What is a microarray

Size: px
Start display at page:

Download "What is a microarray"

Transcription

1 DNA Microarrays

2 What is a microarray A surface on which sequences from thousands of different genes are covalently attached to fixed locations (probes). Glass slides Silicon chips Utilize the selective nature of DNA-DNA or DNA-RNA hybridization

3 Types of microarrays Probe Manufacture Spotted Arrays DNA probes are synthesized and then spotted onto the microarray Customized for each experiment in-lab Low cost Oligonucleotide microarrays DNA oligonucleotides are synthezised directly on the microarray Commercial arrays (Affymetrix, Nimblegen and Combimatrix) expensive Detection Two-color detection Spotted Array: Compare two samples by labeling with two different flurophores and analyzing on the same array Cy5 (red) and Cy3 (green) One-color detection Determine gene expression level One array per sample

4 Phosphoramidite chemistry Stable = can actually be shipped High coupling yield Synthesis on a solid support Monomer addition Still a manual method, not consistent Faster cycle time of 20 minutes Using some nasty reagents (e.g. DMAP, DMF, Thiophenol) Very cyclical and repetitive = not fun

5 Coupling efficiency 100 % 50 % Phosphoramidite chemistry at 98% coupling efficiency 0 % 10 bases 20 bases

6 Solid Phase Synthesis Controlled Pore Glass (CPG) support covalently linked with one of the four nucleosides Reactive groups of nucleosides are blocked or protected to prevent unwanted side reactions DNA synthesis occurs by connecting nucleoside monomers one at a time to the 5' end of growing chain (3' to 5' end) DNA chain is cleaved from the support by ammonia treatment

7 Solid Phase Synthesis CPG support covalently linked with one of the four nucleosides

8 DMT - protected nucleoside CH 3 O DMT group C O BASE CPG O Linker O O CH 3 C O CH 2 CH 2 C O NH CH CH CH S i O O

9 Solid Phase Synthesis CPG support covalently linked with one of the four nucleosides Reactive groups of nucleosides are blocked or protected to prevent unwanted side reactions

10 Protection of Base Amino Groups O N O NH C N NH HN N C O N N N N CH CH 3 CH 3 Adenosine - benzoyl protected Guanosine - isobutyryl protected O O NH C HN CH 3 N O N O N Thymidine Cytidine - benzoyl protected

11 Solid Phase Synthesis CPG support covalently linked with one of the four nucleosides Reactive groups of nucleosides are blocked or protected to prevent unwanted side reactions DNA synthesis occurs by connecting nucleoside monomers one at a time to the 5' end of growing chain (3' to 5' end)

12 Direction of synthesis Oligonucleotide 5 Natural DNA CPG

13 Solid Phase Synthesis CPG support covalently linked with one of the four nucleosides Reactive groups of nucleosides are blocked or protected to prevent unwanted side reactions DNA synthesis occurs by connecting nucleoside monomers one at a time to the 5' end of growing chain (3' to 5' end) DNA chain is cleaved from the support by ammonia treatment

14 Typical quantities of oligonucleotide obtained from different scales Synthesis scale Crude Yield (O.D.) (20 mers) Primer (40 nmole) 0.2 umole 1 umole 10 umole

15 Analysis & Purification PAGE HPLC CE (capillary electrophoresis) OPC (oligonucleotide Purification Cartridge)

16 Quantitation & Storage UV spectroscopy: Measuring OD at 260 nm 1 OD 260 for ssdna = 33 ug/ml Storage: stable with little or no degradation for long periods of time (over a year)

17 Alternative chemistries Antisense (phosphorothioate) RNA oligoribonucleotides (using 2' silyl 5' DMT-CE phosphoramidite RNA monomers) 5' modified oligonucleotides

18 5' modified oligonucleotides Aminolink Enzyme - labeled Biotin - labeled Fluorescein-lebeled

19 Applications of Oligonucleotides Probes Primers Synthetic gene Mutagenesis

20 Microarray Platforms! " Spotted" DNA fragments (usually created by PCR)or oligos are stuck to glass slides" The size of the fragment can be any length (usually 500 bp-1 kb)" The size of the oligos range from nts" These arrays can be created in individual labs using affordable equipment" " " Affymetrix" Affymetrix arrays are typically limited to oligos of nts" The probes on these arrays are synthesized using a light mask technology " Photo-sensitive reactions are used to remove a blocking group and then extend " It is very costly to fabricate masks for a new array design " Not commonly used for custom arrays" " "

