What is a microarray
|
|
- Ruby Warren
- 6 years ago
- Views:
Transcription
1 DNA Microarrays
2 What is a microarray A surface on which sequences from thousands of different genes are covalently attached to fixed locations (probes). Glass slides Silicon chips Utilize the selective nature of DNA-DNA or DNA-RNA hybridization
3 Types of microarrays Probe Manufacture Spotted Arrays DNA probes are synthesized and then spotted onto the microarray Customized for each experiment in-lab Low cost Oligonucleotide microarrays DNA oligonucleotides are synthezised directly on the microarray Commercial arrays (Affymetrix, Nimblegen and Combimatrix) expensive Detection Two-color detection Spotted Array: Compare two samples by labeling with two different flurophores and analyzing on the same array Cy5 (red) and Cy3 (green) One-color detection Determine gene expression level One array per sample
4 Phosphoramidite chemistry Stable = can actually be shipped High coupling yield Synthesis on a solid support Monomer addition Still a manual method, not consistent Faster cycle time of 20 minutes Using some nasty reagents (e.g. DMAP, DMF, Thiophenol) Very cyclical and repetitive = not fun
5 Coupling efficiency 100 % 50 % Phosphoramidite chemistry at 98% coupling efficiency 0 % 10 bases 20 bases
6 Solid Phase Synthesis Controlled Pore Glass (CPG) support covalently linked with one of the four nucleosides Reactive groups of nucleosides are blocked or protected to prevent unwanted side reactions DNA synthesis occurs by connecting nucleoside monomers one at a time to the 5' end of growing chain (3' to 5' end) DNA chain is cleaved from the support by ammonia treatment
7 Solid Phase Synthesis CPG support covalently linked with one of the four nucleosides
8 DMT - protected nucleoside CH 3 O DMT group C O BASE CPG O Linker O O CH 3 C O CH 2 CH 2 C O NH CH CH CH S i O O
9 Solid Phase Synthesis CPG support covalently linked with one of the four nucleosides Reactive groups of nucleosides are blocked or protected to prevent unwanted side reactions
10 Protection of Base Amino Groups O N O NH C N NH HN N C O N N N N CH CH 3 CH 3 Adenosine - benzoyl protected Guanosine - isobutyryl protected O O NH C HN CH 3 N O N O N Thymidine Cytidine - benzoyl protected
11 Solid Phase Synthesis CPG support covalently linked with one of the four nucleosides Reactive groups of nucleosides are blocked or protected to prevent unwanted side reactions DNA synthesis occurs by connecting nucleoside monomers one at a time to the 5' end of growing chain (3' to 5' end)
12 Direction of synthesis Oligonucleotide 5 Natural DNA CPG
13 Solid Phase Synthesis CPG support covalently linked with one of the four nucleosides Reactive groups of nucleosides are blocked or protected to prevent unwanted side reactions DNA synthesis occurs by connecting nucleoside monomers one at a time to the 5' end of growing chain (3' to 5' end) DNA chain is cleaved from the support by ammonia treatment
14 Typical quantities of oligonucleotide obtained from different scales Synthesis scale Crude Yield (O.D.) (20 mers) Primer (40 nmole) 0.2 umole 1 umole 10 umole
15 Analysis & Purification PAGE HPLC CE (capillary electrophoresis) OPC (oligonucleotide Purification Cartridge)
16 Quantitation & Storage UV spectroscopy: Measuring OD at 260 nm 1 OD 260 for ssdna = 33 ug/ml Storage: stable with little or no degradation for long periods of time (over a year)
17 Alternative chemistries Antisense (phosphorothioate) RNA oligoribonucleotides (using 2' silyl 5' DMT-CE phosphoramidite RNA monomers) 5' modified oligonucleotides
18 5' modified oligonucleotides Aminolink Enzyme - labeled Biotin - labeled Fluorescein-lebeled
19 Applications of Oligonucleotides Probes Primers Synthetic gene Mutagenesis
20 Microarray Platforms! " Spotted" DNA fragments (usually created by PCR)or oligos are stuck to glass slides" The size of the fragment can be any length (usually 500 bp-1 kb)" The size of the oligos range from nts" These arrays can be created in individual labs using affordable equipment" " " Affymetrix" Affymetrix arrays are typically limited to oligos of nts" The probes on these arrays are synthesized using a light mask technology " Photo-sensitive reactions are used to remove a blocking group and then extend " It is very costly to fabricate masks for a new array design " Not commonly used for custom arrays" " "
21 Types of Microarray Platforms! NimbleGen Maskless Array Synthesizer technology uses PowerPoint projector parts; 786,000 tiny aluminum mirrors are used to shine light in specific patterns, Photo deposition chemistry allows single nt extensions. 380,000 or 2.1 million oligos/array (50mers). Agilent Uses ink-jet printer technology. Grows another base at the end of a molecule by deprotecting the end and attaching a new base with a protected end to avoid duplication. 244,000 oligos/array (60mers). Combimatrix Semiconductor technology directs the assembly of a specific sequence of DNA bases in response to a digital command. Each feature on the array (a microelectrode) is digitally addressed to controls the addition of a new base. 12,000 oligos (50mers)/array; 40,000 feature arrays in development.
