Supporting Information
|
|
- Betty Cook
- 6 years ago
- Views:
Transcription
1 Supporting Information Environmental DNA (edna) Shedding and Decay Rates to Model Freshwater Mussel edna Transport in a River Brandon J. Sansom 1 and Lauren M. Sassoubre 1* 1 Department of Civil, Structural, and Environmental Engineering, The State University of New York at Buffalo, Buffalo, New York * Corresponding author. Tel: Fax lsassoub@buffalo.edu Supporting Information contains: Number of pages: 8 Number of tables: 2 Number of figures: 3 S1
2 Materials and Methods Genus-specific assay design and QPCR optimization for Lampsilis siliquoidea To develop species specific primers, a representative mitochondrial sequence for the L. siliquoidea was downloaded from the National Center Biotechnology Information (NCBI) Genbank. 1 We specifically targeted the NADH gene and the cytochrome c oxidase subunit 1 (COI) gene because of sequence availability in Genbank. Primers and an internal hybridization oligo or probe were designed using PrimerBlast 2 with default parameters except: (1) primer melting temperature range C, (2) probe melting temperature range C, (3) GC content 35%-65% for both primers and probe, and (4) primer pair specificity checking against other mussel genera found in the same environment. The primer probe sets returned by the program were evaluated for the following criteria: (1) GC content around 50%, (2) a melting temperature between the primers less than 5 C, (3) a melting temperature between the primers and probe of 8-10 C, (4) primer and probe length, (4) no runs of 4 or more of the same base, (5) avoid a T base at the 3 end of the primers, (6) a C or G base at the 3 end of the primers, (7) no more than 3 C and/or G bases in the last 5 base pairs at the 3 end of the primers, and (8) avoid a G base at the 5 end of the probe (to avoid quenching of the fluorophore). Primer probe sets matching all the criteria were mapped onto an alignment made using Clustal Omega 3-5 of sequences from both target and non-target species to look for mismatches in the primer and probe regions. Primer and probe sets that were specific to the target species and contained the most mismatches with other non-target species were ordered from Integrated DNA Technologies (IDT) and tested with genomic DNA in the lab. Data Analysis The error associated with the shedding rate was determined by propagating errors associated with k, C, and V: δs S = ( δk k ) 2 + ( δc C ) 2 + ( δv V ) 2 (eqn. S1) where δ represents the standard deviation associated with each variable. Mass Balance Model and Derivation A simplified, one-dimensional plug-flow reactor model (equation 3) was developed to model L. siliquoidea edna as a function of distance from a mussel bed. The mass balance equation is a modification of the Navier-Stokes advection-diffusion equation for the x direction only: C C + u t x = E 2 C x x 2 kc (eqn. S2) where C represents the edna concentration (copies per ml), t represents time in days, u is the water velocity (m/s) in the streamwise direction (x-direction), E x is the diffusion coefficient in the streamwise direction, and k is the first-order decay constant. We assumed that the diffusive forces were negligible compared to advective forces, and thus simplified the equation to: C C + u = kc (eqn. S3) t x S2
3 Further, we assumed that the edna being released in the stream we are modeling is at steady state ( dc dt = 0): u C x = kc (eqn. S4) The steady state solution to equation S4 is: C = C o e kx u (eqn. S5) Here, C o represents the initial L. siliquoidea edna concentration in our stream. The concentration of L. siliquoidea edna in the environment depends on six main factors: 1) the population size, 2) the shedding rate, 3), the decay rate, 4), the advective forces of flow, 5) the distance edna is collected from its source, and 6) the time between when DNA is shed and when it is collected. The decay rate (k), advective force (u), and distance (x) are factors directly represented in equation S5. To initialize our model, we first had to make certain assumptions about C o to characterize the mussel bed, including population size, shedding rate, and time. To better represent this initial concentration at the mussel bed, we let C o = C bed and wrote C bed as a function of shedding (S, copies/hour/mussel), population