Mammosphere formation assay. Mammosphere culture was performed as previously described (13,

Size: px
Start display at page:

Download "Mammosphere formation assay. Mammosphere culture was performed as previously described (13,"

Transcription

1 Supplemental Text Materials and Methods Mammosphere formation assay. Mammosphere culture was performed as previously described (13, 17). For co-culture with fibroblasts and treatment with CM or CCL2, fibroblasts were grown on top of 0.4-μmpore-size transwell filters (Nunc; Rochester, NY) and CM collected from differentially treated cells, or recombinant CCL2 were added to ultralow attachment 6-well plates (Corning; Corning, NY) containing freshly plated single BC cells at the beginning of the mammosphere formation assay. On day 10, numbers of mammospheres (diameter 70 μm) were counted, and SFE was calculated based on the numbers of initially seeded cells. For secondary sphere formation, first-passage mammospheres from day 10 cultures were collected by gentle centrifugation (320 g) and dissociated into single cells by incubation in trypsin-edta solution (Invitrogen; Carlsbad, CA), before plating into new wells. The PKH67 fluorescence labeling experiments were performed as previously described (19). In brief, BC cells were labeled with PKH67 (Sigma-Aldrich) following the manufacturer s procedures, before plating into ultralow attachment wells for mammosphere formation. On day 10, spheres were analyzed by confocal microscopy, or dissociated into single cells prior to fluorescenceactivated cell sorting on PKH67 intensity. Sorted PKH67 hi and PKH67 low cells were then used in the secondary mammosphere formation assay. RNA extraction, reverse transcription (RT) and real-time quantitative PCR (qpcr). RNA extraction, RT, and qpcr were performed as described previously (40). Primer sequences used are: 5 - AAGATCTCAGTGCAGAGGCTCG-3 and 5 -TTGCTTGTCCAGGTGGTCCAT-3 for human CCL2, 5 - GGTGAGACCTGCCTGAATG-3 and 5 -GTTGGGGTCCTGGCATC-3 for human NOTCH1, 5 - GGTTTTTGGCGGCTTCCAAG-3 and 5 -TCAGTTCCGCCACGGTCTC-3 for human HES1, and 5 - CTACCACATCCAAGGAAGCA-3 and 5 -TTTTTCGTCACTACCTCCCCG-3 for human 18S rrna (as internal control for all RT-qPCR). An annealing temperature of 55 C was used for all the primers. Cytokine antibody array and Western blot analyses. CM collected from 10 6 of cells were concentrated ~10-fold using Amicon Ultra-15 3K centrifugal filter devices (Millipore; Billerica, MA), and then assayed using RayBio human cytokine antibody arrays 6 8 (RayBiotech; Norcross, GA), following the

2 manufacturer s protocol. Preparation of cell lysates and Western blot were carried out as described previously (41). Primary antibodies included: Phospho(P)-Stat3 Y705, Stat3, NICD1, NOTCH1, P-p38 T180/Y182 and p38 (Cell Signaling). Cell transfection, reporter assays, and RNAi studies. DNA transfection was performed using Lipofectamine 2000 (Invitrogen) following the manufacturer s protocol, as described previously (42). The FlexiTube GeneSolution sirnas for NOTCH1 and AllStars negative control sirnas were purchased from Qiagen (Valencia, CA), and transfected using DharmaFECT Duo Transfection Reagent (Dharmacon; Lafayette, CO) according to the manufacturer s procedures. For luciferase reporter assays, cells growing in 12-well plates were transfected with 0.5 µg of CCL2 or NOTCH1 promoter reporters (kindly provided by Drs. Leonid S. Metelitsa and Warren S. Pear, respectively), along with 0.01 µg of pcmv-renilla plasmid as an internal control. Firefly and Renilla luciferase activities were measured using the dual luciferase assay system (Promega; Madison, WI), as described previously (40). In vitro secretase assays. Solubilized membrane extracts were prepared as described previously (43). Synthetic fluorescent resonance energy transfer (FRET) peptide substrates for α- or γ-secretase (Calbiochem; 10 μl of 100 μm stock) were incubated with the membrane extracts (100 μg in 100 μl), in the presence or absence of the α/γ-secretase inhibitors INCB3619 (5 μm) or DAPT (10 μm) at 37ºC overnight in dark. At the end of the incubation, the fluorescence in each sample was measured by a fluorescence spectrometer using excitation wavelength at 325 nm and emission wavelength at 393 nm for the α-secretase substrate, and excitation wavelength at 355 nm and emission wavelength at 440 nm for the γ-secretase substrate. Xenografts. All animal experiments were approved by the institutional animal care and use committee at City of Hope. Six-week-old female NOD/SCID/IL2Rγ-null (NSG) mice were injected in the No. 4 mammary fat pad with a mixture of 10 5 freshly dissociated, unmodified XP primary BC cells and CAF isolated from the same BC specimen but in vitro transduced with phiv7-tetr-ires-gfp lentivirus carrying Dox-inducible CCL2 shrna (for fibroblast-specific CCL2 depletion) or pbabe-gfp retrovirus (for CCL2 neutralizing antibody treatment). In the shrna study, mice were divided into 2 groups (n = 8 per group) for treatment with Dox or control. For the group with Dox treatment, mice were administered 1

