Data Supplement Plasmin Triggers Cytokine Induction in Human Monocyte-Derived Macrophages

Size: px
Start display at page:

Download "Data Supplement Plasmin Triggers Cytokine Induction in Human Monocyte-Derived Macrophages"

Transcription

1 Data Supplement Plasmin Triggers Cytokine Induction in Human Monocyte-Derived Macrophages Qun Li, Yves Laumonnier, Tatiana Syrovets, and Thomas Simmet Methods Antibodies and Reagents Antibodies for immunoblotting: annexin A, SA (BD Biosciences, Bedford, MA), phospho-jak, JAK, JAK and phospho-stat-(tyr ) (Biosource, Nivelles, Belgium), phospho-jak and phospho-stat-(ser ) (Epitomics, Burlingame, CA), phospho-p and p, phospho-iκbα, phospho-erk/, ERK, and phospho-tyk (Cell Signaling, Beverly, MA), phospho-akt-(ser ) (Upstate, Charlottesville, VA), and actin (Chemicon International, Temecula, CA). Antibodies for flow cytometry: annexin A (Biodesign, Saco, ME), SA (RDI, Concord, MA), anti-cd and anti-cd (BD Biosciences), anti-cdc and anti-cd (DAKO, Hamburg, Germany), CD (BD Pharmingen). mouse and rabbit IgG and PE-conjugated donkey anti-mouse and anti-rabbit IgG F(ab) were from Dianova (Hamburg, Germany). Limulus amoebocyte lysate assay, and lipopolysaccharide (LPS; Escherichia coli serotype :B) were from Sigma (St. Louis, MO). Purified human plasmin (lot 9/,. CTA U/mg protein) tested for LPS was from Fluka (Deisenhofen, Germany); plasmin activity is given in Committee on Thrombolytic Agents (CTA) units/ml., The catalytic inhibitor of plasmin, D-Val-Phe-Lys chloromethyl ketone (VPLCK), the JAK inhibitor AG9, the p MAPK inhibitor SB and the MEK inhibitor U were from Calbiochem (San Diego, CA), recombinant human M-CSF was from Biovision (Mountain View, CA). Chemically pure acetyl--keto-β-boswellic acid was isolated as previously described. Cell Preparation and Culture Monocyte-derived human macrophages were differentiated from buffy coats for days with ng/ml M-CSF. Monocytes and neutrophils were isolated by Percoll gradient centrifugation. Macrophages were cultured in RPMI (Invitrogen, Carlsbad, CA),

2 supplemented with % FCS. The cells were stimulated with plasmin in lysine-free RPMI (Sigma). Analysis of Protein Expression For Western blot analysis and flow cytometry, macrophages were analyzed as described. The cytokine levels were quantified with ELISAs (R&D Systems, Minneapolis, MN). For the cleavage of annexin A, macrophages were either unstimulated or stimulated for min with. CTA U/mL plasmin or equivalent amounts of catalytically inactivated plasmin., Reverse Transcription and Polymerase Chain Reaction Analysis Total RNA from macrophages stimulated with. CTA U/mL plasmin or equivalent amounts of catalytically inactivated plasmin (VPLCK-plasmin) was isolated by Trizol (Invitrogen) and analyzed by semi-quantitative RT-PCR. Conditions for TNF-α were as described; for IL- the forward primer -TACATCCTCGACGGCATCTCA-, and the reverse primer -AGTTGTCATGTCCTGCAGCCA- with cycles of amplification (denaturation 9 C s, annealing C s and elongation C s) were used. PCR was performed in the linear range of amplification; GAPDH served as internal standard. The transcripts were identified by direct automated sequencing (Genetic Analyzer; Applied Biosystems). Inhibition of Annexin A and SA Expression by Antisense ODN For in vitro knockdown of annexin A and SA, μm of phosphorothioatemodified oligodeoxynucleotides (ODN) (Thermo Hybaid, Ulm, Germany) were applied to macrophage cultures every h for h as described. STAT and NF-κB family Transcription Factor Assays Human macrophages were stimulated with. CTA U/mL plasmin for min (STAT) or h (NF-κB), and nuclear extracts were prepared., Activation of STATα,, A, B and p, c-rel, RelB were determined in μg nuclear extract with DNA-binding