size (M, mussels/m 3, and time (t, hours): C bed = S M t (eqn. S6) Because we did not observe statistical differences in shedding rates between mussel densities, we can assume that each mussel sheds a similar amount of edna on a per mussel basis. Therefore, we averaged the steady state concentration of edna (copies per hour per mussel) from the shedding and decay experiments performed in this study and input this value as our shedding rate (S ) in equation S6. In traditional mussel surveys, the population size of mussels is represented in units of mussels/m 2. While this is a good index to consider the size of a given population for sedentary organisms that live in the substratum, edna fragments are shed into and quickly mixed in the water column, especially in turbulent flows of natural streams. Therefore, to better represent how much edna is being shed into a volume of water, we represent the population size as mussels/m 3. From a practitioner standpoint, achieving units of mussels/m 3 is as simple as dividing the density of mussels in units of mussels/m 2 by the mean water depth (m). Finally, we observed a sharp increase in edna concentration initially after the mussels were added to the experimental tanks. In all experiments, the concentration leveled off after 12 hours and remained steady for the duration the mussels were in the mesocosms. Therefore, we assumed that steady state is reached within 12 hours, and used a time of 12 hours in our model. S3
4 Results and Discussion Figure S1: The qpcr calibration curve using gblock Gene Fragments synthesized by IDT (IDT, Coralville, IA) sequences. The pooled standard curves had a slope = and intercept = 33.1, resulting in an assay efficiency of 99.0% (r 2 = 0.93). Figure S2: edna concentration from the field samples collected from Tonawanda Creek as a function of distance downstream of a mussel bed. Error bars represent ± standard error of three biological samples, each ran in triplicate qpcr measurements. The predicted edna concentration determined by a onedimensional model is represented by the solid line. S4
5 Figure S3: The predicted edna concentration as a function of distance downstream of a mussel bed. Vertical dashed lines indicate the predicted downstream detection distance for varying volumes of water filtered. S5
6 Table S1. Sample collection information for shedding and decay experiments conducted in 2016, including date and time, hours since the start of the experiment, and presence or absence of Lampsilis siliquoidea in the tank. The bolded time points indicate when the edna concentration in the tank appeared to be at steady state where shedding balanced decay. Sample Number Moderate Density (replicate 1: 55 /m 2 experiment conducted from 09/17/ /18/2016) Start (hours) High Density (110 /m 2 experiment conducted from 09/17/ /18/2016) Start (hours) Environmental Treatment (Tonawanda Creek Water experiment conducted from 09/19/ /18/2016) Start (hours) 0 0:00 No 0:00 No 0:00 No 1 14:00 Yes 14:00 Yes 5:00 Yes 2 21:00 Yes 21:00 Yes 18:00 Yes 3 28:00 Yes 28:00 Yes 24:00 Yes 4 38:15 Yes 38:15 Yes 31:00 Yes 5 45:00 Yes 45:00 Yes 41:00 No 6 50:00 Yes 50:00 Yes 47:30 No 7 63:00 Yes 63:00 Yes 52:30 No 8 69:00 Yes 69:00 Yes 65:00 No 9 76:00 Yes 76:00 Yes 71:00 No 10 86:00 No 86:00 No 78:00 No 11 92:30 No 92:30 No 89:30 No 12 97:30 No 97:30 No 95:30 No :00 No 110:00 No 99:00 No :00 No 116:00 No 114:15 No :00 No 123:00 No 124:15 No :30 No 134:30 No 137:45 No :30 No 140:30 No 149:00 No :00 No 144:00 No 162:15 No :15 No 159:15 No 170:00 No :15 No 169:15 No 336:30 No :45 No 182:45 No 501:00 No :00 No 194:00 No 697:00 No :15 No 207:15 No :00 No 215:00 No :30 No 381:30 No :00 No 546:00 No :00 No 742:00 No S6
7 Table S2. Sample collection information for shedding and decay experiments conducted in 2017, including date and time, hours since the start of the experiment, and presence or absence of Lampsilis siliquoidea in the tank. The bolded time points indicate when the edna concentration in the tank appeared to be at steady state where shedding balanced decay. Sample Number Low Density (replicate 1: 16 /m 2 experiment conducted from 08/23/2017-9/21/2017) Start (hours) Low Density (replicate 2: 16 /m 2 experiment conducted from 08/23/2017-9/21/2017) Start (hours) Moderate Density (replicate 2: 55 /m 2 experiment conducted from 08/23/2017-9/21/2017 Start (hours) 0 0:00 No 0:00 No 0:00 No 1 16:25 Yes 16:25 Yes 16:25 Yes 2 23:55 Yes 23:55 Yes 23:55 Yes 3 40:25 Yes 40:25 Yes 40:25 Yes 4 48:25 Yes 48:25 Yes 48:25 Yes 5 64:25 Yes 64:25 Yes 64:25 Yes 6 74:10 Yes 74:10 Yes 74:10 Yes 7 87:55 No 87:55 No 87:55 No 8 98:05 No 98:05 No 98:05 No 9 112:25 No 112:25 No 112:25 No :55 No 120:55 No 120:55 No :40 No 136:40 No 136:40 No :25 No 145:25 No 145:25 No :55 No 160:55 No 160:55 No :25 No 168:25 No 168:25 No :25 No 183:25 No 183:25 No :40 No 361:40 No 361:40 No :25 No 695:25 No 695:25 No S7
