Introduction to microarray technology and data analysis

Size: px
Start display at page:

Download "Introduction to microarray technology and data analysis"

Transcription

1 Introduction to microarray technology and data analysis Aron C. Eklund Cancer Systems Biology group Center for Biological Sequence Analysis Technical University of Denmark Introduction to Systems Biology February 17, 2014

2 Tools we can use to study the cellular system Mass Spectrometry Total protein levels and post transla7onal modificia7ons metabolomics Sequencing Genomic and exosome sequence Muta7ons in DNA, RNA Arrays Levels of RNA Gene manipula7on studies Knockdown RNA Overexpress RNA IE: Generate a large amount of data

3 System biology work flow DNA RNA Protein Metabolites Modeling of all informa7on (determine regulators of certain func7on) Computer driven hypothesis of molecular regulators of func7on Experimental manipula7on DNA RNA Protein Metabolites

4 Learning objectives 1. Describe a gene expression microarray and what it measures 2. Explain the steps needed to generate gene expression microarray data 4. Describe at least one application of a gene expression microarray 5. Use R at a basic level 6. Explain and calculate a log2 ratio 7. Explain and calculate a P value using the t test

5 Expression of a gene Transcription Translation DNA mrna Protein gene expression = how much of a certain mrna is present protein expression = how much of a certain protein is present

6 Why do we want to measure gene expression? 1. Biological / medical research - inference of the function of a gene - understanding gene regulation - biomarker discovery 2. Clinical diagnostics - predictive biomarkers for cancer - identifying cancers of unknown primary

7 The DNA microarray Thousands to millions of DNA spots in a few square centimeters Cartridge Glass slide a. b.

8 The gene expression microarray a. Labeled target RNA made from a biological sample Specific hybridization between a complementary probe and target detected by fluorescence DNA probe attached to the microarray substrate expression profile

9 Sequence-specific hybridization 5 -CTTGACACCCAGCTGGTCCTGTGGATGGGAGCGGT-3 3 -GTGGGTCGACCAGGACACCTACCCT-5 Probe Target mrna Substrate 5 -TAGCACACCCCGCTGCTCCTGTGGTCCCAAATGCA-3 X 3 -GTGGGTCGACCAGGACACCTACCCT-5 other mrna

10 Gene expression matrix Samples Genes 100.CEL.gz 103.CEL.gz 104.CEL.gz 105.CEL.gz 106.CEL.gz DDR RFC HSPA PAX GUCA1A UBA THRA PTPN CCL CYP2E EPHB ESRRA CYP2A GAS MMP TRADD FNTB PLD which values can be compared here?

11 The process Biological specimen Expression data

12 The process 1. Isolate RNA from a biological specimen 2. Create labeled target from the RNA 3. Let the labeled target hybridize (incubate) on the microarray 4. Wash off the unbound target 5. Scan the microarray 6. Analyze the data

13 SAMPLE Two color labeled cdna (mostly outdated simple approach!) CONTROL mrna mrna cdna cdna Cy5-cDNA Cy3-cDNA

14 The Eberwine Protocol SAMPLE 42 C 2 h + Reverse Transcriptase RNA ssdna T7 70 C 10 min 16 C 2 h + RNase H + Polymerase clean up dsdna T7 pol 37 C 6 h dsdna arna + Biotin-labeled nucleotides

15 Affymetrix fluidics station and scanner Hybridize, incubate, rinse Scan

16 Image processing and normalization Normalization adjusts data to correct for systematic bias in intensity levels

17 Normalized expression matrix Samples Genes 100.CEL.gz 103.CEL.gz 104.CEL.gz 105.CEL.gz 106.CEL.gz DDR RFC HSPA PAX GUCA1A UBA THRA PTPN CCL CYP2E EPHB ESRRA CYP2A GAS MMP TRADD FNTB PLD now what?