3 TransAM ELISAs for STAT and NF-κB family transcription factors (Active Motif, Carlsbad, CA). Data are expressed as amount of corresponding transcription factor in treated cells compared to unstimulated controls using - different nuclear extract preparations each. Statistical Analysis Values shown represent mean ± SEM where applicable. Statistical significances were calculated with the Newman-Keuls test. Differences were considered significant for P<.. References. Burysek L, Syrovets T, Simmet T. The serine protease plasmin triggers expression of MCP- and CD in human primary monocytes via activation of p MAPK and janus kinase (JAK)/STAT signaling pathways. J Biol Chem. ;:9-.. Laumonnier Y, Syrovets T, Burysek L, Simmet T. Identification of the annexin A heterotetramer as a receptor for the plasmin-induced signaling in human peripheral monocytes. Blood. ;:-9.. Büchele B, Simmet T. Analysis of different pentacyclic triterpenic acids from frankincense in human plasma by high-performance liquid chromatography and photodiode array detection. J Chromatogr B Analyt Technol Biomed Life Sci. ;9:-.. Colognato R, Slupsky JR, Jendrach M, Burysek L, Syrovets T, Simmet T. Differential expression and regulation of protease-activated receptors in human peripheral monocytes and monocyte-derived antigen-presenting cells. Blood. ;:-.. Syrovets T, Jendrach M, Rohwedder A, Schüle A, Simmet T. Plasmin-induced expression of cytokines and tissue factor in human monocytes involves AP- and IKKβ-mediated NF-κB activation. Blood. ;9:9-9.. Syrovets T, Büchele B, Krauss C, Laumonnier Y, Simmet T. Acetyl-boswellic acids inhibit lipopolysaccharide-mediated TNF-α induction in monocytes by direct interaction with IκB kinases. J Immunol. ;:9-.

4 Supplemental Data A P-JAK (fold activation) P-TYK (fold activation) P-STATTyr (fold activation) P-STATSer (fold activation) B P-p (fold activation) P-ERK/ (fold activation) C P-AKt (fold activation) P-IκBα (fold activation) Supplemental Figure I.

5 D P-AKt (fold activation) AG P-ERK/ (fold activation) Plasmin+AG9 (um) AG P-IκBα (fold activation) AG P-p (fold activation) AG Supplemental Figure I. Plasmin triggers activation of JAK/STAT, MAPK and NF-κB signaling pathways. Macrophages (x /assay) were stimulated with plasmin (. CTA U/mL) in serum-free RPMI for the indicated time. Whole cell lysates were separated and analyzed by densitometric scanning of Western immunoblots. A, Timedependent activation of JAK/STAT. Analysis of phospho-jak (P-JAK), phospho- TYK (P-TYK), phospho-stat-(tyr ) and phospho-stat-(ser ); JAK, TYK and actin served as loading controls. B, Time-dependent activation of MAPK. Analysis of phospho-p and phospho-erk/; p or ERK served as loading control. C, Timedependent activation of the NF-κB pathway. Analysis of phospho-akt-(ser ) and phospho-iκbα from whole cell lysates from macrophages stimulated with plasmin. D, Effects of the JAK inhibitor, AG9, on the plasmin-induced MAPK and NF-κB signaling pathways. Cells pretreated with μm AG9 for min were stimulated with. CTA U/mL plasmin for min. Analysis of phospho-erk/, phospho-akt-(ser ), phospho- IκBα, and phospho-p; non-phosphorylated proteins and actin served as loading controls. All results are mean ± SEM of at least independent experiments.

6 A TNF-α mrna/gapdh mrna..... Plasmin (. CTA U/mL) LPS ( µg/ml) h h h IL- mrna/gapdh mrna Plasmin (. CTA U/mL) LPS ( µg/ml) h h h B TNF-α mrna/gapdh mrna LPS.... Plasmin (CTA U/mL) IL- mrna/gapdh mrna LPS.... Plasmin (CTA U/mL) C TNF-α mrna/gapdh mrna IL- mrna/gapdh mrna Plasmin Plasmin-VPLCK. Plasmin Plasmin-VPLCK Supplemental Figure II. Plasmin triggers time- and concentration-dependent induction of TNF-α and IL- genes. A, Time-dependent and B, concentration-dependent stimulation of the TNF-α and IL- mrna expression. Macrophages were stimulated with plasmin (. CTA U/mL) or LPS ( μg/ml) for the indicated times and the mrna levels were analyzed by RT-PCR and densitometry. C, The gene induction depends on the proteolytic activity of plasmin. Macrophages were stimulated for h with plasmin (. CTA U/mL) or with equivalent amounts of catalytically inactivated plasmin; TNF-α and

7 IL- mrna were analyzed by RT-PCR and densitometry. GAPDH served as loading control. In each case, results are means ± SEM of independent experiments. Protein expression (fold)... Sense annexin A AS annexin A Sense SA AS SA. annexin A SA Supplemental Figure III. The annexin A heterotetramer is indispensable for the plasmin-stimulated release of cytokines by the macrophages. Specific antisense ODN decrease the expression of annexin A and SA. Macrophages were treated for h with μm of the corresponding ODN (sense or antisense). After h recovery in RPMI without lysine, the cells were lysed, the proteins were separated and analyzed by immunoblotting and densitometric scanning. Actin served as loading control. The data represent the mean percentage ± SEM of independent experiments.