22 Making a Spotted Arrays Probes cdna microarrays (up to 3000 bp) Long-oligonucleotide spotted arrays: uniform length ( bp) Customized spotted array Spotting pins draw fluid (containing DNA probes) by capillary action and form spots on the side through surface tension interaction between the surface and spotting buffer. spotted onto glass slide using robotic arms Commercial spotted arrays (Agilent) SurePrint Technology Iike an inkjet printer, prints sets of cdna clones or oligonucleotides one-by-one
23 Spotted Arrays: Sample Preparation and Two-color Detection Allows a direct comparison between two different samples
24 DNA microarrays can be manufactured by: Photolitography (Affymetrix, Nimblegen) Inkjet (Agilent, Canon) Robot spotting (many providers)
25 Affymetrix photolitography Each probe 25 bp long probes per gene Perfect Match (PM) as well as MisMatch (MM) probes
26 Masked Array Synthesis (Affymetrix)
27 Maskless Arrays (Nimblegen)
28 NimbleGen photolitography
29 Robot Spotting
30 InkJet (HP/Canon) technology
31 Making a Oligonucleotide array Probes bp oligonucleotide probes Electrochemistry - CombiMatrix Array Each microelectrode selectively generates chemical reagents by electrochemical reaction. Controls the building of DNA on a semiconductor chip by the software-controled turning on and off of electrodes. Photolithography - Affymetrix Array manipulates light to direct the chemical synthesis of the probes Mask directs the flow of U.V. light Uses light sensitive protecting groups.
32 Applications Expression profiling Comparative genomic hybridization Single nucleotide polymorphism Sequencing
33 Summary
34
35 References GeneChip Expression Analysis Technical Manual. support/downloads/manuals/expression_analysis_technical_manual.pdf. McInnerney Kate. One-cycle eukaryotic target prep protocol. Agilent SurePrint Technology (2003) Retrieved March 23, 2008 from Spotted Array Printing Techniques NCBI A Science Primer: Microarrays: Chipping away at the myteries of science and medicine. Affymetrix GeneChip Workflow tools Affymetrix Educator Resources
36 Image Analysis 1. Gridding: identify spots (automatic, semiautomatic, manual) 2. Segmentation: separate spots from background. Fixed circle (B), Adaptive circle C, Adaptive shape (D), Histogram 3. Intensity extraction: mean or median of pixels in spot 4. Background correction: local or global
37 Distribution of mrna levels in different cells
38
39 Photolithography
40 Removal of protecting groups and caps
41 DNA Synthesis Chemistry Cycle Detritylation Coupling Capping Oxidation
42 Oligonucleotide Array: Eukaryotic Target Preparation and Onecolor detection
43 Detection of mrna
Gene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationDNA Microarray Technology
2 DNA Microarray Technology 2.1 Overview DNA microarrays are assays for quantifying the types and amounts of mrna transcripts present in a collection of cells. The number of mrna molecules derived from
More informationINTRODUCTION. The Technology of Microarrays January Hanne Jarmer
INTRODUCTION The Technology of Microarrays January 2009 - Hanne Jarmer The Concept gene mrna gene specific DNA probes labeled target Spotted arrays High-density arrays 13-16 micron features ~60 micron
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationIntroduction to DNA microarrays. DTU - January Hanne Jarmer
Introduction to DNA microarrays DTU - January 2007 - Hanne Jarmer Microarrays - The Concept Measure the level of transcript from a very large number of genes in one go Microarrays - The Concept Measure
More informationClones. Glass Slide PCR. Purification. Array Printing. Post-process. Hybridize. Scan. Array Fabrication. Sample Preparation/Hybridization.