21 Types of Microarray Platforms! NimbleGen Maskless Array Synthesizer technology uses PowerPoint projector parts; 786,000 tiny aluminum mirrors are used to shine light in specific patterns, Photo deposition chemistry allows single nt extensions. 380,000 or 2.1 million oligos/array (50mers). Agilent Uses ink-jet printer technology. Grows another base at the end of a molecule by deprotecting the end and attaching a new base with a protected end to avoid duplication. 244,000 oligos/array (60mers). Combimatrix Semiconductor technology directs the assembly of a specific sequence of DNA bases in response to a digital command. Each feature on the array (a microelectrode) is digitally addressed to controls the addition of a new base. 12,000 oligos (50mers)/array; 40,000 feature arrays in development.

22 Making a Spotted Arrays Probes cdna microarrays (up to 3000 bp) Long-oligonucleotide spotted arrays: uniform length ( bp) Customized spotted array Spotting pins draw fluid (containing DNA probes) by capillary action and form spots on the side through surface tension interaction between the surface and spotting buffer. spotted onto glass slide using robotic arms Commercial spotted arrays (Agilent) SurePrint Technology Iike an inkjet printer, prints sets of cdna clones or oligonucleotides one-by-one

23 Spotted Arrays: Sample Preparation and Two-color Detection Allows a direct comparison between two different samples

24 DNA microarrays can be manufactured by: Photolitography (Affymetrix, Nimblegen) Inkjet (Agilent, Canon) Robot spotting (many providers)

25 Affymetrix photolitography Each probe 25 bp long probes per gene Perfect Match (PM) as well as MisMatch (MM) probes

26 Masked Array Synthesis (Affymetrix)

27 Maskless Arrays (Nimblegen)

28 NimbleGen photolitography

29 Robot Spotting

30 InkJet (HP/Canon) technology

31 Making a Oligonucleotide array Probes bp oligonucleotide probes Electrochemistry - CombiMatrix Array Each microelectrode selectively generates chemical reagents by electrochemical reaction. Controls the building of DNA on a semiconductor chip by the software-controled turning on and off of electrodes. Photolithography - Affymetrix Array manipulates light to direct the chemical synthesis of the probes Mask directs the flow of U.V. light Uses light sensitive protecting groups.

32 Applications Expression profiling Comparative genomic hybridization Single nucleotide polymorphism Sequencing

33 Summary

34

35 References GeneChip Expression Analysis Technical Manual. support/downloads/manuals/expression_analysis_technical_manual.pdf. McInnerney Kate. One-cycle eukaryotic target prep protocol. Agilent SurePrint Technology (2003) Retrieved March 23, 2008 from Spotted Array Printing Techniques NCBI A Science Primer: Microarrays: Chipping away at the myteries of science and medicine. Affymetrix GeneChip Workflow tools Affymetrix Educator Resources

36 Image Analysis 1. Gridding: identify spots (automatic, semiautomatic, manual) 2. Segmentation: separate spots from background. Fixed circle (B), Adaptive circle C, Adaptive shape (D), Histogram 3. Intensity extraction: mean or median of pixels in spot 4. Background correction: local or global

37 Distribution of mrna levels in different cells

38

39 Photolithography

40 Removal of protecting groups and caps

41 DNA Synthesis Chemistry Cycle Detritylation Coupling Capping Oxidation

42 Oligonucleotide Array: Eukaryotic Target Preparation and Onecolor detection

43 Detection of mrna

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

DNA Microarray Technology

DNA Microarray Technology 2 DNA Microarray Technology 2.1 Overview DNA microarrays are assays for quantifying the types and amounts of mrna transcripts present in a collection of cells. The number of mrna molecules derived from

More information

INTRODUCTION. The Technology of Microarrays January Hanne Jarmer

INTRODUCTION. The Technology of Microarrays January Hanne Jarmer INTRODUCTION The Technology of Microarrays January 2009 - Hanne Jarmer The Concept gene mrna gene specific DNA probes labeled target Spotted arrays High-density arrays 13-16 micron features ~60 micron

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

Introduction to DNA microarrays. DTU - January Hanne Jarmer

Introduction to DNA microarrays. DTU - January Hanne Jarmer Introduction to DNA microarrays DTU - January 2007 - Hanne Jarmer Microarrays - The Concept Measure the level of transcript from a very large number of genes in one go Microarrays - The Concept Measure

More information

Clones. Glass Slide PCR. Purification. Array Printing. Post-process. Hybridize. Scan. Array Fabrication. Sample Preparation/Hybridization.