18 What is the question? Typically, we use microarrays to compare between groups: Disease vs. normal Drug treatment vs. control Disease A vs. Disease B Good prognosis vs. bad prognosis

19 Comparing a gene between two groups MBNL fold change log2 ratio P value (Student s t test) HD N

20 Visualization of microarray data 0.00 scanner origin PCC BPE4 BPLE3 BPLE2 BPLER2 BPE3 BPE2 BPLE4 BPLER3 BPLER4 OCE1 FNE1 OCE2 FNE2 OCLER1 FNLER1 OCLE1 FNLE1 OCLE2 OCLER2 FNLE2 FNLER2 HMLE3 HMLER3 HME3 HME2 HME4 HMLER4 HMLE2 HMLE4 HMLER2

21 Individual probe response on microarrays Log scale Natural scale Log intensity Intensity Log concentration (pm) Concentration (pm) D. Skvortsov et al., (2007) NAR

22 Microarray data: what do the numbers mean 1. No calibration: Expression values cannot be readily translated into concentration 2. Response curves are not parallel: Comparison between one gene and another gene is almost meaningless 3. Noisy at low levels (on the log scale): Fold changes can be misleading. 4. Saturation at high levels: Cannot detect changes

23 Evolution of gene expression (mrna) measurements s - Northern blot - one gene at a time, not very accurate s - Quantitative reverse transcriptase polymerase chain reaction (RT-PCR) - one gene at a time, very accurate 3. mid-1990s - DNA microarray - many genes at a time, medium accuracy 4. Late 2000s - RNA-seq - all genes, high accuracy?

24 Other applications of microarrays (in general) DNA microarray - Gene expression - Genotyping (SNP profile) - DNA profiling (CGH, copy number) - ChIP-Chip Protein microarrays Tissue microarrays Cellular microarrays Compound microarrays

25 About the exercises

26 The data set in the exercise Genome-wide expression profiling of human blood reveals biomarkers for Huntington's disease. Borovecki F, Lovrecic L, Zhou J, Jeong H, Then F, Rosas HD, Hersch SM, Hogarth P, Bouzou B, Jensen RV, Krainc D. Proc Natl Acad Sci U S A Aug 2;102(31): samples: - 14 normal - 5 presymptomatic - 12 symptomatic Affymetrix HG-U133A arrays Huntingon s disease: - neurological disorder - polyglutamine expansion in the huntingtin gene Why search for marker of disease progression (not diagnosis)? - assess treatment efficacy - surrogate endpoint in drug trials

27 Practicalities

28 Lunch break now Exercises at 13:00

Introduction to microarray technology and data analysis

Introduction to microarray technology and data analysis Introduction to microarray technology and data analysis Aron C. Eklund eklund@cbs.dtu.dk Cancer Systems Biology group Center for Biological Sequence Analysis Technical University of Denmark Introduction

More information

Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison. CodeLink compatible

Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison. CodeLink compatible Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison CodeLink compatible Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood

More information

INTRODUCTION. The Technology of Microarrays January Hanne Jarmer

INTRODUCTION. The Technology of Microarrays January Hanne Jarmer INTRODUCTION The Technology of Microarrays January 2009 - Hanne Jarmer The Concept gene mrna gene specific DNA probes labeled target Spotted arrays High-density arrays 13-16 micron features ~60 micron

More information

Introduction to DNA microarrays. DTU - January Hanne Jarmer

Introduction to DNA microarrays. DTU - January Hanne Jarmer Introduction to DNA microarrays DTU - January 2007 - Hanne Jarmer Microarrays - The Concept Measure the level of transcript from a very large number of genes in one go Microarrays - The Concept Measure

More information

3.1.4 DNA Microarray Technology

3.1.4 DNA Microarray Technology 3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns

More information

Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes

Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional

More information

DNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT.

DNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. DNA/RNA MICROARRAYS This protocol is based on the EDVOTEK protocol DNA/RNA Microarrays. 10 groups of students NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. 1. EXPERIMENT OBJECTIVE The objective of this

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison

Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison Microarray Analysis of Gene Expression in Huntington's Disease Peripheral Blood - a Platform Comparison Thank you for waiting. The presentation will be starting in a few minutes at 9AM Pacific Daylight

More information

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Deoxyribonucleic Acid DNA

Deoxyribonucleic Acid DNA Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

COS 597c: Topics in Computational Molecular Biology. DNA arrays. Background

COS 597c: Topics in Computational Molecular Biology. DNA arrays. Background COS 597c: Topics in Computational Molecular Biology Lecture 19a: December 1, 1999 Lecturer: Robert Phillips Scribe: Robert Osada DNA arrays Before exploring the details of DNA chips, let s take a step

More information

Gene expression analysis. Gene expression analysis. Total RNA. Rare and abundant transcripts. Expression levels. Transcriptional output of the genome

Gene expression analysis. Gene expression analysis. Total RNA. Rare and abundant transcripts. Expression levels. Transcriptional output of the genome Gene expression analysis Gene expression analysis Biology of the transcriptome Observing the transcriptome Computational biology of gene expression sven.nelander@wlab.gu.se Recent examples Transcriptonal

More information

Gene expression. What is gene expression?

Gene expression. What is gene expression? Gene expression What is gene expression? Methods for measuring a single gene. Northern Blots Reporter genes Quantitative RT-PCR Operons, regulons, and stimulons. DNA microarrays. Expression profiling Identifying

More information

Microarray. Key components Array Probes Detection system. Normalisation. Data-analysis - ratio generation

Microarray. Key components Array Probes Detection system. Normalisation. Data-analysis - ratio generation Microarray Key components Array Probes Detection system Normalisation Data-analysis - ratio generation MICROARRAY Measures Gene Expression Global - Genome wide scale Why Measure Gene Expression? What information

More information

Selected Techniques Part I

Selected Techniques Part I 1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative

More information

6. GENE EXPRESSION ANALYSIS MICROARRAYS

6. GENE EXPRESSION ANALYSIS MICROARRAYS 6. GENE EXPRESSION ANALYSIS MICROARRAYS BIOINFORMATICS COURSE MTAT.03.239 16.10.2013 GENE EXPRESSION ANALYSIS MICROARRAYS Slides adapted from Konstantin Tretyakov s 2011/2012 and Priit Adlers 2010/2011

More information

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods

More information

Measuring gene expression (Microarrays) Ulf Leser

Measuring gene expression (Microarrays) Ulf Leser Measuring gene expression (Microarrays) Ulf Leser This Lecture Gene expression Microarrays Idea Technologies Problems Quality control Normalization Analysis next week! 2 http://learn.genetics.utah.edu/content/molecules/transcribe/

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

DNA Microarray Technology

DNA Microarray Technology CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Microarrays: since we use probes we obviously must know the sequences we are looking at!

Microarrays: since we use probes we obviously must know the sequences we are looking at! These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression

More information

Motivation From Protein to Gene

Motivation From Protein to Gene MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein

More information

Introduction to Bioinformatics and Gene Expression Technology

Introduction to Bioinformatics and Gene Expression Technology Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA

More information

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1 CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing

More information

SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.

SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology. SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture

More information

Measuring and Understanding Gene Expression

Measuring and Understanding Gene Expression Measuring and Understanding Gene Expression Dr. Lars Eijssen Dept. Of Bioinformatics BiGCaT Sciences programme 2014 Why are genes interesting? TRANSCRIPTION Genome Genomics Transcriptome Transcriptomics

More information

Goals of pharmacogenomics

Goals of pharmacogenomics Goals of pharmacogenomics Use drugs better and use better drugs! People inherit/exhibit differences in drug: Absorption Metabolism and degradation of the drug Transport of drug to the target molecule Excretion

More information

MICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE

MICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE MICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE National Center for Biotechnology Information With only a few exceptions, every

More information

Bioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU.

Bioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU. Introduction to Bioinformatics: Microarray Technology Assc.Prof. Chuchart Areejitranusorn AMS. KKU. ความจร งเก ยวก บ ความจรงเกยวกบ Cell and DNA Cell Nucleus Chromosome Protein Gene (mrna), single strand

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Microarrays & Gene Expression Analysis

Microarrays & Gene Expression Analysis Microarrays & Gene Expression Analysis Contents DNA microarray technique Why measure gene expression Clustering algorithms Relation to Cancer SAGE SBH Sequencing By Hybridization DNA Microarrays 1. Developed

More information

Introduction to Microarray Analysis

Introduction to Microarray Analysis Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray

More information

Gene expression analysis: Introduction to microarrays

Gene expression analysis: Introduction to microarrays Gene expression analysis: Introduction to microarrays Adam Ameur The Linnaeus Centre for Bioinformatics, Uppsala University February 15, 2006 Overview Introduction Part I: How a microarray experiment is

More information

BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis

BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology Lecture 2: Microarray analysis Genome wide measurement of gene transcription using DNA microarray Bruce Alberts, et al., Molecular Biology

More information

Measuring gene expression

Measuring gene expression Measuring gene expression Grundlagen der Bioinformatik SS2018 https://www.youtube.com/watch?v=v8gh404a3gg Agenda Organization Gene expression Background Technologies FISH Nanostring Microarrays RNA-seq

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

Blotting Techniques (Southern blot, Northern blot, Western blot, and Eastern blot)

Blotting Techniques (Southern blot, Northern blot, Western blot, and Eastern blot) Blotting Techniques (Southern blot, Northern blot, Western blot, and Eastern blot) Masheal Aljumaah SEP 2018 Learning Objectives: What is blotting? Blotting Techniques Types. Applications for each technique.

More information

Human Genomics. 1 P a g e

Human Genomics. 1 P a g e Human Genomics What were the aims of the human genome project? To identify all the approximately 20,000-25,000 genes in Human DNA. To find where each gene is located To determine the sequences of the 3

More information

The Agilent Total RNA Isolation Kit

The Agilent Total RNA Isolation Kit Better RNA purity. Better data. Without DNase treatment. The Agilent Total RNA Isolation Kit Now you can isolate highly purified, intact RNA without DNase treatment Introducing the Agilent Total RNA Isolation

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary

More information

Design. Construction. Characterization

Design. Construction. Characterization Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication

More information

Feature Selection of Gene Expression Data for Cancer Classification: A Review

Feature Selection of Gene Expression Data for Cancer Classification: A Review Available online at www.sciencedirect.com ScienceDirect Procedia Computer Science 50 (2015 ) 52 57 2nd International Symposium on Big Data and Cloud Computing (ISBCC 15) Feature Selection of Gene Expression

More information

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene

More information

Introduction to gene expression microarray data analysis

Introduction to gene expression microarray data analysis Introduction to gene expression microarray data analysis Outline Brief introduction: Technology and data. Statistical challenges in data analysis. Preprocessing data normalization and transformation. Useful

More information

DNA Microarray Technology

DNA Microarray Technology 2 DNA Microarray Technology 2.1 Overview DNA microarrays are assays for quantifying the types and amounts of mrna transcripts present in a collection of cells. The number of mrna molecules derived from

More information

Welcome! Introduction to High Throughput Genomics December Norwegian Microarray Consortium FUGE Bioinformatics platform

Welcome! Introduction to High Throughput Genomics December Norwegian Microarray Consortium FUGE Bioinformatics platform Introduction to High Throughput Genomics December 2011 Norwegian Microarray Consortium FUGE Bioinformatics platform Rita Holdhus Kjell Petersen Welcome! Course program Day 1 Thursday 1st December 2011

More information

SGN-6106 Computational Systems Biology I

SGN-6106 Computational Systems Biology I SGN-6106 Computational Systems Biology I A View of Modern Measurement Systems in Cell Biology Kaisa-Leena Taattola 21.2.2007 1 The cell a complex system (Source: Lehninger Principles of Biochemistry 4th

More information

Then, we went on to discuss genome expression and described: Microarrays

Then, we went on to discuss genome expression and described: Microarrays In the previous lecture, we have discussed: - classical sequencing methods - newer authomatic sequencing methods - solid-phase parallel sequencing - Next Generation mass-sequencing methods Then, we went

More information

By the name of ALLA. To calculate the statistical significance we use certain formula to know the significance of certain mutation.