Terminologies Reporter: the nucleotide sequence present in a particular location on the array (a.k.a. probe) Feature: the location of a reporter on the array Composite sequence: a set of reporters used
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationMoc/Bio and Nano/Micro Lee and Stowell
Moc/Bio and Nano/Micro Lee and Stowell Moc/Bio-Lecture GeneChips Reading material http://www.gene-chips.com/ http://trueforce.com/lab_automation/dna_microa rrays_industry.htm http://www.affymetrix.com/technology/index.affx
More informationAgilent s Microarray Platform: How High-Fidelity DNA Synthesis Maximizes the Dynamic Range of Gene Expression Measurements
Agilent s Microarray Platform: How High-Fidelity DNA Synthesis Maximizes the Dynamic Range of Gene Expression Measurements Author Emily LeProust, Ph.D. Agilent Technologies A key factor controlling the
More informationDNA Microarrays Introduction Part 2. Todd Lowe BME/BIO 210 April 11, 2007
DNA Microarrays Introduction Part 2 Todd Lowe BME/BIO 210 April 11, 2007 Reading Assigned For Friday, please read two papers and be prepared to discuss in detail: Comprehensive Identification of Cell Cycle-related
More informationDNA Microarrays and Clustering of Gene Expression Data
DNA Microarrays and Clustering of Gene Expression Data Martha L. Bulyk mlbulyk@receptor.med.harvard.edu Biophysics 205 Spring term 2008 Traditional Method: Northern Blot RNA population on filter (gel);
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationOutline. Array platform considerations: Comparison between the technologies available in microarrays
Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of
More informationDeoxyribonucleic Acid DNA
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationDifferential gene expression. General Introduction. Overview (1) Biology Fundamentals - Genes
Differential gene expression General Introduction Overview (1) Reminder of biology Major steps in microarray analysis Microarray preparation design, clone/probe selection RNA extraction, hybridization
More informationExpressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes
Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional
More informationBiology 644: Bioinformatics
Measure of the linear correlation (dependence) between two variables X and Y Takes a value between +1 and 1 inclusive 1 = total positive correlation 0 = no correlation 1 = total negative correlation. When
More informationSpotted DNA Array Design. Todd Lowe BME/Bio 210 Sept 30, 2008
Spotted DNA Array Design Todd Lowe BME/Bio 210 Sept 30, 2008 Making Your Own Array For Affymetrix-style GeneChips, most labs will use commercially available arrays, so no array design considerations For
More informationMicroarrays The technology
Microarrays The technology Goal Goal: To measure the amount of a specific (known) DNA molecule in parallel. In parallel : do this for thousands or millions of molecules simultaneously. Main components
More informationSUREGUIDE CRISPR LIBRARIES
SUREGUIDE CRISPR LIBRARIES Fidelity The Agilent Advantage Guide Representation Customization The Agilent Advantage Fidelity What is fidelity? Fidelity in DNA synthesis is simple to understand but can be
More informationCustom Oligonucleotide Synthesis
Custom Oligonucleotide Synthesis Custom Oligo Synthesis, antisense oligos, RNA oligos, chimeric oligos, Fluorescent dye labeled oligos, Molecular Beacons, sirna, phosphonates Affinity Ligands, 2-5 linked
More informationSureGuide CRISPR Libraries
SureGuide CRISPR Libraries Fidelity The Agilent Advantage Guide Representation Customization Fidelity What is fidelity? Fidelity in DNA synthesis is simple to understand but can be difficult to achieve.
More informationCAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1
CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing
More informationSoybean Microarrays. An Introduction. By Steve Clough. November Common Microarray platforms
Soybean Microarrays Microarray construction An Introduction By Steve Clough November 2005 Common Microarray platforms cdna: spotted collection of PCR products from different cdna clones, each representing
More informationsequencing I. Brief history of sequencing II. Sanger dideoxy method for III. Maxam-Gilbert chemical cleavage method
DNA SEQUENCING DNA sequencing I. Brief history of sequencing II. Sanger dideoxy method for sequencing III. Maxam-Gilbert chemical cleavage method DNA sequencing Why sequence DNA? All genes available for
More informationBioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU.
Introduction to Bioinformatics: Microarray Technology Assc.Prof. Chuchart Areejitranusorn AMS. KKU. ความจร งเก ยวก บ ความจรงเกยวกบ Cell and DNA Cell Nucleus Chromosome Protein Gene (mrna), single strand
More informationChemical Structure. User Bulletin: ABI 392/4 Nucleic Acid Synthesizers. Subject: Biotin Labeling of Oligonucleotides on a DNA/RNA Synthesizer
Technical Resources FAQs Error Codes Request Forms Doc. Library Software Library Fax on Demand Course Listing Contact Information Part Numbers Our Teams User Bulletin - Number 70 Models 38X/39X Biotin
More informationAnnouncements. Lecture 2: DNA Microarray Overview. Gene Expression: The Central Dogma. Talks. Go to class web page
Announcements Lecture 2: DNA Microarray Overview Go to class web page http://www.cs.washington.edu/527 Add yourself to class list Check out HW1, including last year s (Some slides from Dr. Holly Dressman,
More informationPlease purchase PDFcamp Printer on to remove this watermark. DNA microarray
DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of
More informationDNA CHIPS- Technology and Utility
DNA CHIPS- Technology and Utility Yanal Alkuddsi Ph.D Student Dept. of Genetics and Plant Breeding University of Agricultural Sciences Dharwad, Karnataka, India, 580005 1.INTRODUCTION CONTENT 2.MICROARRAYS:
More informationMicroarrays: since we use probes we obviously must know the sequences we are looking at!
These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression
More informationBiomedical Applications of MEMS. Biochip Technology. Genetic Database. DNA Hybridization Arrays. Dr. Bruce K. Gale Fundamentals of Micromachining
Biomedical Applications of MEMS Dr. Bruce K. Gale Fundamentals of Micromachining Biochip Technology with special thanks to Xiaolian Gao, University of Houston Genetic Database Challenges Function must
More informationIndex 257. commercial origins, Antisense oligonucleotides, commercial processes, 247 clinical applications, 181
Index 257 Index A B Abortion, ethics of prenatal diagnosis, Biochip, 65, 66 commercial origins, 247 249 Antisense oligonucleotides, commercial processes, 247 clinical applications, 181 definition, 17,
More informationFAQ (Frequently Asked Questions) about custom DNA Synthesis
FAQ (Frequently Asked Questions) about custom DNA Synthesis 1. What is scale of synthesis? Scale of synthesis refers to the amount of starting CPG (controlled-pore glass) support-bound monomer used to
More informationComputing with large data sets
Computing with large data sets Richard Bonneau, spring 2009 Lecture 14 (week 8): genomics 1 Central dogma Gene expression DNA RNA Protein v22.0480: computing with data, Richard Bonneau Lecture 14 places
More informationBi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8
Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically
More informationDNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center
DNA Chip Technology Benedikt Brors Dept. Intelligent Bioinformatics Systems German Cancer Research Center Why DNA Chips? Functional genomics: get information about genes that is unavailable from sequence
More informationSpotted DNA Array Design. Todd Lowe Bio 210 Jan 13 & 15, 2003
Spotted DNA Array Design Todd Lowe Bio 210 Jan 13 & 15, 2003 Making Your Own Array For Affymetrix-style GeneChips, most labs will use commercially available arrays, so no array design considerations Spotted
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationGene expression profiling experiments:
Gene expression profiling experiments: Problems, pitfalls, and solutions. Heli Borg The Alternatives in Microarray Experiments bacteria - eucaryots non poly(a) + - poly(a) + oligonucleotide Affymetrix
More informationDesign. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
More informationThen, we went on to discuss genome expression and described: Microarrays
In the previous lecture, we have discussed: - classical sequencing methods - newer authomatic sequencing methods - solid-phase parallel sequencing - Next Generation mass-sequencing methods Then, we went