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/4/9/eaat5401/dc1 Supplementary Materials for GLK-IKKβ signaling induces dimerization and translocation of the AhR-RORγt complex in IL-17A induction and autoimmune

More information

used at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies were

used at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies were 1 Supplemental Methods Reagents and chemicals: TGFβ was a generous gift from Genzyme Inc. (Cambridge, MA) and was used at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies

More information

Cell death analysis using the high content bioimager BD PathwayTM 855 instrument (BD

Cell death analysis using the high content bioimager BD PathwayTM 855 instrument (BD Supplemental information Materials and Methods: Cell lines, reagents and antibodies: Wild type (A3) and caspase-8 -/- (I9.2) Jurkat cells were cultured in RPMI 164 medium (Life Technologies) supplemented

More information

Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1

Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 a His-ORMDL3 ~ 17 His-ORMDL3 GST-ORMDL3 - + - + IPTG GST-ORMDL3 ~ b Integrated Density (ORMDL3/ -actin) 0.4 0.3 0.2 0.1

More information

Cell were phenotyped using FITC-conjugated anti-human CD3 (Pharmingen, UK)

Cell were phenotyped using FITC-conjugated anti-human CD3 (Pharmingen, UK) SUPPLEMENTAL MATERIAL Supplemental Methods Flow cytometry Cell were phenotyped using FITC-conjugated anti-human CD3 (Pharmingen, UK) and anti-human CD68 (Dako, Denmark), anti-human smooth muscle cell α-actin

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation

More information

Anti-ERK1/2, anti-p-erk1/2, anti-p38 anti-p-msk1 (Thr581) and anti-p-msk2

Anti-ERK1/2, anti-p-erk1/2, anti-p38 anti-p-msk1 (Thr581) and anti-p-msk2 Supplementary methods Antibodies Anti-ERK1/2, anti-p-erk1/2, anti-p38 anti-p-msk1 (Thr581) and anti-p-msk2 polyclonal were from Cell Signalling and the anti-p-histone H3(Ser1) antibody was from Upstate.

More information

Supplementary Table 1. PCR amplification conditions for each primer pair. Primer sequence

Supplementary Table 1. PCR amplification conditions for each primer pair. Primer sequence - 1 - Supplementary Tables Supplementary Table 1. PCR amplification conditions for each primer pair Primer sequence FN1 S - CAAAGCAAGCCCGGTTGT AS - CGCTCCCACTGTTGATTTATCTG ITGα2 S - TTAGGTTACTCTGTGGCTGCAATT

More information

Supplementary Methods Plasmid constructs

Supplementary Methods Plasmid constructs Supplementary Methods Plasmid constructs. Mouse cdna encoding SHP-1, amplified from mrna of RAW264.7 macrophages with primer 5'cgtgcctgcccagacaaactgt3' and 5'cggaattcagacgaatgcccagatcacttcc3', was cloned

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.8/nature85 Supplementary Methods Plasmid construction Murine RIG-I, HMGB and Rab5 cdnas were obtained by polymerase chain reaction with reverse transcription (RT-PCR) on total RNA from, and then cloned

More information

Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by

Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by down-regulating PKA and CREB activation Sudha Saryu Malhotra 1, Pankaj Suman 2 and Satish Kumar Gupta 1 * 1 Reproductive

More information

Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation

Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation 1 2 3 4 5 SUPPLEMENTAL DATA Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation Magalí Nazar, Juan Pablo Nicola, María Laura

More information

A human immunodeficiency caused by mutations in the PIK3R1 gene. Whole exome sequencing. Whole exome sequencing libraries were prepared from 3

A human immunodeficiency caused by mutations in the PIK3R1 gene. Whole exome sequencing. Whole exome sequencing libraries were prepared from 3 A human immunodeficiency caused by mutations in the PIK3R1 gene. Supplementary Methods Whole exome sequencing. Whole exome sequencing libraries were prepared from 3 µg of genomic DNA extracted from total

More information

Li et al., Supplemental Figures

Li et al., Supplemental Figures Li et al., Supplemental Figures Fig. S1. Suppressing TGM2 expression with TGM2 sirnas inhibits migration and invasion in A549-TR cells. A, A549-TR cells transfected with negative control sirna (NC sirna)

More information

Reagents and cell culture Mcl-1 gene expression: real-time quantitative RT-PCR In vitro PP2A phosphatase assay Detection of Mcl-1 in vivo

Reagents and cell culture Mcl-1 gene expression: real-time quantitative RT-PCR In vitro PP2A phosphatase assay Detection of Mcl-1 in vivo Reagents and cell culture Antibodies specific for caspase 3, PARP and GAPDH were purchased from Cell Signaling Technology Inc. (Beverly, MA). Caspase inhibitor z-vad-fmk and ROS scavenger N-acetyl-Lcysteine