Clones. Glass Slide PCR. Purification. Array Printing. Post-process. Hybridize. Scan. Array Fabrication. Sample Preparation/Hybridization. Terminologies Reporter: the nucleotide sequence present in a particular location on the array (a.k.a. probe) Feature: the location of a reporter on the array Composite sequence: a set of reporters used

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

Moc/Bio and Nano/Micro Lee and Stowell

Moc/Bio and Nano/Micro Lee and Stowell Moc/Bio and Nano/Micro Lee and Stowell Moc/Bio-Lecture GeneChips Reading material http://www.gene-chips.com/ http://trueforce.com/lab_automation/dna_microa rrays_industry.htm http://www.affymetrix.com/technology/index.affx

More information

Agilent s Microarray Platform: How High-Fidelity DNA Synthesis Maximizes the Dynamic Range of Gene Expression Measurements

Agilent s Microarray Platform: How High-Fidelity DNA Synthesis Maximizes the Dynamic Range of Gene Expression Measurements Agilent s Microarray Platform: How High-Fidelity DNA Synthesis Maximizes the Dynamic Range of Gene Expression Measurements Author Emily LeProust, Ph.D. Agilent Technologies A key factor controlling the

More information

DNA Microarrays Introduction Part 2. Todd Lowe BME/BIO 210 April 11, 2007

DNA Microarrays Introduction Part 2. Todd Lowe BME/BIO 210 April 11, 2007 DNA Microarrays Introduction Part 2 Todd Lowe BME/BIO 210 April 11, 2007 Reading Assigned For Friday, please read two papers and be prepared to discuss in detail: Comprehensive Identification of Cell Cycle-related

More information

DNA Microarrays and Clustering of Gene Expression Data

DNA Microarrays and Clustering of Gene Expression Data DNA Microarrays and Clustering of Gene Expression Data Martha L. Bulyk mlbulyk@receptor.med.harvard.edu Biophysics 205 Spring term 2008 Traditional Method: Northern Blot RNA population on filter (gel);

More information

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Outline. Array platform considerations: Comparison between the technologies available in microarrays

Outline. Array platform considerations: Comparison between the technologies available in microarrays Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of

More information

Deoxyribonucleic Acid DNA

Deoxyribonucleic Acid DNA Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Differential gene expression. General Introduction. Overview (1) Biology Fundamentals - Genes

Differential gene expression. General Introduction. Overview (1) Biology Fundamentals - Genes Differential gene expression General Introduction Overview (1) Reminder of biology Major steps in microarray analysis Microarray preparation design, clone/probe selection RNA extraction, hybridization

More information

Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes

Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Measure of the linear correlation (dependence) between two variables X and Y Takes a value between +1 and 1 inclusive 1 = total positive correlation 0 = no correlation 1 = total negative correlation. When

More information

Spotted DNA Array Design. Todd Lowe BME/Bio 210 Sept 30, 2008

Spotted DNA Array Design. Todd Lowe BME/Bio 210 Sept 30, 2008 Spotted DNA Array Design Todd Lowe BME/Bio 210 Sept 30, 2008 Making Your Own Array For Affymetrix-style GeneChips, most labs will use commercially available arrays, so no array design considerations For

More information

Microarrays The technology

Microarrays The technology Microarrays The technology Goal Goal: To measure the amount of a specific (known) DNA molecule in parallel. In parallel : do this for thousands or millions of molecules simultaneously. Main components

More information

SUREGUIDE CRISPR LIBRARIES

SUREGUIDE CRISPR LIBRARIES SUREGUIDE CRISPR LIBRARIES Fidelity The Agilent Advantage Guide Representation Customization The Agilent Advantage Fidelity What is fidelity? Fidelity in DNA synthesis is simple to understand but can be

More information

Custom Oligonucleotide Synthesis

Custom Oligonucleotide Synthesis Custom Oligonucleotide Synthesis Custom Oligo Synthesis, antisense oligos, RNA oligos, chimeric oligos, Fluorescent dye labeled oligos, Molecular Beacons, sirna, phosphonates Affinity Ligands, 2-5 linked

More information

SureGuide CRISPR Libraries

SureGuide CRISPR Libraries SureGuide CRISPR Libraries Fidelity The Agilent Advantage Guide Representation Customization Fidelity What is fidelity? Fidelity in DNA synthesis is simple to understand but can be difficult to achieve.