3 mg/ml Dox in 5% sucrose through the drinking water starting at 2 days before transplantation. In the study with CCL2 antibody, mice were divided into 3 groups (n = 8 per group). CCL2 neutralizing antibody (Catalog #AB-279-NA) or goat IgG control (Catalog #AB-108-C) purchased from R&D Systems (Minneapolis, MN), or equal volume of PBS, were administered through intraperitoneal (i.p.) injection three times a week at 5 mg/kg, starting at the next day after transplantation. The same CCL2 neutralizing antibody and IgG control were used in sphere formation assay (Fig. 1F) and CM preparation (Fig. 4G) at a final concentration of 30 ng/ml. When tumor became palpable, tumor volume was assessed every other day by caliper measurements using the formula (width 2 length)/2 (mm 3 ). At the end of each experiment, harvested tumors were mechanically and enzymatically dissociated, and the epithelial tumor cells and CAFs were purified by flow cytometry using human ESA (for tumor cells) and the GFP label on CAFs as markers.

4 Supplemental Figures Figure S1. Marker expression in primary fibroblasts and BC cells. (A) Western blot analysis of Vimentin and GAPDH in NAF2 and CAF after treatment with the CM from BT474 or XP BC cells for 3 or 10 days. (B) Immunofluorescence assay indicating SMA expression in a fraction of Vimentin-expressing primary CAF Bar equals 100 μm. (C) Flow cytometry indicating ESA expression in the majority of primary XP epithelial tumor cells and lack of ESA in primary CAF

5 Figure S2. Serial confocal images of representative mammospheres formed by PKH67-labeled BT474 cells in the presence or absence of CCL2. Scale bar equals 20 μm.

6 Figure S3. CCL2 expression in CAF3 cells upon CM treatments. Total RNA isolated from CAF3 that had been treated with CM from indicated BC cells for 4 or 24 h in the presence or absence of Stattic was analyzed for CCL2 mrna level by RT-qPCR. Data were normalized to 18S in each sample. * p<0.001 compared to the control (the first column).

7 Figure S4. Sustained CCL2 induction in CAFs co-cultured with tumor cells. RNA was isolated from CAF that had been co-cultured with XP tumor cells for indicated time in the presence or absence of Stattic. Expression of CCL2 was assessed by RT-qPCR. * p<0.001 compared to the control (the first column).

8 Figure S5. Expression of CCR2 and CCR4 in BC cells. RNA was extracted from indicated BC cells and subjected to RT-qPCR for the expression of CCR2 and CCR4. Data were normalized to 18S in each sample.

9 Figure S6. HES1 and HEY1 reporter assays in BT474 cells. Luciferase activity was analyzed in reportertransfected BT474 cells at 24 h post CCL2 treatment +/- inhibitors of γ-secretase (DAPT; 10 nm) or α-secretase (INCB3619; 5 nm). Each bar represents the mean ± S.D. of 3 independently transfected wells. * p<0.001 compared to the control (the first column).

10 Figure S7. In vitro secretase cleavage assay. The solubilized plasma membrane extracts prepared from BT474 cells treated with CCL2 or vehicle were incubated with synthetic fluorescent resonance energy transfer (FRET) substrates for α- or γ-secretase. As controls for the specificity of FRET substrates, DAPT or INCB3619 was added to the untreated BT474 membrane extracts. At the end of the incubation, the fluorescence absorbance (ABS) in each sample was measured, as indicated in the graph. Each bar represents the mean ± S.D. of 3 independent wells. * p<0.001 compared to the control (the first column).

