Comparison of 3 labeling and amplification protocols: for total RNA labeling, amplification, and Affymetrix GeneChip expression (last updated 9/26/05)
|
|
|
- Barnard Fletcher
- 6 years ago
- Views:
Transcription
1 Comparison of 3 labeling and amplification protocols: for total RNA labeling, amplification, and Affymetrix GeneChip expression (last updated 9/26/05) Purpose: to compare 3 of the commercially available total RNA labeling and amplification protocols for Affymetrix expression arrays. The 3 protocols studied were the GeneChip Expression 3 - Amplification protocol by Affymetrix, the MessageAmp II-Biotin Enhanced protocol by Ambion, and the Ovation Biotin System by NuGEN. Background: in addition to a significant decrease in the cost per labeling reaction for a single round amplification, the Ambion protocol claims to generate increased crna yields while requiring less starting total RNA when compared to the Affymetrix protocol. The NuGEN protocol requires significantly less starting total RNA than both the Affymetrix and Ambion protocols but, unlike the other 2 protocols, generates cdna for hybridization to Affymetrix GeneChips rather than crna.
2 Project Outline 6 PaxGene tubes drawn from each of 2 normal blood donors, total RNA extraction, removal of globin mrna using the Ambion Globinclear kit, labeling reactions for Affymetrix, Ambion, and NuGEN (both globin reduced and non-globin reduced samples), hybridized to custom designed GeneChips The Ambion protocol potentially presents an option of starting with as little as 500ng total RNA to generate enough crna to put on a standard Affymetrix GeneChip compared to the 5ug of total RNA we normally use for the Affymetrix protocol. The NuGEN protocol present an option of starting with as little as 5ng of total RNA to generate enough single stranded cdna to put on a standard Affymetrix GeneChip. Ambion s GLOBINclear-Human Kit is designed to rapidly deplete alpha and beta globin mrna from total RNA preparations derived from human whole blood. RNA samples processed with the GLOBINclear-Human Kit demonstrate improved RNA expression profiling because the depletion procedure alleviates problems associated with the abundant globin mrna found in whole blood RNA samples. Blood Donor (2 donors) 6 PAXgene Tubes each total RNA extraction globin reduction (Ambion Globinclear) The PAXgene Blood RNA Kit allows the isolation of total RNA from 2.5ml human whole blood samples collected in PAXgene Blood RNA tubes. PreAnalytiX developed the PAXgene Blood RNA System to enable the collection, stabilization, and transportation of whole blood specimens, and the rapid and efficient efficient isolation of cellular RNA. Affymetrix protocol Ambion protocol NuGEN protocol 0.5ug 1ug 5ug 0.5ug 1ug 5ug 25ng globin reduced 5ng globin reduced 25ng non-globin reduced 5ng non-globin reduced GeneChip GeneChip GeneChip GeneChip GeneChip GeneChip GeneChip GeneChip GeneChip GeneChip
3 GeneChip info The GeneChips used in this experiment were custom designed arrays from another project known as the Glue grant and are referred to as GLYCOv1 GeneChips. Info regarding the Glue grant is as follows: Title Consortium for Functional Glycomics Funded by National Institute of General Medical Sciences Grant Number 1R24 GM PI James Paulson Website to Version1 info -
4 PAXgene Tube RNA Extraction Sample Conc. (ng/ul) 260/280 Vol. (ul) total RNA Yield (ug) Donor 1 Tube A Donor 1 Tube B Donor 1 Tube C Donor 1 Tube D Donor 1 Tube E Donor 1 Tube F Donor 2 Tube A Donor 2 Tube B Donor 2 Tube C Donor 2 Tube D Donor 2 Tube E Donor 2 Tube F total RNA from Donor 1 Tube F and Donor 2 Tube A left for non-globin reduced NuGEN protocol. Remaining samples pooled for globin reduction. Typical total RNA yields for the PAXgene Tube system range from 4-7ug total RNA per tube.