More information

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1 CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing

More information

Soybean Microarrays. An Introduction. By Steve Clough. November Common Microarray platforms

Soybean Microarrays. An Introduction. By Steve Clough. November Common Microarray platforms Soybean Microarrays Microarray construction An Introduction By Steve Clough November 2005 Common Microarray platforms cdna: spotted collection of PCR products from different cdna clones, each representing

More information

sequencing I. Brief history of sequencing II. Sanger dideoxy method for III. Maxam-Gilbert chemical cleavage method

sequencing I. Brief history of sequencing II. Sanger dideoxy method for III. Maxam-Gilbert chemical cleavage method DNA SEQUENCING DNA sequencing I. Brief history of sequencing II. Sanger dideoxy method for sequencing III. Maxam-Gilbert chemical cleavage method DNA sequencing Why sequence DNA? All genes available for

More information

Bioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU.

Bioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU. Introduction to Bioinformatics: Microarray Technology Assc.Prof. Chuchart Areejitranusorn AMS. KKU. ความจร งเก ยวก บ ความจรงเกยวกบ Cell and DNA Cell Nucleus Chromosome Protein Gene (mrna), single strand

More information

Chemical Structure. User Bulletin: ABI 392/4 Nucleic Acid Synthesizers. Subject: Biotin Labeling of Oligonucleotides on a DNA/RNA Synthesizer

Chemical Structure. User Bulletin: ABI 392/4 Nucleic Acid Synthesizers. Subject: Biotin Labeling of Oligonucleotides on a DNA/RNA Synthesizer Technical Resources FAQs Error Codes Request Forms Doc. Library Software Library Fax on Demand Course Listing Contact Information Part Numbers Our Teams User Bulletin - Number 70 Models 38X/39X Biotin

More information

Announcements. Lecture 2: DNA Microarray Overview. Gene Expression: The Central Dogma. Talks. Go to class web page

Announcements. Lecture 2: DNA Microarray Overview. Gene Expression: The Central Dogma. Talks. Go to class web page Announcements Lecture 2: DNA Microarray Overview Go to class web page http://www.cs.washington.edu/527 Add yourself to class list Check out HW1, including last year s (Some slides from Dr. Holly Dressman,

More information

Please purchase PDFcamp Printer on to remove this watermark. DNA microarray

Please purchase PDFcamp Printer on  to remove this watermark. DNA microarray DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of

More information

DNA CHIPS- Technology and Utility

DNA CHIPS- Technology and Utility DNA CHIPS- Technology and Utility Yanal Alkuddsi Ph.D Student Dept. of Genetics and Plant Breeding University of Agricultural Sciences Dharwad, Karnataka, India, 580005 1.INTRODUCTION CONTENT 2.MICROARRAYS:

More information

Microarrays: since we use probes we obviously must know the sequences we are looking at!

Microarrays: since we use probes we obviously must know the sequences we are looking at! These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression

More information

Biomedical Applications of MEMS. Biochip Technology. Genetic Database. DNA Hybridization Arrays. Dr. Bruce K. Gale Fundamentals of Micromachining

Biomedical Applications of MEMS. Biochip Technology. Genetic Database. DNA Hybridization Arrays. Dr. Bruce K. Gale Fundamentals of Micromachining Biomedical Applications of MEMS Dr. Bruce K. Gale Fundamentals of Micromachining Biochip Technology with special thanks to Xiaolian Gao, University of Houston Genetic Database Challenges Function must

More information

Index 257. commercial origins, Antisense oligonucleotides, commercial processes, 247 clinical applications, 181

Index 257. commercial origins, Antisense oligonucleotides, commercial processes, 247 clinical applications, 181 Index 257 Index A B Abortion, ethics of prenatal diagnosis, Biochip, 65, 66 commercial origins, 247 249 Antisense oligonucleotides, commercial processes, 247 clinical applications, 181 definition, 17,