More information

Antibodies used in this study Figure S1. Akt expression in neutrophils from WT and individual Akt isoform knockout mice

Antibodies used in this study Figure S1. Akt expression in neutrophils from WT and individual Akt isoform knockout mice ntibodies used in this study The anti β-actin monoclonal antibody (Sigma-ldrich, St. Louis, MO) was generated against a slightly modified human β-actin N-terminal peptide, c-sp-sp-sp-ile-la-la-leu-val-ile-

More information

Supplementary Information

Supplementary Information Supplementary Information Sam68 modulates the promoter specificity of NF-κB and mediates expression of CD25 in activated T cells Kai Fu 1, 6, Xin Sun 1, 6, Wenxin Zheng 1, 6, Eric M. Wier 1, Andrea Hodgson

More information

Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice

Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice Supplementary Material Supplementary Methods Materials Spironolactone, aldosterone and β-glycerophosphate were

More information

Supplemental Materials and Methods

Supplemental Materials and Methods Supplemental Materials and Methods 125 I-CXCL12 binding assay KG1 cells (2 10 6 ) were preincubated on ice with cold CXCL12 (1.6µg/mL corresponding to 200nM), CXCL11 (1.66µg/mL corresponding to 200nM),

More information

Species predicted to react based on 100% sequence homology: Chicken, Bovine, Dog.

Species predicted to react based on 100% sequence homology: Chicken, Bovine, Dog. 1 of 5 11/1/2013 10:25 PM Product Pathways - Jak/Stat Pathway Phospho-Stat3 (Tyr705) Antibody #9131 Have you tried your application using our XP monoclonal antibodies? Try products: 9145 PhosphoSitePlus

More information

Nature Medicine doi: /nm.3554

Nature Medicine doi: /nm.3554 SUPPLEMENTARY FIGURES LEGENDS Supplementary Figure 1: Generation, purification and characterization of recombinant mouse IL-35 (ril-35). High-Five insect cells expressing high levels of the bicistronic

More information

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of Fig. S1 TGF RI inhibitor SB525334 effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of different concentrations of SB525334. Cells were lysed and

More information

Post-translational modification

Post-translational modification Protein expression Western blotting, is a widely used and accepted technique to detect levels of protein expression in a cell or tissue extract. This technique measures protein levels in a biological sample

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Fig. 1. Kinetics of,,, AKT and ERK activation in BMMCs following SCF stimulation. Starved BMMCs were stimulated with 250ng/mL of SCF for the indicated time. Soluble Cell Lysates (SCLs) were

More information

Flowcytometry-based purity analysis of peritoneal macrophage culture.

Flowcytometry-based purity analysis of peritoneal macrophage culture. Liao et al., KLF4 regulates macrophage polarization Revision of Manuscript 45444-RG- Supplementary Figure Legends Figure S Flowcytometry-based purity analysis of peritoneal macrophage culture. Thioglycollate

More information

Supplementary Fig. 1 Kinetics of appearence of the faster migrating form of Bcl-10.

Supplementary Fig. 1 Kinetics of appearence of the faster migrating form of Bcl-10. α-cd3 + α-cd28: Time (min): + + + + + + + + + 0 5 15 30 60 120 180 240 300 360 360 n.s. Supplementary Fig. 1 Kinetics of appearence of the faster migrating form of. Immunoblot of lysates from Jurkat cells

More information

Table S1. Primer sequences

Table S1. Primer sequences Table S1. Primer sequences Primers for quantitative PCR Tgf 1 Forward Tgf 1 Reverse Tgf 2Forward Tgf 2Reverse Tgf 3 Forward Tgf 3 Reverse Tgf r1 Forward Tgf r1 Reverse Tgf r2 Forward Tgf r2 Reverse Thbs1

More information

Regulation and Function of the IL-1 Family Cytokine IL-1F9 in Human Bronchial Epithelial Cells

Regulation and Function of the IL-1 Family Cytokine IL-1F9 in Human Bronchial Epithelial Cells Online Data Supplement Regulation and Function of the IL-1 Family Cytokine IL-1F9 in Human Bronchial Epithelial Cells Regina T. Chustz 1, Deepti R. Nagarkar 1, Julie A. Poposki 1, Silvio Favoreto, Jr 1,

More information

PE11, a PE/PPE family protein of Mycobacterium tuberculosis is involved in cell wall remodeling and virulence

PE11, a PE/PPE family protein of Mycobacterium tuberculosis is involved in cell wall remodeling and virulence PE11, a PE/PPE family protein of Mycobacterium tuberculosis is involved in cell wall remodeling and virulence Parul Singh 1,2, Rameshwaram Nagender Rao 1, Jala Ram Chandra Reddy 3, R.B.N. Prasad 3, Sandeep