8 References 1. Benson, D. A.; Karsch-Mizrachi, I.; Lipman, D. J.; Ostell, J.; Wheeler, D. L., GenBank. Nucleic acids research 2005, 33, (D1), D Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T. L., Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC bioinformatics 2012, 13, 134. S8
Guidelines for Developing Robust and Reliable PCR Assays
Guidelines for Developing Robust and Reliable PCR Assays Leta Steffen, PhD Applications Scientist Promega Corporation Outline 1) PCR reaction components What is in the reaction? How does it affect assay
More informationwas not peer-reviewed) is the author/funder, who has granted biorxiv a license to display the preprint in perpetuity.
qpcr assays for the detection of two western North American freshwater mussel species, Anodonta nuttalliana and Anodonta oregonensis, from environmental DNA Torrey W. Rodgers 1 and Karen E. Mock 1 1 -
More informationGUIDELINES FOR DESIGNING ENVIRONMENTAL DNA SURVEYS FOR TARGET SPECIES DRAFT. December 2015
GUIDELINES FOR DESIGNING ENVIRONMENTAL DNA SURVEYS FOR TARGET SPECIES DRAFT December 2015 Caren Goldberg Katherine Strickler Alexander Fremier Washington State University Pullman, WA 99164 Note: these
More informationAmplicon size (bp) E ± SD
Development of a probe-based qpcr assay for the detection of constitutional and somatic deletions in the NF1 gene. Application to genetic testing and tumor analysis. Terribas E, Garcia-Linares C, Lázaro
More informationPRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5
Molecular Biology-2017 1 PRESENTING SEQUENCES As you know, sequences may either be double stranded or single stranded and have a polarity described as 5 and 3. The 5 end always contains a free phosphate
More informationPCR PRIMER DESIGN SARIKA GARG SCHOOL OF BIOTECHNOLGY DEVI AHILYA UNIVERSITY INDORE INDIA
PCR PRIMER DESIGN SARIKA GARG SCHOOL OF BIOTECHNOLGY DEVI AHILYA UNIVERSITY INDORE-452017 INDIA BIOINFORMATICS Bioinformatics is considered as amalgam of biological sciences especially Biotechnology with
More informationqpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time
qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template
More informationAssay Design Considerations, Optimization and Validation
Assay Design Considerations, Optimization and Validation Ray Meng, Ph.D. International Field Applications Specialist Gene Expression Division Bio-Rad Laboratories, Inc. Assay Design Considerations Experiment
More informationUniversal Labeling of 5 -Triphosphate RNAs by Artificial RNA Ligase Enzyme with Broad Substrate Specificity
Universal Labeling of 5 -Triphosphate RNAs by Artificial RNA Ligase Enzyme with Broad Substrate Specificity John C. Haugner III and Burckhard Seelig* Department of Biochemistry, Molecular Biology and Biophysics
More information3 Designing Primers for Site-Directed Mutagenesis
3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed
More informationOptimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design
Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design The Polymerase Chain Reaction (PCR) is a powerful technique used for the amplification of a specific segment of a nucleic acid
More informationSupplemental Table S1. Experimental details of the qpcr analyses according to the checklist of the MIQE* guidelines.
Supplemental Table S1, page 1 Supplemental Table S1. Experimental details of the qpcr analyses according to the checklist of the MIQE* guidelines. ITEM TO ERXPERIMENTAL DESIGN Definition of experimental
More informationGenome Resources. Genome Resources. Maj Gen (R) Suhaib Ahmed, HI (M)
Maj Gen (R) Suhaib Ahmed, I (M) The human genome comprises DNA sequences mostly contained in the nucleus. A small portion is also present in the mitochondria. The nuclear DNA is present in chromosomes.