By the name of ALLA. To calculate the statistical significance we use certain formula to know the significance of certain mutation. By the name of ALLA LECTURE NO# 13 This lecture include the slide from 43 to 74 so plz refer to them Genome-wide association studies (GWAS) : GWAS is the study of whole genome of the Pts to find mutation

More information

EECS730: Introduction to Bioinformatics

EECS730: Introduction to Bioinformatics EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and

More information

Computing with large data sets

Computing with large data sets Computing with large data sets Richard Bonneau, spring 2009 Lecture 14 (week 8): genomics 1 Central dogma Gene expression DNA RNA Protein v22.0480: computing with data, Richard Bonneau Lecture 14 places

More information

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how

More information

Outline. Array platform considerations: Comparison between the technologies available in microarrays

Outline. Array platform considerations: Comparison between the technologies available in microarrays Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of

More information

Introduction to Bioinformatics. Fabian Hoti 6.10.

Introduction to Bioinformatics. Fabian Hoti 6.10. Introduction to Bioinformatics Fabian Hoti 6.10. Analysis of Microarray Data Introduction Different types of microarrays Experiment Design Data Normalization Feature selection/extraction Clustering Introduction

More information

LABORATORY FUNDAMENTALS IN BIOLOGICAL ENGINEERING. Leona Samson. MODULE 2 EXPRESSION ENGINEERING Lecture # 3.

LABORATORY FUNDAMENTALS IN BIOLOGICAL ENGINEERING. Leona Samson. MODULE 2 EXPRESSION ENGINEERING Lecture # 3. 20.109 LABORATORY FUNDAMENTALS IN BIOLOGICAL ENGINEERING MODULE 2 EXPRESSION ENGINEERING Lecture # 3 Leona Samson March 31 st 2009 Snapshot of the next four weeks We will eliminate the expression of various

More information

Exploration and Analysis of DNA Microarray Data

Exploration and Analysis of DNA Microarray Data Exploration and Analysis of DNA Microarray Data Dhammika Amaratunga Senior Research Fellow in Nonclinical Biostatistics Johnson & Johnson Pharmaceutical Research & Development Javier Cabrera Associate

More information

Computational Biology I

Computational Biology I Computational Biology I Microarray data acquisition Gene clustering Practical Microarray Data Acquisition H. Yang From Sample to Target cdna Sample Centrifugation (Buffer) Cell pellets lyse cells (TRIzol)

More information

Site directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha

Site directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha Site directed mutagenesis, Insertional and Deletion Mutagenesis Mitesh Shrestha Mutagenesis Mutagenesis (the creation or formation of a mutation) can be used as a powerful genetic tool. By inducing mutations

More information

Introduction to Bioinformatics: Chapter 11: Measuring Expression of Genome Information

Introduction to Bioinformatics: Chapter 11: Measuring Expression of Genome Information HELSINKI UNIVERSITY OF TECHNOLOGY LABORATORY OF COMPUTER AND INFORMATION SCIENCE Introduction to Bioinformatics: Chapter 11: Measuring Expression of Genome Information Jarkko Salojärvi Lecture slides by

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

Exome Sequencing Exome sequencing is a technique that is used to examine all of the protein-coding regions of the genome.

Exome Sequencing Exome sequencing is a technique that is used to examine all of the protein-coding regions of the genome. Glossary of Terms Genetics is a term that refers to the study of genes and their role in inheritance the way certain traits are passed down from one generation to another. Genomics is the study of all

More information

Capabilities & Services

Capabilities & Services Capabilities & Services Accelerating Research & Development Table of Contents Introduction to DHMRI 3 Services and Capabilites: Genomics 4 Proteomics & Protein Characterization 5 Metabolomics 6 In Vitro

More information

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template

More information

Biochemistry 412. DNA Microarrays. April 1, 2008

Biochemistry 412. DNA Microarrays. April 1, 2008 Biochemistry 412 DNA Microarrays April 1, 2008 Microarrays Have Led to an Explosion in mrna Profiling Studies Stolovitky (2003) Curr. Opin. Struct. Biol. 13, 370. Two Main Types of DNA Microarrays Grünenfelder