More information* Custom assays developed based on customer requirements. * Rigorous QC process to ensure test performance and accuracy
Price List 2012-13 About Scigenom * Genomics focused R & D organization * Expertise in rapid and accurate DNA test development * Several DNA based tests readily available * Custom assays developed based
More informationMotivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
More informationIntroduction to biology and measurement of gene expression
Introduction to biology and measurement of gene expression Statistical analysis of gene expression data with R and Bioconductor University of Copenhagen, 17-21 August, 2009 Margaret Taub University of
More informationMicroarray. Key components Array Probes Detection system. Normalisation. Data-analysis - ratio generation
Microarray Key components Array Probes Detection system Normalisation Data-analysis - ratio generation MICROARRAY Measures Gene Expression Global - Genome wide scale Why Measure Gene Expression? What information
More informationFluorous Affinity Purification of Oligonucleotides
Fluorous Affinity Purification of Oligonucleotides A higher affinity alternative to RP cartridge purification. One-pass loading without ammonia removal. High recoveries (typically 70-100%). High selectivity
More information10.1 The Central Dogma of Biology and gene expression
126 Grundlagen der Bioinformatik, SS 09, D. Huson (this part by K. Nieselt) July 6, 2009 10 Microarrays (script by K. Nieselt) There are many articles and books on this topic. These lectures are based
More informationIntroduction to Bioinformatics and Gene Expression Technology
Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA
More informationBENG 183 Trey Ideker (the details )
BENG 183 Trey Ideker (the details ) (1) Devils in the details: Sequencing topics to be covered in today s lecture DNA preparation prior to sequencing Amplification: vectors or cycle sequencing PAGE and
More informationMolecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
More informationEnabling Genomic Technologies to support The Strategic Research Programme in Diabetes (
Enabling Genomic Technologies to support The Strategic Research Programme in Diabetes (http://ki.se/srp-diabetes) Karin Dahlman-Wright BEA, Bioinformatics and Expression Analysis CF and Karin Dahlman-Wright
More informationMicroarray Industry Products
Via Nicaragua, 12-14 00040 Pomezia (Roma) Phone: +39 06 91601628 Fax: +39 06 91612477 info@lifelinelab.com www.lifelinelab.com Microarray Industry Products Page 10 NBT / BCPIP Chromogenic phosphatase
More informationPassivation of the areas of the chip surrounding the oligonucleotide spots was carried out by
Supporting Information Microarray Fabrication. Oligonucleotide capture strands were immobilized onto the SMPB- (succinimidyl 4-(p-maleimidophenyl)butyrate) functionalized glass slide by spotting 5 - hexylthiol-capped
More informationMicroarray Technique. Some background. M. Nath
Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique
More informationAmino-allyl Dye Coupling Protocol
Amino-allyl Dye Coupling Protocol Joseph DeRisi, June 2001 Typically, fluorescently labeled cdna is generated by incorporation of dyeconjugated nucleotide analogs during the reverse transcription process.
More informationRecitation CHAPTER 9 DNA Technologies
Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown
More informationMICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE
MICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE National Center for Biotechnology Information With only a few exceptions, every
More informationMartin Gilar Waters Corporation, Milford, MA, U.S. Origins of synthetic oligonucleotides impurities. Lab-scale isolation options
LIGNUCLETIDE SEPARATIN TECHNLGY: SYNTHESIS CHALLENGES AND HPLC ISLATIN PTINS Martin Gilar Waters Corporation, Milford, MA, U.S. INTRDUCTIN rigins of synthetic oligonucleotides impurities Use of synthetic
More informationExact and Approximation Algorithms for DNA Tag Set Design
Exact and Approximation Algorithms for DNA Tag Set Design by Dragoş N. Trincă B.S., A.I.Cuza University (Romania), 003 A Thesis Submitted in Partial Fulfillment of the Requirements for the Degree of Master
More informationCOS 597c: Topics in Computational Molecular Biology. DNA arrays. Background
COS 597c: Topics in Computational Molecular Biology Lecture 19a: December 1, 1999 Lecturer: Robert Phillips Scribe: Robert Osada DNA arrays Before exploring the details of DNA chips, let s take a step
More informationClassification and Characterization of Impurities in Phosphoramidites Used in Making Therapeutic Oligonucleotides:
Tech ote Classification and Characterization of Impurities in hosphoramidites Used in Making Therapeutic ligonucleotides: Risk Mitigation Strategies for Entering Clinical hases He, Kaizhang; Hasan, Ahmad
More informationDNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT.