More information

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). 1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well

More information

Supporting Information

Supporting Information Supporting Information Casson et al. 10.1073/pnas.1421699112 Sl Materials and Methods Macrophage Infections. In experiments where macrophages were primed with LPS, cells were pretreated with 0.5 μg/ml

More information

BmDCs were generated as described by a modified protocol of Inaba et al S1. Briefly, bone

BmDCs were generated as described by a modified protocol of Inaba et al S1. Briefly, bone Generation and culture of bone marrow-derived dendritic cells (bmdcs) BmDCs were generated as described by a modified protocol of Inaba et al S1. Briefly, bone marrow cells from murine tibias and femurs

More information

Mayumi Egawa, Kaori Mukai, Soichiro Yoshikawa, Misako Iki, Naofumi Mukaida, Yohei Kawano, Yoshiyuki Minegishi, and Hajime Karasuyama

Mayumi Egawa, Kaori Mukai, Soichiro Yoshikawa, Misako Iki, Naofumi Mukaida, Yohei Kawano, Yoshiyuki Minegishi, and Hajime Karasuyama Immunity, Volume 38 Supplemental Information Inflammatory Monocytes Recruited to Allergic Skin Acquire an Anti-inflammatory M2 Phenotype via Basophil-Derived Interleukin-4 Mayumi Egawa, Kaori Mukai, Soichiro

More information

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit Catalog #: TFEH-p65 User Manual Mar 13, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,

More information

Supplementary Information

Supplementary Information Supplementary Information Mutual reinforcement of inflammation and carcinogenesis by the Helicobacter pylori CagA oncoprotein Nobumi Suzuki, Naoko Murata-Kamiya, Kohei Yanagiya, Wataru Suda, Masahira Hattori,

More information

Cell viability. Cell viability was examined by MTT assay (Sigma-Aldrich).

Cell viability. Cell viability was examined by MTT assay (Sigma-Aldrich). Supplementary Materials Supplementary materials and methods Cell culture. Primary human dermal fibroblasts (DFs) were isolated from full-thickness skin samples. Tissue samples were dissected into small

More information

Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured

Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured under static conditions. Cells were seeded in the chamber area of the device and cultured overnight without medium perfusion.

More information

Generation of mouse BMDCs Vectors Short hairpin RNA constructs cdna constructs and generation of stable cell lines

Generation of mouse BMDCs Vectors Short hairpin RNA constructs cdna constructs and generation of stable cell lines Generation of mouse BMDCs Mouse BMDCs were differentiated from BM cells isolated from femur and tibiae of the hind legs. Cell suspensions were filtered through a 40 µm cell strainer and incubated for 2

More information

Please read manual carefully before starting experiment

Please read manual carefully before starting experiment RayBio Cell-Based Human/Mouse/Rat ERK1/2, JNK, p38 MAPK Phosphorylation ELISA Sampler Kit For the semi-quantitative detection of phosphorylated human, mouse, or rat ERK1/2 (Thr202/Tyr204), JNK (Thr183/Tyr185),

More information

Supplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface.

Supplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface. Supplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface. (a) Human PDAC cell lines were treated as indicated in Figure 1 panel F. Cells were analyzed for FITC-rBAG3 binding

More information

Human skin punch biopsies were obtained under informed consent from normal healthy

Human skin punch biopsies were obtained under informed consent from normal healthy SUPPLEMENTAL METHODS Acquisition of human skin specimens. Human skin punch biopsies were obtained under informed consent from normal healthy volunteers (n = 30) and psoriasis patients (n = 45) under a

More information

To determine the effect of N1IC in the susceptibility of T cells to the tolerogenic effect of tumorassociated

To determine the effect of N1IC in the susceptibility of T cells to the tolerogenic effect of tumorassociated Supplementary Methods Tolerogenic effect of MDSC To determine the effect of N1IC in the susceptibility of T cells to the tolerogenic effect of tumorassociated MDSC in vivo, we used a model described previously

More information

Please read manual carefully before starting experiment

Please read manual carefully before starting experiment RayBio Cell Based Human STAT5 (Tyr694) Phosphorylation ELISA Kit For the semi quantitative detection of phosphorylated human STAT5 (Tyr694) and total STAT5 in adherent whole cell lines. User Manual (Revised

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.

Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting. Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice

More information

Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium

Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium Iodide (Invitrogen, Carlsbad, CA) staining. Briefly, 2x10 5 cells were washed once in cold PBS and resuspended

More information

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα

More information

Supplementary Figure 1 Validate the expression of mir-302b after bacterial infection by northern

Supplementary Figure 1 Validate the expression of mir-302b after bacterial infection by northern Supplementary Figure 1 Validate the expression of mir-302b after bacterial infection by northern blot. Northern blot analysis of mir-302b expression following infection with PAO1, PAK and Kp in (A) lung

More information

Data Sheet GITR / NF-ĸB-Luciferase Reporter (Luc) - Jurkat Cell Line Catalog #60546

Data Sheet GITR / NF-ĸB-Luciferase Reporter (Luc) - Jurkat Cell Line Catalog #60546 Data Sheet GITR / NF-ĸB-Luciferase Reporter (Luc) - Jurkat Cell Line Catalog #60546 Description This cell line expresses a surface human GITR (glucocorticoid-induced TNFR family related gene; TNFRSF18;

More information

Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating

Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating Supplemental Figure Legend: Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating strategy for mouse MDSC. CD11b + Ly6C high Ly6G - cells are defined as M-MDSC. CD11b + Ly6C low

More information

A comparison of protein detection and quantification techniques

A comparison of protein detection and quantification techniques APPLICATON NOTE Protein analysis technologies A comparison of protein detection and quantification techniques Enabling researchers to make scientific discoveries using the best tools for specific needs

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed

More information

b alternative classical none

b alternative classical none Supplementary Figure. 1: Related to Figure.1 a d e b alternative classical none NIK P-IkBa Total IkBa Tubulin P52 (Lighter) P52 (Darker) RelB (Lighter) RelB (Darker) HDAC1 Control-Sh RelB-Sh NF-kB2-Sh

More information

Supplementary material and methods

Supplementary material and methods Inhibitory effect of caffeic acid on ADP-induced thrombus formation and platelet activation involves mitogen-activated protein kinases Yu Lu 1,2,3,#, Quan Li 3,4,#, Yu-Ying Liu 3,4, Kai Sun 3,4, Jing-Yu

More information

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure Cell-Based ELISA Sampler Kit for detecting phospho-erk1/2 (pthr 202 /ptyr 204 ), phospho-jnk (pthr 183 /ptyr 185 ), and phospho-p38 MAPK (pthr 180 /ptyr 182 ) in cultured cell lines adequate for 192 assays

More information

Flow-cytometry assessment of parasitemia in cell parasite co-culture assay using hydroethidine staining Western blotting RT-PCR

Flow-cytometry assessment of parasitemia in cell parasite co-culture assay using hydroethidine staining Western blotting RT-PCR Flow-cytometry assessment of parasitemia in cell parasite co-culture assay using hydroethidine staining The capability of cells, either PBMC or purified T- cell lines, to inhibit parasite growth or merozoite

More information

ONLINE SUPPLEMENT Methods: Table 1

ONLINE SUPPLEMENT Methods:  Table 1 ONLINE SUPPLEMENT Methods: Immunohistochemistry: Serial sections of formalin-fixed, paraffin-embedded tissue sections (5 µm) were deparaffinized and rehydrated by immersion in xylenes and graded alcohol

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure S1 (a) P-cRAF colocalizes with LC3 puncta. Immunofluorescence (IF) depicting colocalization of P-cRAF (green) and LC3 puncta (red) in NIH/3T3 cells treated

More information

Supplementary Material & Methods

Supplementary Material & Methods Supplementary Material & Methods Affymetrix micro-array Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, USA). RNA concentration and quality was determined using the ND-1000 spectrophotometer

More information

Supporting Information

Supporting Information Supporting Information SI Materials and Methods RT-qPCR The 25 µl qrt-pcr reaction mixture included 1 µl of cdna or DNA, 12.5 µl of 2X SYBER Green Master Mix (Applied Biosystems ), 5 µm of primers and

More information

Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).

Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences). Mice C57BL/6-Ly5.1 or -Ly5.2 congenic mice were used for LSK transduction and competitive repopulation assays. Animal care was in accordance with the guidelines of Keio University for animal and recombinant

More information

CD1a-autoreactive T cells are a normal component of the human αβ T cell repertoire

CD1a-autoreactive T cells are a normal component of the human αβ T cell repertoire CDa-autoreactive T cells are a normal component of the human αβ T cell repertoire Annemieke de Jong, Victor Peña-Cruz, Tan-Yun Cheng, Rachael A. Clark, Ildiko Van Rhijn,, D. Branch Moody Division of Rheumatology,

More information

Mammosphere formation assay. Mammosphere culture was performed as previously described (13,

Mammosphere formation assay. Mammosphere culture was performed as previously described (13, Supplemental Text Materials and Methods Mammosphere formation assay. Mammosphere culture was performed as previously described (13, 17). For co-culture with fibroblasts and treatment with CM or CCL2, fibroblasts

More information

Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were. oligonucleotide spanning the NF-kB site (5 -GATCC-

Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were. oligonucleotide spanning the NF-kB site (5 -GATCC- SUPPLEMENTARY MATERIALS AND METHODS Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were prepared as previously described. (1) A [ 32 P] datp-labeled doublestranded oligonucleotide spanning

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Nature Biotechnology: doi: /nbt Supplementary Figure 1 Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible

More information

(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower

(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Virus infection induces RNF128 expression. (a,b) RT-PCR analysis of Rnf128 (RNF128) mrna expression in mouse peritoneal macrophages (a) and THP-1 cells (b) upon stimulation with

More information

Strategies for Assessment of Immunotoxicology in Preclinical Drug Development

Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Rebecca Brunette, PhD Scientist, Analytical Biology SNBL USA Preclinical Immunotoxicology The study of evaluating adverse effects

More information

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure

TECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure Cell-Based ELISA Kit for detecting phospho-stat4 (ptyr 693 ) in cultured cell lines adequate for 192 assays (2 96 well plate) Catalog Number RAB0449 Storage Temperature 20 C TECHNICAL BULLETIN Product

More information

Please read manual carefully before starting experiment

Please read manual carefully before starting experiment RayBio Cell-Based Phosphorylation ELISA Kit - Preliminary For the semi-quantitative detection of both phosphorylated and pan human, mouse or rat proteins in adherent whole cell lines. User Manual (Revised

More information

Supplementary Online Material

Supplementary Online Material Material and Methods Supplementary Online Material Reagents and antibodies Wortmannin, JNK inhibitor II (Anthra[1,9-cd]pyrazol-6(2H)-one 1,9-pyrazoloanthrone), SB 2358, and PD 9859 were purchased from

More information

Data Sheet. MAPK/ERK Signaling Pathway SRE Reporter HEK293 Cell Line Catalog #: 60406

Data Sheet. MAPK/ERK Signaling Pathway SRE Reporter HEK293 Cell Line Catalog #: 60406 Data Sheet MAPK/ERK Signaling Pathway SRE Reporter HEK293 Cell Line Catalog #: 60406 Description The MAPK/ERK signaling pathway is a major participant in the regulation of cell growth and differentiation.

More information

RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the

RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the

More information

Supplemental Table S1. RT-PCR primers used in this study

Supplemental Table S1. RT-PCR primers used in this study Supplemental Table S1. RT-PCR primers used in this study -----------------------------------------------------------------------------------------------------------------------------------------------

More information

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with

More information

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification.

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Gene Direction Primer sequence (5 3 ) Annealing Temperature Size (bp) BRCA1 Forward TTGCGGGAGGAAAATGGGTAGTTA 50 o C 292

More information

1. Primers for PCR to amplify hairpin stem-loop precursor mir-145 plus different flanking sequence from human genomic DNA.

1. Primers for PCR to amplify hairpin stem-loop precursor mir-145 plus different flanking sequence from human genomic DNA. Supplemental data: 1. Primers for PCR to amplify hairpin stem-loop precursor mir-145 plus different flanking sequence from human genomic DNA. Strategy#1: 20nt at both sides: #1_BglII-Fd primer : 5 -gga

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figures Supplementary Figure 1. MLK1-4 phosphorylate MEK in the presence of RAF inhibitors. (a) H157 cells were transiently transfected with Flag- or HA-tagged MLK1-4

More information

Supporting Online Material. 3. Analysis of in vivo TLR4-mediated response in TRIF-deficient mice

Supporting Online Material. 3. Analysis of in vivo TLR4-mediated response in TRIF-deficient mice Supporting Online Material 1. Materials and Methods 2. Generation of TRIF-deficient mice 3. Analysis of in vivo TLR4-mediated response in TRIF-deficient mice 4. Measurement of LPS-induced IRAK-1 kinase

More information

Data Sheet CD137/NF-κB Reporter - HEK293 Recombinant Cell Line Catalog # 79289

Data Sheet CD137/NF-κB Reporter - HEK293 Recombinant Cell Line Catalog # 79289 Data Sheet CD137/NF-κB Reporter - HEK293 Recombinant Cell Line Catalog # 79289 Background Human CD137 (4-1BB; TNFRS9) is an inducible co-stimulatory molecule that activates T cells. CD137:CD137L-mediated

More information

Transcriptional regulation of IFN-l genes in Hepatitis C virus-infected hepatocytes via IRF-3 IRF-7 NF- B complex

Transcriptional regulation of IFN-l genes in Hepatitis C virus-infected hepatocytes via IRF-3 IRF-7 NF- B complex POSTER PRESENTATION Transcriptional regulation of IFN-l genes in Hepatitis C virus-infected hepatocytes via IRF-3 IRF-7 NF- B complex Hai-Chon Lee *, Je-In Youn, Kyungwha Lee, Hwanyul Yong, Seung-Yong