More information

Moc/Bio and Nano/Micro Lee and Stowell

Moc/Bio and Nano/Micro Lee and Stowell Moc/Bio and Nano/Micro Lee and Stowell Moc/Bio-Lecture GeneChips Reading material http://www.gene-chips.com/ http://trueforce.com/lab_automation/dna_microa rrays_industry.htm http://www.affymetrix.com/technology/index.affx

More information

Introduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics

Introduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics Introduction to Microarray Technique, Data Analysis, Databases Maryam Abedi PhD student of Medical Genetics abedi777@ymail.com Outlines Technology Basic concepts Data analysis Printed Microarrays In Situ-Synthesized

More information

Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility

Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility 2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,

More information

Lecture 22 Eukaryotic Genes and Genomes III

Lecture 22 Eukaryotic Genes and Genomes III Lecture 22 Eukaryotic Genes and Genomes III In the last three lectures we have thought a lot about analyzing a regulatory system in S. cerevisiae, namely Gal regulation that involved a hand full of genes.

More information

DNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center

DNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center DNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center Why DNA Chips? Functional genomics: get information about genes that is unavailable from sequence

More information

Biotechnology Chapter 20

Biotechnology Chapter 20 Biotechnology Chapter 20 DNA Cloning DNA Cloning AKA Plasmid-based transformation or molecular cloning First off-let s sum up what happens. A plasmid is taken from a bacteria A gene is inserted into the

More information

Class Information. Introduction to Genome Biology and Microarray Technology. Biostatistics Rafael A. Irizarry. Lecture 1

Class Information. Introduction to Genome Biology and Microarray Technology. Biostatistics Rafael A. Irizarry. Lecture 1 This work is licensed under a Creative Commons ttribution-noncommercial-sharelike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this

More information

Applications and Uses. (adapted from Roche RealTime PCR Application Manual)

Applications and Uses. (adapted from Roche RealTime PCR Application Manual) What Can You Do With qpcr? Applications and Uses (adapted from Roche RealTime PCR Application Manual) What is qpcr? Real time PCR also known as quantitative PCR (qpcr) measures PCR amplification as it

More information

Predicting Microarray Signals by Physical Modeling. Josh Deutsch. University of California. Santa Cruz

Predicting Microarray Signals by Physical Modeling. Josh Deutsch. University of California. Santa Cruz Predicting Microarray Signals by Physical Modeling Josh Deutsch University of California Santa Cruz Predicting Microarray Signals by Physical Modeling p.1/39 Collaborators Shoudan Liang NASA Ames Onuttom

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

LATE-PCR. Linear-After-The-Exponential

LATE-PCR. Linear-After-The-Exponential LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,

More information

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc. Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers

More information

2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes?

2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes? 2/5/16 DNA sequencing, Transcriptomics and Genomics Honeypot Ants "nequacatl" BY2208, Mani Lecture 3 Gene sequence changes? And/or gene expression changes? gene expression differences DNA sequencing, Transcriptomics

More information

NimbleGen Arrays and LightCycler 480 System: A Complete Workflow for DNA Methylation Biomarker Discovery and Validation.

NimbleGen Arrays and LightCycler 480 System: A Complete Workflow for DNA Methylation Biomarker Discovery and Validation. Cancer Research Application Note No. 9 NimbleGen Arrays and LightCycler 480 System: A Complete Workflow for DNA Methylation Biomarker Discovery and Validation Tomasz Kazimierz Wojdacz, PhD Institute of

More information

Biochemistry 412. DNA Microarrays. March 30, 2007

Biochemistry 412. DNA Microarrays. March 30, 2007 Biochemistry 412 DNA Microarrays March 30, 2007 Put a hex on you! Saturn s north pole, as seen from the Cassini spacecraft http://saturn.jpl.nasa.gov/multimedia/images/index.cfm Microarrays Have Led to

More information

Today s Topic: Microarrays. but first, student slides from HW

Today s Topic: Microarrays. but first, student slides from HW Today s Topic: Microarrays but first, student slides from HW Back to Microarrays (Reference: Zvelebil and Baum 2008, chap. 15) We refer specifically to DNA microarrays DNA: deoxyribonucleic acid microarray:

More information

Please purchase PDFcamp Printer on to remove this watermark. DNA microarray

Please purchase PDFcamp Printer on  to remove this watermark. DNA microarray DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of

More information

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction Variations of PCR in the Diagnostic Lab The most common variations of standard PCR used in the diagnostic laboratory are: Reverse Transcriptase PCR (RT-PCR) Nested PCR (n-pcr)

More information

Using Lower Amounts of RNA for GE Microarray Experiments

Using Lower Amounts of RNA for GE Microarray Experiments Welcome to our E-Seminar: Using Lower Amounts of RNA for GE Microarray Experiments Chairperson: Rita Willis Slide 1 Labeling RNA for Microarray Experiments Outline Introduction Labeling, Amplification

More information

11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11

11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11 Proteomics, functional genomics, and systems biology Biosciences 741: Genomics Fall, 2013 Week 11 1 Figure 6.1 The future of genomics Functional Genomics The field of functional genomics represents the

More information

Methods for Working with DNA and RNA

Methods for Working with DNA and RNA Methods for Working with DNA and RNA 1. Gel electrophoresis A. Materials: agarose (large DNAs) vs. acrylamide (high resolution, DNA sequencing) B. Separated by its sieving property and charge: both are

More information

Factors for consideration in developing research initiatives for DNA microarray development and experimentation.

Factors for consideration in developing research initiatives for DNA microarray development and experimentation. Factors for consideration in developing research initiatives for DNA microarray development and experimentation. Robert Fleischmann and Scott Peterson The Institute for Genomic Research The recent development

More information

Background Analysis and Cross Hybridization. Application

Background Analysis and Cross Hybridization. Application Background Analysis and Cross Hybridization Application Pius Brzoska, Ph.D. Abstract Microarray technology provides a powerful tool with which to study the coordinate expression of thousands of genes in

More information

Microarrays The technology

Microarrays The technology Microarrays The technology Goal Goal: To measure the amount of a specific (known) DNA molecule in parallel. In parallel : do this for thousands or millions of molecules simultaneously. Main components

More information

Single-Cell. Defy the Law of Averages

Single-Cell. Defy the Law of Averages Single-Cell AnalysiS Defy the Law of Averages An entirely new approach Single-Cell AnalysiS that Defies the Law of Averages Get Accurate, Reliable Gene expression Data with the fluidigm Single-Cell Workflow

More information

Quantitative Real Time PCR USING SYBR GREEN

Quantitative Real Time PCR USING SYBR GREEN Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to

More information

Human Genomics. Higher Human Biology

Human Genomics. Higher Human Biology Human Genomics Higher Human Biology Learning Intentions Explain what is meant by human genomics State that bioinformatics can be used to identify DNA sequences Human Genomics The genome is the whole hereditary

More information

Announcements. Lecture 2: DNA Microarray Overview. Gene Expression: The Central Dogma. Talks. Go to class web page

Announcements. Lecture 2: DNA Microarray Overview. Gene Expression: The Central Dogma. Talks. Go to class web page Announcements Lecture 2: DNA Microarray Overview Go to class web page http://www.cs.washington.edu/527 Add yourself to class list Check out HW1, including last year s (Some slides from Dr. Holly Dressman,

More information

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8 Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically

More information

Intro to Microarray Analysis. Courtesy of Professor Dan Nettleton Iowa State University (with some edits)

Intro to Microarray Analysis. Courtesy of Professor Dan Nettleton Iowa State University (with some edits) Intro to Microarray Analysis Courtesy of Professor Dan Nettleton Iowa State University (with some edits) Some Basic Biology Genes are DNA sequences that code for proteins. (e.g. gene lengths perhaps 1000

More information

Q-PCR QUANTITATIVE-PCR 세포생물학및실험 2 박태식교수님

Q-PCR QUANTITATIVE-PCR 세포생물학및실험 2 박태식교수님 Q-PCR QUANTITATIVE-PCR 세포생물학및실험 2 박태식교수님 Title : Study that the Drug A inhibits the accumulation of fat. Schedules 1. Mouse necropsy : take up the blood and major tissues(organs) ex) heart, liver, fat,

More information