More information

FAQ (Frequently Asked Questions) about custom DNA Synthesis

FAQ (Frequently Asked Questions) about custom DNA Synthesis FAQ (Frequently Asked Questions) about custom DNA Synthesis 1. What is scale of synthesis? Scale of synthesis refers to the amount of starting CPG (controlled-pore glass) support-bound monomer used to

More information

Computing with large data sets

Computing with large data sets Computing with large data sets Richard Bonneau, spring 2009 Lecture 14 (week 8): genomics 1 Central dogma Gene expression DNA RNA Protein v22.0480: computing with data, Richard Bonneau Lecture 14 places

More information

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8 Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically

More information

DNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center

DNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center DNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center Why DNA Chips? Functional genomics: get information about genes that is unavailable from sequence

More information

Spotted DNA Array Design. Todd Lowe Bio 210 Jan 13 & 15, 2003

Spotted DNA Array Design. Todd Lowe Bio 210 Jan 13 & 15, 2003 Spotted DNA Array Design Todd Lowe Bio 210 Jan 13 & 15, 2003 Making Your Own Array For Affymetrix-style GeneChips, most labs will use commercially available arrays, so no array design considerations Spotted

More information

3.1.4 DNA Microarray Technology

3.1.4 DNA Microarray Technology 3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns

More information

Gene expression profiling experiments:

Gene expression profiling experiments: Gene expression profiling experiments: Problems, pitfalls, and solutions. Heli Borg The Alternatives in Microarray Experiments bacteria - eucaryots non poly(a) + - poly(a) + oligonucleotide Affymetrix

More information

Design. Construction. Characterization

Design. Construction. Characterization Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication

More information

Then, we went on to discuss genome expression and described: Microarrays

Then, we went on to discuss genome expression and described: Microarrays In the previous lecture, we have discussed: - classical sequencing methods - newer authomatic sequencing methods - solid-phase parallel sequencing - Next Generation mass-sequencing methods Then, we went

More information

* Custom assays developed based on customer requirements. * Rigorous QC process to ensure test performance and accuracy

* Custom assays developed based on customer requirements. * Rigorous QC process to ensure test performance and accuracy Price List 2012-13 About Scigenom * Genomics focused R & D organization * Expertise in rapid and accurate DNA test development * Several DNA based tests readily available * Custom assays developed based

More information

Motivation From Protein to Gene

Motivation From Protein to Gene MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein

More information

Introduction to biology and measurement of gene expression

Introduction to biology and measurement of gene expression Introduction to biology and measurement of gene expression Statistical analysis of gene expression data with R and Bioconductor University of Copenhagen, 17-21 August, 2009 Margaret Taub University of

More information

Microarray. Key components Array Probes Detection system. Normalisation. Data-analysis - ratio generation

Microarray. Key components Array Probes Detection system. Normalisation. Data-analysis - ratio generation Microarray Key components Array Probes Detection system Normalisation Data-analysis - ratio generation MICROARRAY Measures Gene Expression Global - Genome wide scale Why Measure Gene Expression? What information

More information

Fluorous Affinity Purification of Oligonucleotides

Fluorous Affinity Purification of Oligonucleotides Fluorous Affinity Purification of Oligonucleotides A higher affinity alternative to RP cartridge purification. One-pass loading without ammonia removal. High recoveries (typically 70-100%). High selectivity

More information

10.1 The Central Dogma of Biology and gene expression

10.1 The Central Dogma of Biology and gene expression 126 Grundlagen der Bioinformatik, SS 09, D. Huson (this part by K. Nieselt) July 6, 2009 10 Microarrays (script by K. Nieselt) There are many articles and books on this topic. These lectures are based

More information

Introduction to Bioinformatics and Gene Expression Technology

Introduction to Bioinformatics and Gene Expression Technology Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA

More information

BENG 183 Trey Ideker (the details )

BENG 183 Trey Ideker (the details ) BENG 183 Trey Ideker (the details ) (1) Devils in the details: Sequencing topics to be covered in today s lecture DNA preparation prior to sequencing Amplification: vectors or cycle sequencing PAGE and

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

Enabling Genomic Technologies to support The Strategic Research Programme in Diabetes (