More informationFactors affecting PCR
Lec. 11 Dr. Ahmed K. Ali Factors affecting PCR The sequences of the primers are critical to the success of the experiment, as are the precise temperatures used in the heating and cooling stages of the
More informationPRIMEGENSw3 User Manual
PRIMEGENSw3 User Manual PRIMEGENSw3 is Web Server version of PRIMEGENS program to automate highthroughput primer and probe design. It provides three separate utilities to select targeted regions of interests
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationEpiQ Chromatin Analysis Kit Primer Design and qpcr Optimization Guide
EpiQ Chromatin Analysis Kit Primer Design and qpcr Optimization Guide Table of Contents I. INTRODUCTION II. PRIMER DESIGN A. Finding the target gene using the UCSC Genome Bioinformatics Site B. Identifying
More informationDiscovery of a trans-dichloroethene Respiring Dehalogenimonas in the 1,1,2,2-
Supplemental materials Discovery of a trans-dichloroethene Respiring Dehalogenimonas in the 1,1,2,2- Tetrachloroethane-Dechlorinating WBC-2 Consortium Authors Marie J. Manchester 1, Laura A. Hug 2, Matt
More informationqpcr course Alyona Minina Department of Plant Biology SLU
qpcr course Alyona Minina Department of Plant Biology SLU 2014 What do you want to know? Data Analysis and interpretation Lecture 2 Statistical analysis of qpcr How qpcr works Lecture 2 Application of
More informationBioinformatics Course AA 2017/2018 Tutorial 2
UNIVERSITÀ DEGLI STUDI DI PAVIA - FACOLTÀ DI SCIENZE MM.FF.NN. - LM MOLECULAR BIOLOGY AND GENETICS Bioinformatics Course AA 2017/2018 Tutorial 2 Anna Maria Floriano annamaria.floriano01@universitadipavia.it
More informationREAL TIME PCR USING SYBR GREEN
REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM
More informationSupplemental Materials. DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC
Supplemental Materials DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC BAA-1523 = JCM 15061) was grown in defined basal medium amended with 0.5 mm 1,1,2- trichloroethane (1,1,2-TCA)
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationFor detailed instructions about the TruSeq Custom Amplicon library preparation methods, refer to your reference guide.
1 TruSeq Custom Amplicon Script Welcome Navigation Objectives Welcome to the TruSeq Custom Amplicon course. Click next to begin. Take a moment to familiarize yourself with the navigation for this course.
More informationAccurately and reproducibly quantify as little as 20 fg of bacterial DNA using real-time PCR.
INSTRUCTION MANUAL Femto Bacterial DNA Quantification Kit Catalog No. E2006 Highlights Accurately and reproducibly quantify as little as 20 fg of bacterial DNA using real-time PCR. High specificity and
More informationPolymerase Chain Reaction-361 BCH
Polymerase Chain Reaction-361 BCH 1-Polymerase Chain Reaction Nucleic acid amplification is an important process in biotechnology and molecular biology and has been widely used in research, medicine, agriculture
More informationIntroduction to Real-Time PCR: Basic Principles and Chemistries
Introduction to Real-Time PCR: Basic Principles and Chemistries Leta Steffen, PhD Applications Scientist Promega Corporation Outline I. Real-Time PCR overview Basics of Real-Time PCR Understanding the
More informationCEE ENVIRONMENTAL QUALITY ENGINEERING PROBLEM SET #5
CEE 3510 -- ENVIRONMENTAL UALITY ENGINEERING PROBLEM SET #5 Problem 1. (adapted from Water uality by Tchobanoglous and Schroeder) A stream has a nearly uniform cross section, although it passes through
More informationSupporting Information for
Supporting Information for Ultra-selective and sensitive DNA detection by a universal apurinic/apyrimidinic probe-based Endonuclease IV signal amplification system Xianjin Xiao, Chen Song, Chen Zhang,
More informationQuality assurance in NGS (diagnostics)
Quality assurance in NGS (diagnostics) Chris Mattocks National Genetics Reference Laboratory (Wessex) Research Diagnostics Quality assurance Any systematic process of checking to see whether a product
More informationOpen Channel Flow. Ch 10 Young, Handouts
Open Channel Flow Ch 10 Young, Handouts Introduction Many Civil & Environmental engineering flows have a free surface open to the atmosphere Rivers, streams and reservoirs Flow in partially filled pipes
More information7/24/2012. DNA Probes. Hybridization and Probes. CLS 420 Immunology & Molecular Diagnostics. Target Sequences. Target Sequences. Nucleic Acid Probes
Hybridization and Probes CLS 420 Immunology & Molecular Diagnostics Molecular Diagnostics Techniques: Hybridization and Probes Nucleic acid probes: A short, known sequence of DNA or RNA Used to detect