11 Figure S8. Representative IHC images of XP/CAF xenograft tumors treated with PBS, IgG, or anti-ccl2. Serial sections of tumors were stained for human CCL2, NOTCH1, and SMA. Bar equals 100 μm.

12 Figure S9. Representative IHC images of CCL2 and NOTCH1 in primary BC specimens. Images from two specimens were shown. Bar equals 100 μm.

SUPPLEMENTAL FIGURES AND TABLES

SUPPLEMENTAL FIGURES AND TABLES SUPPLEMENTAL FIGURES AND TABLES A B Flag-ALDH1A1 IP: α-ac HEK293T WT 91R 128R 252Q 367R 41/ 419R 435R 495R 412R C Flag-ALDH1A1 NAM IP: HEK293T + + - + D NAM - + + E Relative ALDH1A1 activity 1..8.6.4.2

More information

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1. A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200

More information

Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered

Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl

More information

Supplemental Methods Cell lines and culture

Supplemental Methods Cell lines and culture Supplemental Methods Cell lines and culture AGS, CL5, BT549, and SKBR were propagated in RPMI 64 medium (Mediatech Inc., Manassas, VA) supplemented with % fetal bovine serum (FBS, Atlanta Biologicals,

More information

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of Fig. S1 TGF RI inhibitor SB525334 effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of different concentrations of SB525334. Cells were lysed and

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION (Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).

More information

Supplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after

Supplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after Supplementary Information: Materials and Methods Recombinant protein expression and in vitro kinase assay. GST and GST-p53 were purified according to standard protocol after induction with.5mm IPTG for

More information

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of

More information

RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the

RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the

More information

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα

More information

Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3

Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3 ChIP H3K4Me3 enrichment.25.2.15.1.5 H3K4Me3 H3K4Me3 ctrl H3K4Me3 + E2 NS + E2 1. kb kb +82 kb Figure S1. Estrogen promotes entry of MCF-7 into the cell cycle but does not significantly change activation-associated

More information

Supplemental methods:

Supplemental methods: Supplemental methods: ASC-J9 treatment ASC-J9 was patented by the University of Rochester, the University of North Carolina, and AndroScience Corp., and then licensed to AndroScience Corp. Both the University

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

Supplementary information for: Mutant p53 gain-of-function induces epithelial-mesenchymal transition. through modulation of the mir-130b-zeb1 axis

Supplementary information for: Mutant p53 gain-of-function induces epithelial-mesenchymal transition. through modulation of the mir-130b-zeb1 axis Supplementary information for: Mutant p53 gain-of-function induces epithelial-mesenchymal transition through modulation of the mir-3b-zeb axis AUTHORS: Peixin Dong, Mihriban Karaayvaz, Nan Jia, Masanori

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION The Supplementary Information (SI) Methods Cell culture and transfections H1299, U2OS, 293, HeLa cells were maintained in DMEM medium supplemented with 10% fetal bovine serum. H1299 and 293 cells were

More information

cells (MLEC) that produce luciferase under the control of the PAI-1 promoter in response to

cells (MLEC) that produce luciferase under the control of the PAI-1 promoter in response to Supplemental Materials and Methods TGF bioassay. To quantify the levels of active and total TGF, we used mink lung epithelial cells (MLEC) that produce luciferase under the control of the PAI-1 promoter

More information

Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy

Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy of various tumor type TRCs, including H22 (murine hepatocarcinoma) and CT26 (murine colon cancer). Bar, 50 µm. b, B16 cells

More information

Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell

Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell Supplementary Figures S1-S3 Supplementary Methods Supplementary Figure S1. Identification

More information

SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION

SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION SUPPLEMENTAL MATERIALS SIRTUIN PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF ACTIVATION Haranatha R. Potteti*, Subbiah Rajasekaran*, Senthilkumar B. Rajamohan*, Chandramohan R. Tamatam,

More information

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative

More information

Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1

Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 a His-ORMDL3 ~ 17 His-ORMDL3 GST-ORMDL3 - + - + IPTG GST-ORMDL3 ~ b Integrated Density (ORMDL3/ -actin) 0.4 0.3 0.2 0.1