DNA/RNA MICROARRAYS This protocol is based on the EDVOTEK protocol DNA/RNA Microarrays. 10 groups of students NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. 1. EXPERIMENT OBJECTIVE The objective of this
More informationMeasuring gene expression (Microarrays) Ulf Leser
Measuring gene expression (Microarrays) Ulf Leser This Lecture Gene expression Microarrays Idea Technologies Problems Quality control Normalization Analysis next week! 2 http://learn.genetics.utah.edu/content/molecules/transcribe/
More informationSelected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
More informationBi 8 Lecture 5. Ellen Rothenberg 19 January 2016
Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationearray 5.0 Create your own Custom Microarray Design
earray 5.0 Create your own Custom Microarray Design http://earray.chem.agilent.com earray 5.x Overview Session Summary Session Summary Agilent Genomics Microarray Solution earray Functional Overview Gene
More informationUser Guide for the Fluorous Affinity Purification of Oligonucleotides
T A B L E O F C O N T E N T S User Guide for the Fluorous Affinity Purification of Oligonucleotides Fluoro-Pak Columns and Fluorous Phosphoramidites Table of Contents Introduction....................................................
More informationSTATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays. Materials are from
STATC 141 Spring 2005, April 5 th Lecture notes on Affymetrix arrays Materials are from http://www.ohsu.edu/gmsr/amc/amc_technology.html The GeneChip high-density oligonucleotide arrays are fabricated
More informationDNA and Proteine Microarray Technologies Developed on Porous Silicon Substrate. Dr. Monica Simion, IMT Bucharest
DNA and Proteine Microarray Technologies Developed on Porous Silicon Substrate Dr. Monica Simion, IMT Bucharest OmniGrid Micro (Digilab) printhead and wash/dry stations Positioning System with stepper
More informationChapter 1. from genomics to proteomics Ⅱ
Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more
More informationTypical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides
Aminosilane coating Nexterion Slide A+ and Slide AStar Overview Type of coating Immobilization method Typical probes Ordering information Nexterion product Barcode option Item number Slides per pack Aminosilane
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More information3. Methods RNA phosphoramidites with 2 -O-tbutyldimethylsilyl
Comparison of Coupling and Deprotection Protocols for RNA Synthesis ABRF 04, Integrating Technologies in Proteomics & Genomics, Portland, Oregon, Feb. 28 Mar. 2, 04. Richard T. Pon and Shuyuan Yu, UCDNA
More informationCodeLink Human Whole Genome Bioarray
CodeLink Human Whole Genome Bioarray 55,000 human gene targets on a single bioarray The CodeLink Human Whole Genome Bioarray comprises one of the most comprehensive coverages of the human genome, as it
More informationWet-lab Considerations for Illumina data analysis
Wet-lab Considerations for Illumina data analysis Based on a presentation by Henriette O Geen Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina
More informationProduct Specifications & Manual
Product Specifications & Manual Custom Oligo Synthesis, antisense oligos, RNA oligos, chimeric oligos, Fluorescent dye labeled oligos, Molecular Beacons, sirna, phosphonates Affinity Ligands, 2-5 linked
More informationComputational Biology I
Computational Biology I Microarray data acquisition Gene clustering Practical Microarray Data Acquisition H. Yang From Sample to Target cdna Sample Centrifugation (Buffer) Cell pellets lyse cells (TRIzol)
More informationSoybean Microarrays. Microarray construction. An Introduction. By Steve Clough
Soybean Microarrays Microarray construction An Introduction By Steve Clough Common Microarray platforms cdna: spotted collection of PCR products from different cdna clones, each representing a different
More informationMethods for Working with DNA and RNA
Methods for Working with DNA and RNA 1. Gel electrophoresis A. Materials: agarose (large DNAs) vs. acrylamide (high resolution, DNA sequencing) B. Separated by its sieving property and charge: both are