More informationFully Automated Library Quantification for Illumina Sequencing on the NGS STAR
Fully Automated Library Quantification for Illumina Sequencing on the NGS STAR Introduction Hamilton Robotics, an industry leader in liquid handling and laboratory automation equipment, has partnered with
More informationBiology 644: Bioinformatics
Measure of the linear correlation (dependence) between two variables X and Y Takes a value between +1 and 1 inclusive 1 = total positive correlation 0 = no correlation 1 = total negative correlation. When
More informationGene Signal Estimates from Exon Arrays
Gene Signal Estimates from Exon Arrays I. Introduction: With exon arrays like the GeneChip Human Exon 1.0 ST Array, researchers can examine the transcriptional profile of an entire gene (Figure 1). Being
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationPREDICT Host DNA Barcoding Guide
PREDICT Host DNA Barcoding Guide Contents: 1. Rationale for Barcoding.. Page 2 2. Implementation... Page 2 3. PCR Protocols.... Page 3 4. Data Interpretation... Page 5 5. Data Entry into EIDITH.... Page
More informationExperiment (5): Polymerase Chain Reaction (PCR)
BCH361 [Practical] Experiment (5): Polymerase Chain Reaction (PCR) Aim: Amplification of a specific region on DNA. Primer design. Determine the parameters that may affect he specificity, fidelity and efficiency
More informationSuccessful gene expression studies using validated qpcr assays. Jan Hellemans, CEO Biogazelle webinar October 28 th, 2015
Successful gene expression studies using validated qpcr assays Jan Hellemans, CEO Biogazelle webinar October 28 th, 2015 Agenda Requirements for high quality qpcr assays Approaches for qpcr assay validation
More informationSupplementary material. Applied Microbiology and Biotechnology
Supplementary material Applied Microbiology and Biotechnology Identification and quantification of Thiothrix eikelboomii using qpcr for early detection of bulking incidents in a full-scale water reclamation
More informationNucleic Acid Research Group Real-Time PCR Survey
Nucleic Acid Research Group Real-Time PCR Survey Association of Biomolecular Resource Facilities (ABRF) INTRODUCTION: This survey is designed to determine the current status of real-time PCR technology
More informationEstimation of Enterococcus qpcr target sequence recoveries from EPA NEEAR study calibrator samples 2014 UNC Water Micro Conference
Estimation of Enterococcus qpcr target sequence recoveries from EPA NEEAR study calibrator samples 2014 UNC Water Micro Conference Office of Research and Development May 2014. Notice: Although this work
More informationStandardisation of real-time PCR. Dr P. Lewis White Public Health Wales
Standardisation of real-time PCR Dr P. Lewis White Public Health Wales The MIQE Guidelines Publications reporting real-time PCR are ubiquitous Lack of sufficient experimental detail Limits the potential
More informationSupplementary Data: Fig. 1S Detailed description of In vivo experimental design
1 2 Supplementary Data: Fig. 1S Detailed description of In vivo experimental design 3 4 5 6 7 8 9 Relative Expression Studies 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 The
More informationFunctional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
More informationCulture Vs. qpcr. Daniel Grandio Gonzalez
Culture Vs. qpcr Daniel Grandio Gonzalez Introduction Legionelosis, Pontiac Fever, Mycobacteriosis Legionella: Hot water tanks, showers, cooling towers, swimming pools Environmental Mycobacteria: Purified
More informationHigh specificity and sensitivity for fungal DNA allows reliable quantification in a background of nonfungal. Contents
INSTRUCTION MANUAL Femto Fungal DNA Quantification Kit Catalog No. E2007 Highlights Accurately and reproducibly quantify as little as 20 fg of fungal DNA from 1 µl of sample using realtime PCR. High specificity
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationEnvironmental DNA (edna) at the University of Illinois: A new resource for freshwater conservation and management of invasive species
Environmental DNA (edna) at the University of Illinois: A new resource for freshwater conservation and management of invasive species Eric R. Larson erlarson@illinois.edu Mark A. Davis davis63@illinois.edu
More informationDNA Hybridization and Detection
Chapter 6 DNA Hybridization and Detection Fluorescence Polarization Detection of DNA Hybridization........................................................ 6-2 Introduction.............................................................................................................