More information

Reagents and cell culture Mcl-1 gene expression: real-time quantitative RT-PCR In vitro PP2A phosphatase assay Detection of Mcl-1 in vivo

Reagents and cell culture Mcl-1 gene expression: real-time quantitative RT-PCR In vitro PP2A phosphatase assay Detection of Mcl-1 in vivo Reagents and cell culture Antibodies specific for caspase 3, PARP and GAPDH were purchased from Cell Signaling Technology Inc. (Beverly, MA). Caspase inhibitor z-vad-fmk and ROS scavenger N-acetyl-Lcysteine

More information

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG. Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Supplementary Figure 1. PKM2 interacts with MLC2 in cytokinesis. a, U87, U87/EGFRvIII, and HeLa cells in cytokinesis were immunostained with DAPI and an anti-pkm2 antibody. Thirty

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

Supplemental material

Supplemental material Supplemental material THE JOURNAL OF CELL BIOLOGY Taylor et al., http://www.jcb.org/cgi/content/full/jcb.201403021/dc1 Figure S1. Representative images of Cav 1a -YFP mutants with and without LMB treatment.

More information

SUPPLEMENTAL FIGURE LEGENDS

SUPPLEMENTAL FIGURE LEGENDS SUPPLEMENTAL FIGURE LEGENDS Suppl. Fig. 1. Notch and myostatin expression is unaffected in the absence of p65 during postnatal development. A & B. Myostatin and Notch-1 expression levels were determined

More information

Data Sheet PD-1 / NFAT - Reporter - Jurkat Recombinant Cell Line Catalog #: 60535

Data Sheet PD-1 / NFAT - Reporter - Jurkat Recombinant Cell Line Catalog #: 60535 Data Sheet PD-1 / NFAT - Reporter - Jurkat Recombinant Cell Line Catalog #: 60535 Product Description Recombinant Jurkat T cell expressing firefly luciferase gene under the control of NFAT response elements

More information

Supplemental Information

Supplemental Information Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai

More information

used at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies were

used at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies were 1 Supplemental Methods Reagents and chemicals: TGFβ was a generous gift from Genzyme Inc. (Cambridge, MA) and was used at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies

More information

SUPPLEMENTAL MATERIAL. Supplemental Methods:

SUPPLEMENTAL MATERIAL. Supplemental Methods: SUPPLEMENTAL MATERIAL Supplemental Methods: Immunoprecipitation- As we described but with some modifications [22]. As part of another ongoing project, lysate from human umbilical vein endothelial cells

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1

More information

Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and

Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary

More information

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm

More information

Data Sheet. SBE Reporter Kit (TGFβ/SMAD signaling pathway) Catalog #: 60654

Data Sheet. SBE Reporter Kit (TGFβ/SMAD signaling pathway) Catalog #: 60654 Data Sheet SBE Reporter Kit (TGFβ/SMAD signaling pathway) Catalog #: 60654 Background The transforming growth factor beta (TGFβ) signaling pathway is involved in a diverse range of cell processes such

More information

Supplemental Material Igreja and Izaurralde 1. CUP promotes deadenylation and inhibits decapping of mrna targets. Catia Igreja and Elisa Izaurralde

Supplemental Material Igreja and Izaurralde 1. CUP promotes deadenylation and inhibits decapping of mrna targets. Catia Igreja and Elisa Izaurralde Supplemental Material Igreja and Izaurralde 1 CUP promotes deadenylation and inhibits decapping of mrna targets Catia Igreja and Elisa Izaurralde Supplemental Materials and methods Functional assays and

More information

Tumor tissues or cells were homogenized and proteins were extracted using

Tumor tissues or cells were homogenized and proteins were extracted using SUPPLEMENTAL MATERIALS AND METHODS Western Blotting Tumor tissues or cells were homogenized and proteins were extracted using T-PER tissue protein extraction buffer. Protein concentrations were determined

More information

In general, 8- to 10-week-old adult females were ovariectomized and rested for 10 days

In general, 8- to 10-week-old adult females were ovariectomized and rested for 10 days Animal injections and tissue processing In general, 8- to 10-week-old adult females were ovariectomized and rested for 10 days before they received any injections. Mice were injected with sesame seed oil

More information

Single cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor

Single cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor SUPPLEMENTARY INFORMATION Single cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor Anna Turetsky 1,a, Eunha Kim 1,a, Rainer H. Kohler 1, Miles A. Miller 1, Ralph Weissleder 1,2,

More information

Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).

Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences). Mice C57BL/6-Ly5.1 or -Ly5.2 congenic mice were used for LSK transduction and competitive repopulation assays. Animal care was in accordance with the guidelines of Keio University for animal and recombinant

More information

Supplementary methods

Supplementary methods Supplementary methods Cell culture, infection, transfection, and RNA interference HEK293 cells and its derivatives were grown in DMEM supplemented with 10% FBS. Various constructs were introduced into

More information

Comparative Analysis of Argonaute-Dependent Small RNA Pathways in Drosophila

Comparative Analysis of Argonaute-Dependent Small RNA Pathways in Drosophila Molecular Cell, Volume 32 Supplemental Data Comparative Analysis of Argonaute-Dependent Small RNA Pathways in Drosophila Rui Zhou, Ikuko Hotta, Ahmet M. Denli, Pengyu Hong, Norbert Perrimon, and Gregory

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure a T m ( C) Seq. '-3' uguuugugguaacagugugaggu L 62 AttGtcAcaCtcC L2 6 ccattgtcacactcc L3 66 attgtcacactcc 7 ccattgtcacactcca L 73 ccattgtcacactcc L6 74 AttGTcaCaCtCC L7 7 attgtcacactcc

More information

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53 Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -

More information

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin

More information

Assays for gene expression and protein production

Assays for gene expression and protein production Assays for gene expression and protein production Module 3, Lecture 5! 20.109 Spring 2011! Topics for Lecture 5 Measuring protein levels! Measuring transcript levels! Imaging assays! 2 Module overview:

More information

The Transfection Collection TCF/LEF Transient Pack Wnt / -catenin Signaling Pathway Catalog #: 79273

The Transfection Collection TCF/LEF Transient Pack Wnt / -catenin Signaling Pathway Catalog #: 79273 Data Sheet The Transfection Collection TCF/LEF Transient Pack Wnt / -catenin Signaling Pathway Catalog #: 79273 Background The Wnt / -catenin signaling pathway controls a large and diverse set of cell

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12119 SUPPLEMENTARY FIGURES AND LEGENDS pre-let-7a- 1 +14U pre-let-7a- 1 Ddx3x Dhx30 Dis3l2 Elavl1 Ggt5 Hnrnph 2 Osbpl5 Puf60 Rnpc3 Rpl7 Sf3b3 Sf3b4 Tia1 Triobp U2af1 U2af2 1 6 2 4 3

More information

RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) ELISA Kit

RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) ELISA Kit RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) ELISA Kit Catalog #: PEL-Stat3-Y705 User Manual Last revised August 10, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified

More information

0.9 5 H M L E R -C tr l in T w is t1 C M

0.9 5 H M L E R -C tr l in T w is t1 C M a. b. c. d. e. f. g. h. 2.5 C elltiter-g lo A ssay 1.1 5 M T S a s s a y Lum inescence (A.U.) 2.0 1.5 1.0 0.5 n s H M L E R -C tr l in C tr l C M H M L E R -C tr l in S n a il1 C M A bsorbance (@ 490nm

More information

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time

More information

Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by

Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by down-regulating PKA and CREB activation Sudha Saryu Malhotra 1, Pankaj Suman 2 and Satish Kumar Gupta 1 * 1 Reproductive

More information

Data Sheet. TCR activator / PD-L1 - CHO Recombinant Cell line Cat. #: 60536

Data Sheet. TCR activator / PD-L1 - CHO Recombinant Cell line Cat. #: 60536 Data Sheet TCR activator / PD-L1 - CHO Recombinant Cell line Cat. #: 60536 Product Description Recombinant CHO-K1 cells constitutively expressing human PD-L1 (Programmed Cell Death 1 Ligand 1, CD274, B7

More information

Supplementary Figure S1 Evi/Wls and Wnt3 are overexpressed in epithelial cells in colon cancers. (a) Validation of the specificity of the Wnt3