5 RNA Yield after Globin Reduction Sample Conc. (ng/ul) 260/280 Vol. (ul) globin reduced total RNA Yield (ug) Donor 1 (starting amount: 27.9ug) Donor 2 (starting amount: 21.1ug) ug, 1ug, and 5ug aliquots created for both Affymetrix and Ambion protocols for both donors after completion of globin reduction. Globin reduction typically reduces total RNA starting amounts by 30%.
6 Agilent BioAnalyzer Results for globin reduced total RNA Agilent BioAnalyzer chips are used as our main form of quality control for RNA. 250ng aliquots of globin reduced total RNA were isolated for each donor prior to labeling and run on an Agilent BioAnalyzer chip. BioAnalyzer profiles show a slight degree of degradation typically not seen, but profiles remain of high enough quality to continue continue with protocols.
7 Typical Agilent BioAnalyzer Result for globin reduced total RNA The above BioAnalyzer profile is more typical of the quality of total RNA post globin reduction. Such a profile shows less degradation than was seen in the profiles of the total RNA from this experiment in the previous slide.
8 Ambion labeling arna yields Sample Conc. (ng/ul) 260/280 Vol. (ul) arna Yield (ug) Donor 1 (0.5ug) Donor 1 (1ug) Donor 1 (5ug) Donor 2 (0.5ug) Donor 2 (1ug) Donor 2 (5ug) Ambion refers to antisense amplified RNA as arna, although it is also commonly called crna. In our experience these results represent typical arna yields. arna yields show a relationship between increased yield and increased starting amount.
9 Affymetrix Labeling crna yields Sample Conc. (ng/ul) 260/280 Vol. (ul) crna Yield (ug) Donor 1 (0.5ug) Donor 1 (1ug) Donor 1 (5ug) Donor 2 (0.5ug) Donor 2 (1ug) Donor 2 (5ug) Unlike the Ambion protocol, the Affymetrix protocol was unable to generate more than 5ug of crna for the (0.5ug) and (1ug) samples for both donors. Ultimately, only the 5ug samples for each patient generated enough crna to be hybridized to GeneChips.
10 Agilent BioAnalyzer Results for Affymetrix and Ambion crna 250ng aliquots were isolated for each crna sample to be hybridized to a GeneChip and run on an Agilent BioAnalyzer chip. The unusual peak in sample Donor 1 (1ug) Ambion is attributed to an air bubble in the well. All BioAnalyzer profiles indicated amplified RNA of quality high enough to hybridize to a GeneChip.
11 NuGEN sample results cdna (pre-frag) Fragmented & Labeled cdna Sample total RNA Input (ng) Conc. (ng/ul) cdna Yield (ug) Donor 1 gr (gr = globin reduced) cdna Input (ng) Conc. (ng/ul) cdna Yield (ug) Donor 1 gr % Recovery Donor 1 ngr (ngr = non-globin reduced) Donor 1 ngr Donor 2 gr Donor 2 gr Donor 2 ngr Donor 2 ngr Unlike the Ambion and Affymetrix protocols which generate crna, the NuGEN protocol hybridizes cdna. Due to the increased efficiency in hybridization of cdna compared to crna, standard Affymetrix GeneChips require only 2.2ug of cdna for hybridization. For the purposes of this experiment, 1.5ug of cdna from each sample was hybridized to GeneChips.
12 Agilent BioAnalyzer Results for pre-frag NuGEN samples Prior to fragmenting and labeling, 250ng of each sample was isolated and run on an Agilent BioAnalyzer chip. BioAnalyzer profiles showed cdna of high enough quality to continue with fragmenting and labeling.
13 Agilent BioAnalyzer Results for fragmented NuGEN samples 250ng of each sample to be hybridized to a GeneChip was isolated and run on an Agilent BioAnalyzer chip. BioAnalyzer profiles showed cdna of high enough quality to continue with hybridization.