More informationIterated Conditional Modes for Cross-Hybridization Compensation in DNA Microarray Data
http://www.psi.toronto.edu Iterated Conditional Modes for Cross-Hybridization Compensation in DNA Microarray Data Jim C. Huang, Quaid D. Morris, Brendan J. Frey October 06, 2004 PSI TR 2004 031 Iterated
More informationHow One NGS Core Lab Reduced Sequencing Costs with a Novel Library Normalization Kit
How One NGS Core Lab Reduced Sequencing Costs with a Novel Library Normalization Kit GenomeWebinar March 27, 2019 Julia Karow GenomeWeb Tony Brooks UCL Genomics Mida Pezeshkian Swift Biosciences GenomeWebinar
More informationPolymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr
Polymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr review Enzyme based DNA amplification Thermal Polymerarase derived from a thermophylic bacterium DNA dependant DNA polymerase
More informationSALSA MLPA probemix P200-A1 Human DNA Reference-1 Lot A1-1113, Lot A1-0410, A1-0209, A1-0408
SALSA MLPA probemix P200-A1 Human DNA Reference-1 Lot A1-1113, Lot A1-0410, A1-0209, A1-0408 The P200-A1 Human DNA Reference-1 probemix contains reference probes and control fragments specific for unique
More informationAssay Designs and Protocols: Sequenom EpiTYPER
Assay Designs and Protocols: Sequenom EpiTYPER Introduction EpiTYPER assay bisulphite conversion followed by PCR and a base-specific cleavage that depends on the presence of methylated cytosine in the
More informationAutomation of xgen hybridization capture on the Sciclone G3 NGS Workstation
next generation sequencing protocol Automation of xgen hybridization capture on the Sciclone G3 NGS Workstation www.idtdna.com For Research Use Only Version 2 Revision history Document version Date released
More informationUsing AccuCaL-D and the RealCount software for robust quantitation of gene copy number
Using AccuCaL-D and the RealCount software for robust quantitation of gene copy number AccuCal-D, ACCUGEN s improved method for absolute quantitation of gene copy number Quantitative real-time PCR (qpcr)
More informationINVESTIGATION OF FLOW CHARACTERISTICS OF HELLER-TYPE COOLING TOWERS WITH DIFFERENT COOLING DELTA ANGLES
PERIODICA POLYTECHNICA SER. MECH. ENG. VOL. 47, NO. 2, PP. 143 150 (2003) INVESTIGATION OF FLOW CHARACTERISTICS OF HELLER-TYPE COOLING TOWERS WITH DIFFERENT COOLING DELTA ANGLES Nimród KAPÁS Department
More informationEuropean Union Reference Laboratory for Genetically Modified Food and Feed
Report on the Verification of the Performance of MON 87751, MON 87701, MON 87708 and MON 89788 Event-specific PCR-based Methods Applied to DNA Extracted from GM Stack MON 87751 x MON 87701 x MON 87708
More informationncounter Low RNA Input Amplification Kit
ncounter Low RNA Input Amplification Kit The ncounter Low RNA Input Amplification Kit is designed to produce sufficient target for detection in an ncounter hybridization assay. This multiplexed target
More informationNature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets.