Supplementary Figure S1 Evi/Wls and Wnt3 are overexpressed in epithelial cells in colon cancers. (a) Validation of the specificity of the Wnt3 Supplementary Figure S1 Evi/Wls and Wnt3 are overexpressed in epithelial cells in colon cancers. (a) Validation of the specificity of the Wnt3 antibody. HCT116 cells were reverse transfected with sicontrol

More information

Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide,

Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, conjugated with either TAT or Myristic acid and biotin for

More information

Document S1. Supplemental Experimental Procedures and Three Figures (see next page)

Document S1. Supplemental Experimental Procedures and Three Figures (see next page) Supplemental Data Document S1. Supplemental Experimental Procedures and Three Figures (see next page) Table S1. List of Candidate Genes Identified from the Screen. Candidate genes, corresponding dsrnas

More information

Supporting Information

Supporting Information Supporting Information Chakrabarty et al. 10.1073/pnas.1018001108 SI Materials and Methods Cell Lines. All cell lines were purchased from the American Type Culture Collection. Media and FBS were purchased

More information

Chemically defined conditions for human ipsc derivation and culture

Chemically defined conditions for human ipsc derivation and culture Nature Methods Chemically defined conditions for human ipsc derivation and culture Guokai Chen, Daniel R Gulbranson, Zhonggang Hou, Jennifer M Bolin, Victor Ruotti, Mitchell D Probasco, Kimberly Smuga-Otto,

More information

M X 500 µl. M X 1000 µl

M X 500 µl. M X 1000 µl GeneGlide TM sirna Transfection Reagent (Catalog # M1081-300, -500, -1000; Store at 4 C) I. Introduction: BioVision s GeneGlide TM sirna Transfection reagent is a cationic proprietary polymer/lipid formulation,

More information

RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) and Total STAT3 ELISA Kit

RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) and Total STAT3 ELISA Kit RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) and Total STAT3 ELISA Kit Catalog #: PEL-Stat3-Y705-T User Manual Last revised October 10, 2017 Caution: Extraordinarily useful information enclosed ISO

More information

OPPF-UK Standard Protocols: Mammalian Expression

OPPF-UK Standard Protocols: Mammalian Expression OPPF-UK Standard Protocols: Mammalian Expression Joanne Nettleship joanne@strubi.ox.ac.uk Table of Contents 1. Materials... 3 2. Cell Maintenance... 4 3. 24-Well Transient Expression Screen... 5 4. DNA

More information

Supplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface.

Supplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface. Supplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface. (a) Human PDAC cell lines were treated as indicated in Figure 1 panel F. Cells were analyzed for FITC-rBAG3 binding

More information

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). 1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well

More information

RayBio Human and Mouse Phospho-STAT1 (Ser727) and Total STAT1 ELISA Kit

RayBio Human and Mouse Phospho-STAT1 (Ser727) and Total STAT1 ELISA Kit RayBio Human and Mouse Phospho-STAT1 (Ser727) and Total STAT1 ELISA Kit Catalog #: PEL-Stat1-S727-T User Manual Last revised October 10, 2017 Caution: Extraordinarily useful information enclosed ISO 13485

More information

a KYSE270-CON KYSE270-Id1

a KYSE270-CON KYSE270-Id1 a KYSE27-CON KYSE27- shcon shcon sh b Human Mouse CD31 Relative MVD 3.5 3 2.5 2 1.5 1.5 *** *** c KYSE15 KYSE27 sirna (nm) 5 1 Id2 Id2 sirna 5 1 sirna (nm) 5 1 Id2 sirna 5 1 Id2 [h] (pg per ml) d 3 2 1

More information

SUPPORTING ONLINE MATERIAL

SUPPORTING ONLINE MATERIAL SUPPORTING ONLINE MATERIAL SUPPLEMENTAL EXPERIMENTAL PROCEDURES Primers for qpcr and semiquantitative PCR and conditions for semiquantitative PCR G6Pase 5 -ttgtggcagaagcatttgag-3, 5 -atatccttgcactggcaacc-3.

More information

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 female) or wild-type (5 months old, 1 male; 11 months old,

More information

Please read manual carefully before starting experiment

Please read manual carefully before starting experiment RayBio Cell-Based Phosphorylation ELISA Kit - Preliminary For the semi-quantitative detection of both phosphorylated and pan human, mouse or rat proteins in adherent whole cell lines. User Manual (Revised

More information

Cell extracts and western blotting RNA isolation and real-time PCR Chromatin immunoprecipitation (ChIP)

Cell extracts and western blotting RNA isolation and real-time PCR Chromatin immunoprecipitation (ChIP) Cell extracts and western blotting Cells were washed with ice-cold phosphate-buffered saline (PBS) and lysed with lysis buffer. 1 Total cell extracts were separated by SDS-PAGE and transferred to nitrocellulose

More information

Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector.

Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector. Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector. (a) Western blotting analysis and (b) qpcr analysis of eif6 expression in HEK293 T cells transfected with either

More information

Supporting Information

Supporting Information Supporting Information Deng et al. 10.1073/pnas.1515692112 SI Materials and Methods FPLC. All fusion proteins were expressed and purified through a three-step FPLC purification protocol, as described (20),

More information

RayBio Human, Mouse and Rat Phospho-MET (Tyr1234/1235) and Total MET ELISA Kit

RayBio Human, Mouse and Rat Phospho-MET (Tyr1234/1235) and Total MET ELISA Kit RayBio Human, Mouse and Rat Phospho-MET (Tyr1234/1235) and Total MET ELISA Kit Catalog #: PEL-Met-Y1234-T User Manual Last revised October 10, 2017 Caution: Extraordinarily useful information enclosed

More information

Supplementary Material

Supplementary Material Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated

More information

hnrnp C promotes APP translation by competing with FMRP for APP mrna recruitment to P bodies

hnrnp C promotes APP translation by competing with FMRP for APP mrna recruitment to P bodies hnrnp C promotes APP translation by competing with for APP mrna recruitment to P bodies Eun Kyung Lee 1, Hyeon Ho Kim 1, Yuki Kuwano 1, Kotb Abdelmohsen 1, Subramanya Srikantan 1, Sarah S. Subaran 2, Marc

More information

Supplemental Figure Legends:

Supplemental Figure Legends: Supplemental Figure Legends: Fig S1. GFP-ABRO1 localization. U2OS cells were infected with retrovirus expressing GFP- ABRO1. The cells were fixed with 3.6% formaldehyde and stained with antibodies against

More information

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit Catalog #: TFEH-p65 User Manual Mar 13, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,

More information

Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.

Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb. Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

Data Sheet. Application Monitor glucocorticoid signaling pathway activity. Screen activators or inhibitors of the glucocorticoid signaling pathway.

Data Sheet. Application Monitor glucocorticoid signaling pathway activity. Screen activators or inhibitors of the glucocorticoid signaling pathway. Data Sheet GAL4 Reporter Kit (Glucocorticoid Receptor Pathway) Catalog #: w70533 Background The glucocorticoid signaling pathway plays an important role in development, fluid homeostasis, cognition, immune

More information

EPIGENTEK. EpiQuik Tissue Chromatin Immunoprecipitation Kit. Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE

EPIGENTEK. EpiQuik Tissue Chromatin Immunoprecipitation Kit. Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE EpiQuik Tissue Chromatin Immunoprecipitation Kit Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Tissue Chromatin Immunoprecipitation Kit is suitable for combining the specificity

More information

CIGNAL REPORTER ASSAYS & ARRAYS

CIGNAL REPORTER ASSAYS & ARRAYS CIGNAL REPORTER ASSAYS & ARRAYS TM Cell-Based for Measuring Activity Cancer Cell Cycle Cytokines / Inflammation Neuroscience Stem Cell / Development Toxicology Focus on your CIGNAL TM REPORTER ASSAY SYSTEM

More information

HCT116 SW48 Nutlin: p53

HCT116 SW48 Nutlin: p53 Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates

More information

Cignal Reporter Assay Handbook

Cignal Reporter Assay Handbook January 2011 Cignal Reporter Assay Handbook For cell-based pathway activity assays Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample and

More information

EPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE

EPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE EpiQuik Chromatin Immunoprecipitation Kit Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Chromatin Immunoprecipitation Kit is suitable for combining the specificity of

More information

Developmental Reprogramming in Mesenchymal Stromal Cells of Human Subjects with Idiopathic Pulmonary Fibrosis

Developmental Reprogramming in Mesenchymal Stromal Cells of Human Subjects with Idiopathic Pulmonary Fibrosis Developmental Reprogramming in Mesenchymal Stromal Cells of Human Subjects with Idiopathic Pulmonary Fibrosis Diptiman Chanda 1*, Ashish Kurundkar 1, Sunad Rangarajan 1, Morgan Locy 1, Karen Bernard 1,