Enabling Genomic Technologies to support The Strategic Research Programme in Diabetes ( Enabling Genomic Technologies to support The Strategic Research Programme in Diabetes (http://ki.se/srp-diabetes) Karin Dahlman-Wright BEA, Bioinformatics and Expression Analysis CF and Karin Dahlman-Wright

More information

Microarray Industry Products

Microarray Industry Products Via Nicaragua, 12-14 00040 Pomezia (Roma) Phone: +39 06 91601628 Fax: +39 06 91612477 info@lifelinelab.com www.lifelinelab.com Microarray Industry Products Page 10 NBT / BCPIP Chromogenic phosphatase

More information

Passivation of the areas of the chip surrounding the oligonucleotide spots was carried out by

Passivation of the areas of the chip surrounding the oligonucleotide spots was carried out by Supporting Information Microarray Fabrication. Oligonucleotide capture strands were immobilized onto the SMPB- (succinimidyl 4-(p-maleimidophenyl)butyrate) functionalized glass slide by spotting 5 - hexylthiol-capped

More information

Microarray Technique. Some background. M. Nath

Microarray Technique. Some background. M. Nath Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique

More information

Amino-allyl Dye Coupling Protocol

Amino-allyl Dye Coupling Protocol Amino-allyl Dye Coupling Protocol Joseph DeRisi, June 2001 Typically, fluorescently labeled cdna is generated by incorporation of dyeconjugated nucleotide analogs during the reverse transcription process.

More information

Recitation CHAPTER 9 DNA Technologies

Recitation CHAPTER 9 DNA Technologies Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown

More information

MICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE

MICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE MICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE National Center for Biotechnology Information With only a few exceptions, every

More information

Martin Gilar Waters Corporation, Milford, MA, U.S. Origins of synthetic oligonucleotides impurities. Lab-scale isolation options

Martin Gilar Waters Corporation, Milford, MA, U.S. Origins of synthetic oligonucleotides impurities. Lab-scale isolation options LIGNUCLETIDE SEPARATIN TECHNLGY: SYNTHESIS CHALLENGES AND HPLC ISLATIN PTINS Martin Gilar Waters Corporation, Milford, MA, U.S. INTRDUCTIN rigins of synthetic oligonucleotides impurities Use of synthetic

More information

Exact and Approximation Algorithms for DNA Tag Set Design

Exact and Approximation Algorithms for DNA Tag Set Design Exact and Approximation Algorithms for DNA Tag Set Design by Dragoş N. Trincă B.S., A.I.Cuza University (Romania), 003 A Thesis Submitted in Partial Fulfillment of the Requirements for the Degree of Master

More information

COS 597c: Topics in Computational Molecular Biology. DNA arrays. Background

COS 597c: Topics in Computational Molecular Biology. DNA arrays. Background COS 597c: Topics in Computational Molecular Biology Lecture 19a: December 1, 1999 Lecturer: Robert Phillips Scribe: Robert Osada DNA arrays Before exploring the details of DNA chips, let s take a step

More information

Classification and Characterization of Impurities in Phosphoramidites Used in Making Therapeutic Oligonucleotides:

Classification and Characterization of Impurities in Phosphoramidites Used in Making Therapeutic Oligonucleotides: Tech ote Classification and Characterization of Impurities in hosphoramidites Used in Making Therapeutic ligonucleotides: Risk Mitigation Strategies for Entering Clinical hases He, Kaizhang; Hasan, Ahmad

More information

DNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT.

DNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. DNA/RNA MICROARRAYS This protocol is based on the EDVOTEK protocol DNA/RNA Microarrays. 10 groups of students NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. 1. EXPERIMENT OBJECTIVE The objective of this

More information

Measuring gene expression (Microarrays) Ulf Leser

Measuring gene expression (Microarrays) Ulf Leser Measuring gene expression (Microarrays) Ulf Leser This Lecture Gene expression Microarrays Idea Technologies Problems Quality control Normalization Analysis next week! 2 http://learn.genetics.utah.edu/content/molecules/transcribe/

More information

Selected Techniques Part I

Selected Techniques Part I 1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative

More information

Bi 8 Lecture 5. Ellen Rothenberg 19 January 2016

Bi 8 Lecture 5. Ellen Rothenberg 19 January 2016 Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

earray 5.0 Create your own Custom Microarray Design

earray 5.0 Create your own Custom Microarray Design earray 5.0 Create your own Custom Microarray Design http://earray.chem.agilent.com earray 5.x Overview Session Summary Session Summary Agilent Genomics Microarray Solution earray Functional Overview Gene

More information

User Guide for the Fluorous Affinity Purification of Oligonucleotides

User Guide for the Fluorous Affinity Purification of Oligonucleotides T A B L E O F C O N T E N T S User Guide for the Fluorous Affinity Purification of Oligonucleotides Fluoro-Pak Columns and Fluorous Phosphoramidites Table of Contents Introduction....................................................

More information

STATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays. Materials are from

STATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays. Materials are from STATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays Materials are from http://www.ohsu.edu/gmsr/amc/amc_technology.html The GeneChip high-density oligonucleotide arrays are fabricated

More information

DNA and Proteine Microarray Technologies Developed on Porous Silicon Substrate. Dr. Monica Simion, IMT Bucharest

DNA and Proteine Microarray Technologies Developed on Porous Silicon Substrate. Dr. Monica Simion, IMT Bucharest DNA and Proteine Microarray Technologies Developed on Porous Silicon Substrate Dr. Monica Simion, IMT Bucharest OmniGrid Micro (Digilab) printhead and wash/dry stations Positioning System with stepper

More information

Chapter 1. from genomics to proteomics Ⅱ

Chapter 1. from genomics to proteomics Ⅱ Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more

More information

Typical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides

Typical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides Aminosilane coating Nexterion Slide A+ and Slide AStar Overview Type of coating Immobilization method Typical probes Ordering information Nexterion product Barcode option Item number Slides per pack Aminosilane

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

3. Methods RNA phosphoramidites with 2 -O-tbutyldimethylsilyl

3. Methods RNA phosphoramidites with 2 -O-tbutyldimethylsilyl Comparison of Coupling and Deprotection Protocols for RNA Synthesis ABRF 04, Integrating Technologies in Proteomics & Genomics, Portland, Oregon, Feb. 28 Mar. 2, 04. Richard T. Pon and Shuyuan Yu, UCDNA

More information

CodeLink Human Whole Genome Bioarray

CodeLink Human Whole Genome Bioarray CodeLink Human Whole Genome Bioarray 55,000 human gene targets on a single bioarray The CodeLink Human Whole Genome Bioarray comprises one of the most comprehensive coverages of the human genome, as it

More information

Wet-lab Considerations for Illumina data analysis

Wet-lab Considerations for Illumina data analysis Wet-lab Considerations for Illumina data analysis Based on a presentation by Henriette O Geen Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina

More information

Product Specifications & Manual

Product Specifications & Manual Product Specifications & Manual Custom Oligo Synthesis, antisense oligos, RNA oligos, chimeric oligos, Fluorescent dye labeled oligos, Molecular Beacons, sirna, phosphonates Affinity Ligands, 2-5 linked

More information

Computational Biology I

Computational Biology I Computational Biology I Microarray data acquisition Gene clustering Practical Microarray Data Acquisition H. Yang From Sample to Target cdna Sample Centrifugation (Buffer) Cell pellets lyse cells (TRIzol)

More information

Soybean Microarrays. Microarray construction. An Introduction. By Steve Clough

Soybean Microarrays. Microarray construction. An Introduction. By Steve Clough Soybean Microarrays Microarray construction An Introduction By Steve Clough Common Microarray platforms cdna: spotted collection of PCR products from different cdna clones, each representing a different

More information

Methods for Working with DNA and RNA

Methods for Working with DNA and RNA Methods for Working with DNA and RNA 1. Gel electrophoresis A. Materials: agarose (large DNAs) vs. acrylamide (high resolution, DNA sequencing) B. Separated by its sieving property and charge: both are

More information

A robust and sensitive. for profiling of mirnas Life Sciences - Genomics. Stephanie Fulmer-Smentek. Group Manager. Agilent mirna profiling solution

A robust and sensitive. for profiling of mirnas Life Sciences - Genomics. Stephanie Fulmer-Smentek. Group Manager. Agilent mirna profiling solution A robust and sensitive microarray system for profiling of mirnas Life Sciences - Genomics Stephanie Fulmer-Smentek RNA Applications R&D Group Manager Overview microrna biology Agilent mirna platform -