Supplementary Figure 1 ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Gene structures are shown underneath each panel. Supplementary Figure 2 pref6::ref6-gfp complements
More informationEuropean Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)
Guideline for the submission of DNA sequences derived from genetically modified organisms and associated annotations within the framework of Directive 2001/18/EC and Regulation (EC) No 1829/2003 European
More informationOptimizing Multiplex qpcr for Detecting Infectious Diseases
Optimizing Multiplex qpcr for Detecting Infectious Diseases Aurita Menezes Ph.D, qpcr Product Manager Integrated DNA Technologies Agenda Establishing robust multiplex assays In the context of Gene expression
More informationMaximizing your NGS sequencing with IDT. Adam Chernick, PhD Field Applications Manager, Functional Genomics
Maximizing your NGS sequencing with IDT Adam Chernick, PhD Field Applications Manager, Functional Genomics 1 Contents Expanding our NGS portfolio what s next? xgen technology and Lockdown probe advantages
More informationRoche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
More informationRapid DNA amplification in a capillary tube by natural convection with a single isothermal heater
Supplementary Materials For: Rapid DNA amplification in a capillary tube by natural convection with a single isothermal heater Wen Pin Chou 1, Ping Hei Chen 1, Jr Ming Miao 2, Long Sheng Kuo 1, Shiou Hwei
More informationExecutive Summary. clinical supply services
clinical supply services case study Development and NDA-level validation of quantitative polymerase chain reaction (qpcr) procedure for detection and quantification of residual E.coli genomic DNA Executive
More informationConfidence bands and p-values for qpcr data using the double delta model (DDM)
Confidence bands and p-values for qpcr data using the double delta model (DDM) 6 Jakomijn Hoogendam 1, Geertje van der Horst 2, Jan M. Wit 1, Marcel Karperien 1,2, Paul H.C. Eilers 3 1 Department of Paediatrics,
More informationRead Quality Assessment & Improvement. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016
Read Quality Assessment & Improvement UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 QA&I should be interactive Error modes Each technology has unique error modes, depending on the physico-chemical
More informationTwisted Intercalating Nucleic Acid (TINA) a novel group of molecules with improved performance in PCR and qpcr applications
Twisted Intercalating Nucleic Acid (TINA) a novel group of molecules with improved performance in PCR and qpcr applications Dr. Rainer Schubbert, Eurofins Medigenomix 19.03.2013 www.eurofins.de Topics
More informationWeb-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide.
Page 1 of 18 Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. When and Where---Wednesdays 1-2pm Room 438 Library Admin Building Beginning September
More informationUsing Genetics for Species Identification
Using Genetics for Species Identification John Hyde NOAA Southwest Fisheries Science Center La Jolla, California USA December 6, 2013 2 Important Point to Consider Not all specimens need to be genetically
More informationNextGen Sequencing Technologies Sequencing overview
Outline Conventional NextGen High-throughput sequencing (Next-Gen sequencing) technologies. Illumina sequencing in detail. Quality control. Sequence coverage. Multiplexing. FASTQ files. Shendure and Ji
More informationFACULTY OF LIFE SCIENCES
FACULTY OF LIFE SCIENCES SYLLABUS FOR Interdisciplinary Course Biotechnology (UG & PG) (Under Credit Based Continuous Evaluation Grading System) Examinations: 2015-16 GURU NANAK DEV UNIVERSITY AMRITSAR
More informationLightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping
LightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping Introduction Commercial master mixes are convenient and cost-effective solutions for
More informationArray-Ready Oligo Set for the Rat Genome Version 3.0
Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.
More informationMicroRNA profiling directly from low amounts of plasma or serum using the Multiplex Circulating mirna Assay with Firefly particle technology
Technical note MicroRNA profiling directly from low amounts of plasma or serum using the Multiplex Circulating mirna Assay with Firefly particle technology Abstract We introduce a new assay that enables
More informationBiochemistry 674: Nucleic Acids Your Name:
Biochemistry 674: Nucleic Acids Your Name: Exam II, November 18, 1997 Prof. Jason Kahn You do not need a calculator. Guess if you don t know. Give clear and concise answers. You have 85 minutes for this
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationEvent COT102 Cotton. Real-time, Event-specific Polymerase Chain Reaction Method
Event COT102 Cotton Real-time, Event-specific Polymerase Chain Reaction Method Syngenta Crop Protection, LLC 3054 East Cornwallis Road PO Box 12257 Research Triangle Park, NC 27709-2257, USA For technical
More informationELB18S. Entry Level Bioinformatics. Basic Bioinformatics Sessions. Practical 4: Primer Design November (Second 2018 run of this Course)
ELB18S Entry Level Bioinformatics 05-09 November 2018 (Second 2018 run of this Course) Basic Bioinformatics Sessions Primer Design The prime intention of this exercise is to design a way to amplify a DNA
More informationA peer-reviewed version of this preprint was published in PeerJ on 16 March 2018.