14 GeneChip scan results Sample Background Noise % Present 3-5 ratios for GAPDH 3-5 ratios for Actin Scale Factor Donor 1 (5ug) Affymetrix Donor 2 (5ug) Affymetrix Donor 1 (0.5ug) Amb Donor 1 (1ug) Amb % present values are consistent with this custom designed Donor 1 (5ug) Amb GeneChip Donor 2 (0.5ug) Amb Donor 2 (1ug) Amb Donor 2 (5ug) Amb Donor 1 gr 25ng Donor 1 gr 5ng Donor 1 ngr 25ng Donor 1 ngr 5ng Donor 2 gr 25ng Donor 2 gr 5ng Donor 2 ngr 25ng Donor 2 ngr 5ng
15 Conclusions crna yields show the Ambion protocol to be capable of generating enough crna to put on a standard Affymetrix GeneChip from as little as 500ng total RNA. GeneChip quality control results show the Ambion protocol to generate lower background and noise values, higher percent present values, and lower ratio values when compared to the Affymetrix protocol. Thus, the Ambion protocol presents itself as a viable alternative to the Affymetrix protocol. Although the samples processed with the NuGEN protocol show consistently lower percent present values, the NuGEN protocol shows promise in the fact that enough cdna can be generated to put on a standard Affymetrix GeneChip from as little as 5ng starting total RNA. A recent paper from the BMC Genomics journal entitled Increased DNA microarray hybridization specificity using sscdna target shows shows further validation of the NuGEN protocol and may be found at:
T7-Based RNA Amplification Protocol (in progress)
T7-Based RNA Amplification Protocol (in progress) Jacqueline Ann Lopez (modifications) Amy Cash & Justen Andrews INTRODUCTION T7 RNA Amplification, a technique originally developed in the laboratory of
DNA Microarray Technology
CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic
Sample Flexibility for Gene Expression Analysis with the ncounter Analysis System
Technical Note Sample Flexibility for Gene Expression Analysis with the ncounter Analysis System Sensitive Gene Expression Analysis From Crude Preparations and Fragmented RNA Cell Lysates Tissue Homogenates
SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit
SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit Agenda SOLiD Total RNAseq Kit Overview Kit Configurations Barcoding Kit Introduction New Small RNA and WT Workflow Small RNA Workflow Step-by-step Workflow
GeneChip Eukaryotic Small Sample Target Labeling Assay Version II *
GENE EXPRESSION MONITORING TECHNICAL NOTE GeneChip Eukaryotic Small Sample Target Labeling Assay Version II * Introduction There is an overwhelming and continuing demand for a well characterized protocol
Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application
Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,
DNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
Validation Study of FUJIFILM QuickGene System for Affymetrix GeneChip
Validation Study of FUJIFILM QuickGene System for Affymetrix GeneChip Reproducibility of Extraction of Genomic DNA from Whole Blood samples in EDTA using FUJIFILM membrane technology on the QuickGene-810
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
Gene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
PROTOCOL. Amino Allyl MessageAmp II arna Amplification Kit
PROTOCOL Amino Allyl MessageAmp II arna Amplification Kit For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without
PAXgene Blood DNA PAXgene Blood DNA Tube (IVD) for clinical use PAXgene Blood DNA System (RUO) for research use. Explore more at
PAXgene Blood DNA PAXgene Blood DNA Tube (IVD) for clinical use PAXgene Blood DNA System (RUO) for research use Explore more at www.preanalytix.com Situation The composition, amount, quality and integrity
AFFYMETRIX GENECHIP HYBRIDIZATION ANALYSIS (Updated: April 19, 2007) Experimental Organs:
Date: AFFYMETRIX GENECHIP HYBRIDIZATION ANALYSIS (Updated: April 19, 2007) Experimental Organs: Note: This protocol is slightly modified from the general protocol for the biotin-labeled cdna generated
User Manual. GeneChip WT PLUS Reagent Kit Manual Target Preparation for GeneChip Whole Transcript (WT) Expression Arrays