More information

Molecular Genetics II - Genetic Engineering Course (Supplementary notes)

Molecular Genetics II - Genetic Engineering Course (Supplementary notes) 1 von 12 21.02.2015 15:13 Molecular Genetics II - Genetic Engineering Course (Supplementary notes) Figures showing examples of cdna synthesis (currently 11 figures) cdna is a DNA copy synthesized from

More information

Validation Study of FUJIFILM QuickGene System for Affymetrix GeneChip

Validation Study of FUJIFILM QuickGene System for Affymetrix GeneChip Validation Study of FUJIFILM QuickGene System for Affymetrix GeneChip Reproducibility of Extraction of Genomic DNA from Whole Blood samples in EDTA using FUJIFILM membrane technology on the QuickGene-810

More information

Microarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6

Microarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6 Slide Selection Chart... J2 Epoxide-coated Slides... J3 UltraGAPS -coated Slides... J4 GAPS II-coated Slides... J5 Corning Cover Glass... J6 384-well Printing Plates... J6 Slide Mailers/Storage Boxes...

More information

Enable New Experimental Possibilities with Custom RNA Synthesis

Enable New Experimental Possibilities with Custom RNA Synthesis Custom RNA Synthesis Enable New Experimental Possibilities with Custom RNA Synthesis Dharmacon custom RNA synthesis enables additional experimental abilities and scientific discoveries through unique chemistry,

More information

High Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center

High Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina Still-imaging of clusters (~1000

More information

QUICK-Clone TM User Manual. cdna

QUICK-Clone TM User Manual. cdna QUICK-Clone TM User Manual cdna PT1150-1 (PR752268) Published 25 May 2007 Table of Contents I. Introduction 3 II. Applications Discussion 4 A. Primer Design 4 B. Setting up the PCR Reaction 4 C. Example

More information

Introduction to Bioinformatics. Fabian Hoti 6.10.

Introduction to Bioinformatics. Fabian Hoti 6.10. Introduction to Bioinformatics Fabian Hoti 6.10. Analysis of Microarray Data Introduction Different types of microarrays Experiment Design Data Normalization Feature selection/extraction Clustering Introduction

More information

SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.

SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology. SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture

More information

Electrophoresis and the Agilent Bioanalyzer. Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008

Electrophoresis and the Agilent Bioanalyzer. Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008 Electrophoresis and the Agilent Bioanalyzer Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008 Introduction Electrophoresis is one of the most commonlyused methods of separating

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary

More information

Supplementary Information for:

Supplementary Information for: Supplementary Information for: A streamlined and high-throughput targeting approach for human germline and cancer genomes using Oligonucleotide-Selective Sequencing Samuel Myllykangas 1, Jason D. Buenrostro

More information

Gene expression. What is gene expression?

Gene expression. What is gene expression? Gene expression What is gene expression? Methods for measuring a single gene. Northern Blots Reporter genes Quantitative RT-PCR Operons, regulons, and stimulons. DNA microarrays. Expression profiling Identifying

More information

Supporting Information

Supporting Information Supporting Information Efficient RNA synthesis by in vitro transcription of a triazole-modified DNA template Afaf H. El-Sagheer a,b and Tom Brown a a School of Chemistry, University of Southampton, Highfield,

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Common General Cloning Strategy Target DNA from donor organism extracted, cut with restriction endonuclease and ligated into a cloning vector cut with compatible restriction

More information

BioMEMS for Future Drug Discovery Needs

BioMEMS for Future Drug Discovery Needs BioMEMS for Future Drug Discovery Needs a report by Drs Arjun Selvakumar, 1 Yuh-Min Chiang, 1 Simon Sims 2 and Jamie Wibbenmeyer 2 1. Applied MEMS, Inc. and 2. Xeotron Corporation Introduction Billions

More information

Agilent PL-SAX Anion-Exchange Media for Nucleotide and Oligonucleotide Analysis

Agilent PL-SAX Anion-Exchange Media for Nucleotide and Oligonucleotide Analysis Agilent PL-SAX Anion-Exchange Media for Nucleotide and Oligonucleotide Analysis Technical Overview Introduction The physical stability of Agilent PL-SAX ensures rapid equilibration between separations,

More information