A peer-reviewed version of this preprint was published in PeerJ on 16 March 2018. View the peer-reviewed version (peerj.com/articles/4473), which is the preferred citable publication unless you specifically
More informationDownload the Lectin sequence output from
Computer Analysis of DNA and Protein Sequences Over the Internet Part I. IN CLASS Download the Lectin sequence output from http://stan.cropsci.uiuc.edu/courses/cpsc265/ Open these in BioEdit (free software).
More informationUser Bulletin. ABI PRISM 7000 Sequence Detection System DRAFT. SUBJECT: Software Upgrade from Version 1.0 to 1.1. Version 1.
User Bulletin ABI PRISM 7000 Sequence Detection System 9/15/03 SUBJECT: Software Upgrade from Version 1.0 to 1.1 The ABI PRISM 7000 Sequence Detection System version 1.1 software is a free upgrade. Also
More informationFigure S1 Correlation in size of analogous introns in mouse and teleost Piccolo genes. Mouse intron size was plotted against teleost intron size for t
Figure S1 Correlation in size of analogous introns in mouse and teleost Piccolo genes. Mouse intron size was plotted against teleost intron size for the pcloa genes of zebrafish, green spotted puffer (listed
More informationIdentifying Regulatory Regions using Multiple Sequence Alignments
Identifying Regulatory Regions using Multiple Sequence Alignments Prerequisites: BLAST Exercise: Detecting and Interpreting Genetic Homology. Resources: ClustalW is available at http://www.ebi.ac.uk/tools/clustalw2/index.html
More informationB. Incorrect! Ligation is also a necessary step for cloning.
Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease
More informationAnalysis of Side Sluice in Trapezoidal Channel
Analysis of Side Sluice in Trapezoidal Channel Dr. L. G. Patil 1, Amol M. Kode 2 1 Associate Professor, Department of Civil Engineering, SGGSIE&T, Nanded 2 M. Tech Student, Department of Civil Engineering,
More informationUser Manual. NGS Library qpcr Quantification Kit (Illumina compatible)
NGS Library qpcr Quantification Kit (Illumina compatible) User Manual 384 Oyster Point Blvd, Suite 15 South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 872-0253 www.mclab.com Contents
More informationModule1TheBasicsofRealTimePCR Monday, March 19, 2007
Objectives Slide notes: Page 1 of 41 Module 1: The Basics Of Real Time PCR Slide notes: Module 1: The Basics of real time PCR Page 2 of 41 Polymerase Chain Reaction Slide notes: Here is a review of PCR,
More informationBiochemistry. Dr. Shariq Syed. Shariq AIKC/FinalYB/2014
Biochemistry Dr. Shariq Syed Shariq AIKC/FinalYB/2014 What is DNA Sequence?? Our Genome is made up of DNA Biological instructions are written in our DNA in chemical form The order (sequence) in which nucleotides
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationData Retrieval from GenBank
Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing
More informationAmino-allyl Dye Coupling Protocol
Amino-allyl Dye Coupling Protocol Joseph DeRisi, June 2001 Typically, fluorescently labeled cdna is generated by incorporation of dyeconjugated nucleotide analogs during the reverse transcription process.
More informationSelecting Specific PCR Primers with MFEprimer. Wubin Qu and Chenggang Zhang
Chapter 15 Selecting Specific PCR Primers with MFEprimer Abstract Selecting specific primers is crucial for polymerase chain reaction (PCR). Nonspecific primers will bind to unintended genes and result
More informationDeoxyribonucleic Acid DNA
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationBoost Your Real-Time Results
Boost Your Real-Time Results Refresh your knowledge of the fundamentals of real-time PCR Sample & Assay Technologies 1 Introduction Real-time PCR and RT-PCR are highly sensitive techniques that enable
More informationDesigning CRISPR mediated Gene disruptions with gblocks Gene Fragments
Designing CRISPR mediated Gene disruptions with gblocks Gene Fragments Adam Clore, PhD Manager, Synthetic Biology Design Integrated DNA technology Typical CRISPR timeline in Mammalian cell lines Design
More informationLoss of Native Allele Protocol for KOMP-Regeneron derived ESC lines January 9 th 2009
Loss of Native Allele Protocol for KOMP-Regeneron derived ESC lines January 9 th 2009 I. Alkaline DNA extraction in 96 well format Solutions 50mM NaOH 1M Tris-HCl ph 8.0 1. Grow ES cells in a 96-well TC
More information