User Manual GeneChip WT PLUS Reagent Kit Manual Target Preparation for GeneChip Whole Transcript (WT) Expression Arrays For Research Use Only. Not for use in diagnostic procedures. P/N 703174 Rev. 2 Trademarks
Globin Block Modules for QuantSeq Instruction Manual
Globin Block Modules for QuantSeq Instruction Manual Catalog Numbers: 070 (RS-Globin Block, Homo sapiens, 96 rxn) 071 (RS-Globin Block, Sus scrofa, 96 rxn) 015 (QuantSeq 3 mrna-seq Library Prep Kit for
Section 2: Eukaryotic Sample and Array Processing Rev. 3
Section 2: Eukaryotic Sample and Array Processing 701024 Rev. 3 Section 2 Contents Section 2 Eukaryotic Sample and Array Processing Chapter 1 Eukaryotic Target Preparation 2.1.3 Eukaryotic Chapter 2 Eukaryotic
Introduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
BLOOD, PLASMA & SERUM SAMPLE PREPARATION
BLOOD, PLASMA & SERUM SAMPLE PREPARATION The New Standard in RNA Purification, Best-in-Class, Pure & Simple Collection, preservation & isolation of inhibitor-free RNA, microrna and genomic DNA for any
Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract
Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer Application Note Odilo Mueller Abstract This application note describes how the Agilent Technologies 2100 bioanalyzer can be used
GeneChip TM WT PLUS Reagent Kit Manual Target Preparation for GeneChip TM Whole Transcript (WT) Expression Arrays
GeneChip TM WT PLUS Reagent Kit Manual Target Preparation for GeneChip TM Whole Transcript (WT) Expression Arrays UserGuide For support visit thermofisher.com/support or email techsupport@lifetech.com
Microarrays: since we use probes we obviously must know the sequences we are looking at!
These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression
USER GUIDE. Ovation RNA Amplification System V2 PART NO , , 3100-A01
USER GUIDE Ovation RNA Amplification System V2 PART NO. 3100-12, 3100-60, 3100-A01 Patents, Licensing and Trademarks 2009 2016 NuGEN Technologies, Inc. All rights reserved. The Encore, Ovation and Applause
NanoString Assay Sample Type Assay Input Amount Required Sample Amount/Concentration Total RNA 100ng no less than 150ng, normalized to 20ng/µl
High quality ncounter data is achieved with high quality starting material. The guidelines set forth in this document will assist you in preparing your samples for your NanoString run. Please adhere to
FACTORS CONTRIBUTING TO VARIABILITY IN DNA MICROARRAY RESULTS: THE ABRF MICROARRAY RESEARCH GROUP 2002 STUDY
FACTORS CONTRIBUTING TO VARIABILITY IN DNA MICROARRAY RESULTS: THE ABRF MICROARRAY RESEARCH GROUP 2002 STUDY K. L. Knudtson 1, C. Griffin 2, A. I. Brooks 3, D. A. Iacobas 4, K. Johnson 5, G. Khitrov 6,
TECHNICAL BULLETIN. SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies. Catalog Number SEQX Storage Temperature 20 C
SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies Catalog Number SEQX Storage Temperature 20 C TECHNICAL BULLETIN Product Description The SeqPlex DNA Amplification Kit
PROTOCOL. MessageAmp II-Bacteria Kit
PROTOCOL MessageAmp II-Bacteria Kit For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED
Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
Arcturus Turbo Labeling Kit Biotin, Cy 3, Cy
Arcturus Turbo Labeling Kit Biotin, Cy 3, Cy 5 Dyes User Guide For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change
DNA Microarray Data Oligonucleotide Arrays
DNA Microarray Data Oligonucleotide Arrays Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang Bioconductor Short Course 2003 Copyright 2002, all rights reserved Biological question Experimental
USER GUIDE. Ovation PART NO One-Direct System
USER GUIDE Ovation PART NO. 3500 One-Direct System Patents, Licensing and Trademarks 2009 2014 NuGEN Technologies, Inc. All rights reserved. The Encore, Ovation and Applause families of products and methods
Laboratory #7 PCR PCR
1 Laboratory #7 Polymerase chain reaction () is DNA replication in a test tube. In vitro enzymatic amplification of a specific segment of DNA. Many Applications. direct cloning from DNA or cdna. Mutagenesis
Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
