePrint G3 Human Catalog CGH Microarrays Product Note The new Agilent 1M CGH array combines the excellent probe design and performance characteristics of the Agilent acgh platforms with a million

More information

3. Microarrays: experimental design, statistical analysis and gene clustering

3. Microarrays: experimental design, statistical analysis and gene clustering WUEMED Drought Course 3. Microarrays: experimental design, statistical analysis and gene clustering John Bennett International Rice Research Institute Los Baños, Philippines 3.1: Experimental overview

More information

High-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours

High-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours High-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours Application Note Authors Paula Costa and Anniek De Witte Agilent Technologies, Inc. Santa Clara, CA USA Abstract As

More information

LECTURE 6 Jeremy Squire Future directions: the human genome project and automation in molecular diagnostics

LECTURE 6 Jeremy Squire Future directions: the human genome project and automation in molecular diagnostics LECTURE 6 Jeremy Squire Future directions: the human genome project and automation in molecular diagnostics In this lecture we will focus on the importance of cancer genomics or the application of the

More information

THE INSTITUTE FOR GENOMIC RESEARCH Standard Operating Procedure SOP #: M022 REVISION LEVEL:.1 EFFECTIVE DATE: 04/12/04

THE INSTITUTE FOR GENOMIC RESEARCH Standard Operating Procedure SOP #: M022 REVISION LEVEL:.1 EFFECTIVE DATE: 04/12/04 PAGE: 1 of 13 SOP #: M022 REVISION LEVEL:.1 EFFECTIVE DATE: 04/12/04 AUTHOR: Nicholas Marko PRIMARY REVIEWERS: Renee Rubio, Bryan Frank 1. PURPOSE This protocol describes the procedure for amplifying RNA

More information

AdnaTest BreastCancerDetect

AdnaTest BreastCancerDetect AdnaTest BreastCancerDetect RT-PCR Kit for detection of breast cancer associated gene expression in enriched tumor cells For research use only Manual T-1-509 Contents Order Information... 3 Purpose...

More information

Research Powered by Agilent s GeneSpring

Research Powered by Agilent s GeneSpring Research Powered by Agilent s GeneSpring Agilent Technologies, Inc. Carolina Livi, Bioinformatics Segment Manager Research Powered by GeneSpring Topics GeneSpring (GS) platform New features in GS 13 What

More information

Quality assurance of RNA derived from laser microdissected tissue samples obtained by the PALM MicroBeam System using the RNA 6000 Pico LabChip kit.

Quality assurance of RNA derived from laser microdissected tissue samples obtained by the PALM MicroBeam System using the RNA 6000 Pico LabChip kit. Quality assurance of RN derived from laser microdissected tissue samples obtained by the PLM MicroBeam System using the RN 6 Pico LabChip kit. pplication Marcus Gassmann bstract Gene expression profiling

More information

Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes

Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional

More information

Deoxyribonucleic Acid DNA

Deoxyribonucleic Acid DNA Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Image Analysis. Based on Information from Terry Speed s Group, UC Berkeley. Lecture 3 Pre-Processing of Affymetrix Arrays. Affymetrix Terminology

Image Analysis. Based on Information from Terry Speed s Group, UC Berkeley. Lecture 3 Pre-Processing of Affymetrix Arrays. Affymetrix Terminology Image Analysis Lecture 3 Pre-Processing of Affymetrix Arrays Stat 697K, CS 691K, Microbio 690K 2 Affymetrix Terminology Probe: an oligonucleotide of 25 base-pairs ( 25-mer ). Based on Information from

More information

Introduction to Bioinformatics. Fabian Hoti 6.10.

Introduction to Bioinformatics. Fabian Hoti 6.10. Introduction to Bioinformatics Fabian Hoti 6.10. Analysis of Microarray Data Introduction Different types of microarrays Experiment Design Data Normalization Feature selection/extraction Clustering Introduction

More information

CodeLink Human Whole Genome Bioarray

CodeLink Human Whole Genome Bioarray CodeLink Human Whole Genome Bioarray 55,000 human gene targets on a single bioarray The CodeLink Human Whole Genome Bioarray comprises one of the most comprehensive coverages of the human genome, as it

More information

SWISS MADE: Standardized WithIn Class Sum of Squares to evaluate methodologies and dataset elements.

SWISS MADE: Standardized WithIn Class Sum of Squares to evaluate methodologies and dataset elements. See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/42834054 SWISS MADE: Standardized WithIn Class Sum of Squares to evaluate methodologies and

More information