More informationA robust and sensitive. for profiling of mirnas Life Sciences - Genomics. Stephanie Fulmer-Smentek. Group Manager. Agilent mirna profiling solution
A robust and sensitive microarray system for profiling of mirnas Life Sciences - Genomics Stephanie Fulmer-Smentek RNA Applications R&D Group Manager Overview microrna biology Agilent mirna platform -
More informationMolecular Genetics II - Genetic Engineering Course (Supplementary notes)
1 von 12 21.02.2015 15:13 Molecular Genetics II - Genetic Engineering Course (Supplementary notes) Figures showing examples of cdna synthesis (currently 11 figures) cdna is a DNA copy synthesized from
More informationValidation Study of FUJIFILM QuickGene System for Affymetrix GeneChip
Validation Study of FUJIFILM QuickGene System for Affymetrix GeneChip Reproducibility of Extraction of Genomic DNA from Whole Blood samples in EDTA using FUJIFILM membrane technology on the QuickGene-810
More informationMicroarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6
Slide Selection Chart... J2 Epoxide-coated Slides... J3 UltraGAPS -coated Slides... J4 GAPS II-coated Slides... J5 Corning Cover Glass... J6 384-well Printing Plates... J6 Slide Mailers/Storage Boxes...
More informationEnable New Experimental Possibilities with Custom RNA Synthesis
Custom RNA Synthesis Enable New Experimental Possibilities with Custom RNA Synthesis Dharmacon custom RNA synthesis enables additional experimental abilities and scientific discoveries through unique chemistry,
More informationHigh Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center
High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina Still-imaging of clusters (~1000
More informationQUICK-Clone TM User Manual. cdna
QUICK-Clone TM User Manual cdna PT1150-1 (PR752268) Published 25 May 2007 Table of Contents I. Introduction 3 II. Applications Discussion 4 A. Primer Design 4 B. Setting up the PCR Reaction 4 C. Example
More informationIntroduction to Bioinformatics. Fabian Hoti 6.10.
Introduction to Bioinformatics Fabian Hoti 6.10. Analysis of Microarray Data Introduction Different types of microarrays Experiment Design Data Normalization Feature selection/extraction Clustering Introduction
More informationSIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.
SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture
More informationElectrophoresis and the Agilent Bioanalyzer. Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008
Electrophoresis and the Agilent Bioanalyzer Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008 Introduction Electrophoresis is one of the most commonlyused methods of separating
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary
More informationSupplementary Information for:
Supplementary Information for: A streamlined and high-throughput targeting approach for human germline and cancer genomes using Oligonucleotide-Selective Sequencing Samuel Myllykangas 1, Jason D. Buenrostro
More informationGene expression. What is gene expression?
Gene expression What is gene expression? Methods for measuring a single gene. Northern Blots Reporter genes Quantitative RT-PCR Operons, regulons, and stimulons. DNA microarrays. Expression profiling Identifying
More informationSupporting Information
Supporting Information Efficient RNA synthesis by in vitro transcription of a triazole-modified DNA template Afaf H. El-Sagheer a,b and Tom Brown a a School of Chemistry, University of Southampton, Highfield,
More informationRecombinant DNA Technology
Recombinant DNA Technology Common General Cloning Strategy Target DNA from donor organism extracted, cut with restriction endonuclease and ligated into a cloning vector cut with compatible restriction
More informationBioMEMS for Future Drug Discovery Needs
BioMEMS for Future Drug Discovery Needs a report by Drs Arjun Selvakumar, 1 Yuh-Min Chiang, 1 Simon Sims 2 and Jamie Wibbenmeyer 2 1. Applied MEMS, Inc. and 2. Xeotron Corporation Introduction Billions
More informationAgilent PL-SAX Anion-Exchange Media for Nucleotide and Oligonucleotide Analysis
Agilent PL-SAX Anion-Exchange Media for Nucleotide and Oligonucleotide Analysis Technical Overview Introduction The physical stability of Agilent PL-SAX ensures rapid equilibration between separations,
More information