Affymetrix Processing of ChIP or DamID DNA to GeneChip Drosophila Tiling 2.0R Array
http://www.flychip.org.uk/affy_chip.php Affymetrix Processing of ChIP or DamID DNA to GeneChip Drosophila Tiling 2.0R Array Outline For the following protocol 7.5 µg DNA containing dutp (see the corresponding
GeneChip TM WT Terminal Labeling and Hybridization User Manual
GeneChip TM WT Terminal Labeling and Hybridization User Manual for use with the Ambion TM WT Expression Kit User Manual For Research Use Only. Not for use in diagnostic procedures. Information in this
Subtractive hybridization is a powerful technique particularly well-suited for the identification of target cdnas that correspond to rare
Subtractive hybridization is a powerful technique particularly well-suited for the identification of target cdnas that correspond to rare transcripts, that are expressed in one population but not in the
What is a microarray
DNA Microarrays What is a microarray A surface on which sequences from thousands of different genes are covalently attached to fixed locations (probes). Glass slides Silicon chips Utilize the selective
STATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays. Materials are from
STATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays Materials are from http://www.ohsu.edu/gmsr/amc/amc_technology.html The GeneChip high-density oligonucleotide arrays are fabricated
Student Learning Outcomes (SLOS)
Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get
PCR Array FAQ s. PCR Arrays: Placing an order
PCR Array FAQ s PCR Arrays: Placing an order What PCR Array services does the facility provide? The DNA Analysis Facility provides support for gene expression studies using PCR Array technology from a
AdnaTest ProstateCancerDetect
AdnaTest ProstateCancerDetect RT-PCR Kit for detection of prostate cancer associated gene expression in enriched tumor cells For diagnostic use Manual T-1-521 Contents Order Information... 3 Purpose...
Performance characteristics of the High Sensitivity DNA kit for the Agilent 2100 Bioanalyzer
Performance characteristics of the High Sensitivity DNA kit for the Agilent 2100 Bioanalyzer Technical Note 10 Measured conc. [ng/µl] 1 Y intercept = 0.09 r 2 = 0.993 0.1 0.1 1 10 Reference concentration
NanoString Sample Submission Guidelines
High quality ncounter data is achieved with high quality starting material. The guidelines set forth in this document will assist you in preparing your samples for your NanoString run. Please adhere to
KREATECH DIAGNOSTICS ULS LABELING PRODUCTS
KREATECH DIAGNOSTICS ULS LABELING PRODUCTS ULS UNIVERSAL LINKAGE SYSTEM: THE SMARTER WAY FOR TARGET LABELING THE ULS LABELING TECHNOLOGY The proprietary ULS (Universal Linkage System) technology provides
P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
Tech Note. Using the ncounter Analysis System with FFPE Samples for Gene Expression Analysis. ncounter Gene Expression. Molecules That Count
ncounter Gene Expression Tech Note Using the ncounter Analysis System with FFPE Samples for Gene Expression Analysis Introduction For the past several decades, pathologists have kept samples obtained from
Microarray Protocol for Agilent Inkjet-Deposited Presynthesized Oligo Arrays Aminoallyl Method AfCS Procedure Protocol PP Version 1, 10/20/03
Microarray Protocol for Agilent Inkjet-Deposited Presynthesized Oligo Arrays AfCS Procedure Protocol PP00000184 Version 1, 10/20/03 The following procedure details the preparation of fluorescently labeled
Supplemental File 1: Modified Nextera XT DNA Sample Preparation Guide (Illumina, USA, Part # rev. C, October 2012).
Supplemental File 1: Modified Nextera XT DNA Sample Preparation Guide (Illumina, USA, Part # 15031942 rev. C, October 2012). Required Kit content: Box1 ATM Amplicon Tagment Mix TD Tagment DNA Buffer NPM
RNA SEQUINS LABORATORY PROTOCOL
INSTRUCTIONS FOR ADDITION OF SEQUINS TO RNA SAMPLES (for use with RNA sequins version 2) RNA Sequins are designed, validated and manufactured at the Garvan Institute of Medical Research, Sydney Australia.