More information

Wnt16 smact merge VK/AB

Wnt16 smact merge VK/AB A WT Wnt6 smact merge VK/A KO ctrl IgG WT KO Wnt6 smact DAPI SUPPLEMENTAL FIGURE I: Wnt6 expression in MGP-deficient aortae. Immunostaining for Wnt6 and smooth muscle actin (smact) in aortae from 7 day

More information

Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated

Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated Supplementary Figure Legends Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated with either vehicle (left; n=3) or CCl 4 (right; n=3) were co-immunostained for NRP-1 (green)

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice

More information

Data Sheet. TCF/LEF Reporter Kit Wnt / -catenin signaling pathway Catalog #: 60500

Data Sheet. TCF/LEF Reporter Kit Wnt / -catenin signaling pathway Catalog #: 60500 Data Sheet TCF/LEF Reporter Kit Wnt / -catenin signaling pathway Catalog #: 60500 Background The Wnt / -catenin signaling pathway controls a large and diverse set of cell fate decisions in embryonic development,

More information

Figure S1. Specificity of polyclonal anti stabilin-1 and anti stabilin-2 antibodies Lysates of 293T cells transfected with empty vector, mouse

Figure S1. Specificity of polyclonal anti stabilin-1 and anti stabilin-2 antibodies Lysates of 293T cells transfected with empty vector, mouse Figure S1. Specificity of polyclonal anti stabilin-1 and anti stabilin-2 antibodies Lysates of 293T cells transfected with empty vector, mouse stabilin-1, or mouse stabilin-2 were immunoblotted using anti

More information

Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in

Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in mouse NOD/SCID/Jak3 null mice were transplanted with human CD34 + hematopoietic stem cells. (Top) Four weeks after the transplantation

More information

beta-secretase Activity Assay Kit

beta-secretase Activity Assay Kit beta-secretase Activity Assay Kit Catalog Number KA0900 100 assays Version: 04 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4

More information

To determine MRK-003 IC50 values, cell lines were plated in triplicate in 96-well plates at 3 x

To determine MRK-003 IC50 values, cell lines were plated in triplicate in 96-well plates at 3 x Supplementary methods: Cellular growth assay and cell cycle analysis To determine MRK-003 IC50 values, cell lines were plated in triplicate in 96-well plates at 3 x 10 3 cells/well (except for TALL1 and

More information

Please read manual carefully before starting experiment

Please read manual carefully before starting experiment RayBio Cell Based Human STAT5 (Tyr694) Phosphorylation ELISA Kit For the semi quantitative detection of phosphorylated human STAT5 (Tyr694) and total STAT5 in adherent whole cell lines. User Manual (Revised

More information

Supplemental Methods. 37 for 18 h. On the second day, the digested suspension was centrifuged at 700 rpm

Supplemental Methods. 37 for 18 h. On the second day, the digested suspension was centrifuged at 700 rpm Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Supplemental Methods Isolation of Primary Fibroblasts and Cultures We isolated CAFs

More information

Supporting Information

Supporting Information Supporting Information Tal et al. 10.1073/pnas.0807694106 SI Materials and Methods VSV Infection and Quantification. Infection was carried out by seeding 5 10 5 MEF cells per well in a 6-well plate and

More information

Supplementary Information Temperature-responsive Gene Silencing by a Smart Polymer

Supplementary Information Temperature-responsive Gene Silencing by a Smart Polymer Supplementary Information Temperature-responsive Gene Silencing by a Smart Polymer Mingming Wang, Yiyun Cheng * Shanghai Key Laboratory of Regulatory Biology, School of Life Sciences, East China Normal

More information

Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera

Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera SUPPLEMENTARY INFORMATION Roles of human POLD1 and POLD3 in genome stability Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera SUPPLEMENTARY METHODS Cell proliferation After sirna

More information

RayBio Phospho- Stat 3 (Tyr705) ELISA Kit

RayBio Phospho- Stat 3 (Tyr705) ELISA Kit RayBio Phospho- Stat 3 (Tyr705) ELISA Kit For Measuring Phosphorylated Stat3 (Tyr705) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Stat3 (Tyr705) ELISA Kit Protocol (Cat#:

More information