TURBO DNA-free Kit. A. Product Description. TURBO DNase Treatment and Removal Reagents Part Number AM1907
REVISED 4/2009 TURBO DNA-free Kit Inactivation time extended in step 4 on page 7. TURBO DNase Treatment and Removal Reagents Part Number AM1907 A. Product Description Ambion TURBO DNA-free DNase Treatment
2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes?
2/5/16 DNA sequencing, Transcriptomics and Genomics Honeypot Ants "nequacatl" BY2208, Mani Lecture 3 Gene sequence changes? And/or gene expression changes? gene expression differences DNA sequencing, Transcriptomics
Global Expression Profiling of RNA from Laser Microdissected Cells at Fungal Plant Interaction Sites
Chapter 20 Global Expression Profiling of RNA from Laser Microdissected Cells at Fungal Plant Interaction Sites Divya Chandran, Greg Hather, and Mary C. Wildermuth Abstract Global expression profiling
Agilent RNA Spike-In Kit
Agilent RNA Spike-In Kit Agilent RNA Spike-In Kit Product Number 5188-5279 Introduction The Agilent RNA Spike-In Kit was developed to provide positive controls for monitoring the microarray workflow from
Data Sheet. GeneChip Human Genome U133 Arrays
GeneChip Human Genome Arrays AFFYMETRIX PRODUCT FAMILY > ARRAYS > Data Sheet GeneChip Human Genome U133 Arrays The Most Comprehensive Coverage of the Human Genome in Two Flexible Formats: Single-array
USER GUIDE. Universal Plus mrna-seq PART NO. 0508, 9133, 9134
USER GUIDE PART NO. 0508, 9133, 9134 Patents, Licensing and Trademarks 2017 NuGEN Technologies, Inc. All rights reserved. The Encore, Ovation and Applause families of products and methods of their use
Please purchase PDFcamp Printer on to remove this watermark. DNA microarray
DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of
Gene Expression on the Fluidigm BioMark HD
Gene Expression on the Fluidigm BioMark HD Overview Introduction to Fluidigm James Miller Advantages of the technology Running a Fluidigm gene expression project Paul Lacaze Assay design, chemistry, experimental
DNA Workflow. Marine Biological Laboratory. Mark Bratz Applications Scientist, Promega Corporation. August 2016
DNA Workflow Marine Biological Laboratory Mark Bratz Applications Scientist, August 2016 Scientific Applications Support Mission Realize customer driven applications of Promega technologies to enhance
Roche Molecular Biochemicals Technical Note No. LC 9/2000
Roche Molecular Biochemicals Technical Note No. LC 9/2000 LightCycler Optimization Strategy Introduction Purpose of this Note Table of Contents The LightCycler system provides different detection formats
Microarray Technique. Some background. M. Nath
Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique
RNA SEQUINS LABORATORY PROTOCOL
INSTRUCTIONS FOR ADDITION OF SEQUINS TO RNA SAMPLES RNA Sequins are designed, validated and manufactured at the Garvan Institute of Medical Research, Sydney Australia. For Research Use Only. Not intended
Standard Products Nucleic Acid Sample Submission Guideline
Standard Products Nucleic Acid Sample Submission Guideline Document NO.: Version NO.: SOP-SMM-028 A1 Effective Date: 2018-1-3 Document NO.:SOP-SMM-028 Version NO.:A1 Page 1 of 19 CONTETS ABOUT THIS GUIDELINE...
Lecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
RNA 004 v.003 Assessing the quality of RNA using the Agilent 2100 Bioanalyzer
Immune Tolerance Network RNA 004 v.003 Author: Svetlana Kolchinsky, Assay Specialist Approved by: Katarzyna Bourcier, PhD, Assoc. Director of Assay Development 1.0 Title Assessing the Quality of RNA Using
GeneChip Expression Analysis Technical Manual For HT Array Plates Using the GeneChip Array Station
GeneChip Expression Analysis Technical Manual For HT Array Plates Using the GeneChip Array Station P/N 702063 Rev. 2 For research use only. Not for use in diagnostic procedures. Trademarks Affymetrix,
Outline. Array platform considerations: Comparison between the technologies available in microarrays
Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation
Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
Intro to Microarray Analysis. Courtesy of Professor Dan Nettleton Iowa State University (with some edits)
Intro to Microarray Analysis Courtesy of Professor Dan Nettleton Iowa State University (with some edits) Some Basic Biology Genes are DNA sequences that code for proteins. (e.g. gene lengths perhaps 1000
AmpliScribe T 7 Aminoallyl-RNA Transcription Kit
Cat. No. AA50125 The AmpliScribe T7 Aminoallyl-RNA Transcription Kit enables high-yield production of aminoallyl-labeled RNA. The kit utilizes Epicentre s high yielding AmpliScribe T7-Flash in vitro transcription
WT-Ovation Pico RNA Amplification System VERSION 1.0 Catalog #
WT-Ovation Pico RNA Amplification System VERSION 1.0 Catalog # 3300-12 USER GUIDE WT-Ovation Pico System v1.0 www.nugeninc.com i User Guide cat. #D01010 WT-Ovation Pico System v1.0 www.nugeninc.com ii
3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
SideStep Lysis and Stabilization Buffer
SideStep Lysis and Stabilization Buffer INSTRUCTION MANUAL Catalog #400900 Revision B.0 For Research Use Only. Not for use in diagnostic procedures. 400900-12 LIMITED PRODUCT WARRANTY This warranty limits
New Stringent Two-Color Gene Expression Workflow Enables More Accurate and Reproducible Microarray Data
Application Note GENOMICS INFORMATICS PROTEOMICS METABOLOMICS A T C T GATCCTTC T G AAC GGAAC T AATTTC AA G AATCTGATCCTTG AACTACCTTCCAAGGTG New Stringent Two-Color Gene Expression Workflow Enables More
Microarray Gene Expression Analysis at CNIO
Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples
BEST PRACTICES IN MOUSE TISSUE SAMPLE PREPARATION FOR RNA EXTRACTION WITH PRECELLYS EVOLUTION
BEST PRACTICES IN MOUSE TISSUE SAMPLE PREPARATION FOR RNA EXTRACTION WITH PRECELLYS EVOLUTION The lab mouse is the most commonly used mammalian model system for genetic research. Scientists from a wide
Quality of Cancer RNA Samples Is Essential for Molecular Classification Based on Microarray Results Application
Quality of Cancer RNA Samples Is Essential for Molecular Classification Based on Microarray Results Application Pathology Author Jenny Xiao Agilent Technologies, Inc. Deer Creek Road MC U-7 Palo Alto,
B r1 US M
References: 1. Van Gelder, R.N. et al. (1990) Proc Natl Acad Sci USA 87: 1663-1667 2. Cox and Singer (2004) Biotechniques 36 (1): 114 3. Cox, et al. (2004) Analytical Biochemistry 331(2): 243-254 4. Ståhlberg
RNA/cDNA Quality Assay User Manual
.Clontech Laboratories, Inc. RNA/cDNA Quality Assay User Manual (PR0X3688) Cat. No. 636841 Published 1/19/2011 Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA
Illumina TotalPrep -96 RNA Amplification Kit
Illumina TotalPrep -96 RNA Amplification Kit High-Throughput RNA Amplification for Array Analysis Part Number 4393543 Illumina TotalPrep -96 RNA Amplification Kit (Part Number 4393543) Protocol I. Introduction.......................................................
Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
Introduction to Bioinformatics. Fabian Hoti 6.10.
Introduction to Bioinformatics Fabian Hoti 6.10. Analysis of Microarray Data Introduction Different types of microarrays Experiment Design Data Normalization Feature selection/extraction Clustering Introduction
Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays
Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Application Note Authors Bahram Arezi, Nilanjan Guha and Anne Bergstrom Lucas Agilent Technologies Inc. Santa
ProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2.
DNA AMPLIFICATION & PCR ProtoScript First Strand cdna Synthesis Kit Instruction Manual NEB #E6300S/L 30/150 reactions Version 2.2 11/16 be INSPIRED drive DISCOVERY stay GENUINE This product is intended
Full-length single-cell RNA-seq applied to a viral human. cancer: Applications to HPV expression and splicing analysis. Supplementary Information
Full-length single-cell RNA-seq applied to a viral human cancer: Applications to HPV expression and splicing analysis in HeLa S3 cells Liang Wu 1, Xiaolong Zhang 1,2, Zhikun Zhao 1,3,4, Ling Wang 5, Bo
Illumina TruSeq RNA Access Library Prep Kit Automated on the Biomek FX P Dual-Hybrid Liquid Handler
Illumina TruSeq RNA Access Library Prep Kit Automated on the Biomek FX P Dual-Hybrid Liquid Handler Introduction David Horvath, M.S., Senior Applications Scientist, Beckman Coulter, Inc.; Tim Hill, Scientist,
Amplification and Labeling of DNA for Microarray Hybridization, using the Round A/B/C Random DNA Amplification Protocol
Amplification and Labeling of DNA for Microarray Hybridization, using the Round A/B/C Random DNA Amplification Protocol Goal: To amplify and label DNA prior to hybridization to a microarray, in a relatively
Relative Quantification (Mono-Color) Unknown samples (purified total RNA, mrna or cdna or genomic DNA)
The LightCycler 480 System Short Guide Topic: Purpose: Assay Principle: Detection Format: Result: Relative Quantification (Mono-Color) Describes how to set up and perform mono-color Relative Quantification
Molecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
10 RXN 50 RXN 500 RXN
SeqPlex Enhanced DNA Amplification Kit for use with high throughput sequencing technologies Catalog Number SEQXE Storage Temperature 20 C TECHNICAL BULLETIN Product Description The SeqPlex DNA Amplification
Amplicon Sequencing Template Preparation
Amplicon Sequencing Template Preparation The DNA sample preparation procedure for Amplicon Sequencing consists of a simple PCR amplification reaction, but uses special Fusion Primers (Figure 1-1). The
PreAnalytiX Supplementary Protocol
PreAnalytiX Supplementary Protocol Purification of total RNA from microdissected PAXgene Tissue fixed, paraffin-embedded (PFPE) and PAXgene Tissue fixed, cryo-embedded (PFCE) tissues This protocol is for
Microarray-based comparison of three amplification methods for nanogram amounts of total RNA
Am J Physiol Cell Physiol 288: C1179 C1189, 2005. First published December 22, 2004; doi:10.1152/ajpcell.00258.2004. CALL FOR PAPERS Methods in cell physiology Microarray-based comparison of three amplification
GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual
GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000
SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.
SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture
Optimize Your qpcr and RT-qPCR Assays with Careful Planning and Design
Optimize Your qpcr and RT-qPCR Assays with Careful Planning and Design Nadine Nassif, January 2013 Outline Real-Time PCR overview / Understanding qpcr data qpcr detection strategies: dye-based versus label-based
AMV First Strand cdna Synthesis Kit
DNA AMPLIFICATION & PCR AMV First Strand cdna Synthesis Kit Instruction Manual NEB #E6550S Store at 20 C ISO 9001 Registered Quality Management ISO 14001 Registered Environmental Management ISO 13485 Registered
REAL TIME PCR USING SYBR GREEN
REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM
For Research Use Only Ver
INSTRUCTION MANUAL ZR-Duet DNA/RNA MiniPrep Plus Catalog No. D7003 Highlights Efficient isolation and separation of DNA and RNA from any cells, tissue, blood, and biological fluids. High quality DNA and
MMX Lab, University of Helsinki 1-21 March 2012
RNA - DNA Extraction and Expression of Antibiotic Resistance Genes The Research Background It has been observed that antibiotic resistance genes are persistent in the sediment below aquaculture farms even
Table 1.1. Reagents Preparation Reagent Temp Out of Module* Treatment Store before using in Master Mix
Quick Reference Card Axiom Manual Target Prep Protocol Stage 1: DNA Amplification Intro to Manual Target Preparation Running the Axiom Assay requires the following sets of steps: 1. Genomic DNA Prep, described