More information

Xiaoqing Zhang, Guo Zhang, Hai Zhang, Michael Karin, Hua Bai, and Dongsheng Cai

Xiaoqing Zhang, Guo Zhang, Hai Zhang, Michael Karin, Hua Bai, and Dongsheng Cai Cell, Volume 135 Supplemental Data Hypothalamic IKKβ/NF-κB and ER Stress Link Overnutrition to Energy Imbalance and Obesity Xiaoqing Zhang, Guo Zhang, Hai Zhang, Michael Karin, Hua Bai, and Dongsheng Cai

More information

Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using

Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using Supplementary Methods Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using the Qiagen RNeasy Mini Kit, according to the manufacturer s protocol with on-column DNase digestion

More information

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin

More information

Glutamine activates STAT3 to control cancer cell proliferation. independently of glutamine metabolism

Glutamine activates STAT3 to control cancer cell proliferation. independently of glutamine metabolism Glutamine activates STAT3 to control cancer cell proliferation S1 independently of glutamine metabolism Andrea Cacace, Martina Sboarina, Thibaut Vazeille, and Pierre Sonveaux Supplementary tables: Table

More information

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53 Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -

More information

Gene Forward (5 to 3 ) Reverse (5 to 3 ) Accession # PKA C- TCTGAGGAAATGGGAGAACC CGAGGGTTTTCTTCCTCTCAA NM_011100

Gene Forward (5 to 3 ) Reverse (5 to 3 ) Accession # PKA C- TCTGAGGAAATGGGAGAACC CGAGGGTTTTCTTCCTCTCAA NM_011100 Supplementary Methods: Materials. BRL37344, insulin, 3-isobutyl-1-methylxanthine, dibutyryl camp (Bt2-cAMP) and 8-Bromoadenosine 3,5 -cyclic monophosphate sodium (8-br-cAMP), cilostamide, adenosine deaminase,

More information

Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail

Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail were stained with propidium iodide (PI), anti-cd45 (FITC),

More information

gacgacgaggagaccaccgctttg aggcacattgaaggtctcaaacatg

gacgacgaggagaccaccgctttg aggcacattgaaggtctcaaacatg Supplementary information Supplementary table 1: primers for cloning and sequencing cloning for E- Ras ggg aat tcc ctt gag ctg ctg ggg aat ggc ttt gcc ggt cta gag tat aaa gga agc ttt gaa tcc Tpbp Oct3/4

More information

Supplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total

Supplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total Supplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total ERK in the aortic tissue from the saline- or AngII-infused

More information

SI Appendix. Tumor-specific CD8 + Tc9 cells are superior effector than Tc1 cells for. adoptive immunotherapy of cancers

SI Appendix. Tumor-specific CD8 + Tc9 cells are superior effector than Tc1 cells for. adoptive immunotherapy of cancers SI Appendix Tumor-specific CD8 + Tc9 cells are superior effector than Tc1 cells for adoptive immunotherapy of cancers Yong Lu, Bangxing Hong, Haiyan Li, Yuhuan Zheng, Mingjun Zhang, Siqing Wang, Jianfei

More information

For intravenous (IV) administration, LY was formulated in 10 % N methyl pyrrolidine / 18 %

For intravenous (IV) administration, LY was formulated in 10 % N methyl pyrrolidine / 18 % Supplementary Material and Methods Drug formulation For intravenous (IV) administration, LY2835219 was formulated in 10 % N methyl pyrrolidine / 18 % hydroxypropyl β cyclodextrin in 22.5 mm phosphate buffer

More information

a Lamtor1 (gene) b Lamtor1 (mrna) c WT Lamtor1 Lamtor1 flox Lamtor2 A.U. p = LysM-Cre Lamtor3 Lamtor4 Lamtor5 BMDMs: Φ WT Φ KO β-actin WT BMDMs

a Lamtor1 (gene) b Lamtor1 (mrna) c WT Lamtor1 Lamtor1 flox Lamtor2 A.U. p = LysM-Cre Lamtor3 Lamtor4 Lamtor5 BMDMs: Φ WT Φ KO β-actin WT BMDMs a Lamtor (gene) b Lamtor (mrna) c BMDMs: Φ WT Φ KO Lamtor flox 8 bp LysM-Cre 93 bp..5 p =.4 WT BMDMs: Φ WT Φ KO Lamtor (protein) BMDMs: Φ WT Φ KO Lamtor 8 kda Lamtor 4 kda Lamtor3 4 kda Lamtor4 kda Lamtor5.5

More information

Supplementary Material. Levels of S100B protein drive the reparative process in acute muscle injury and muscular dystrophy

Supplementary Material. Levels of S100B protein drive the reparative process in acute muscle injury and muscular dystrophy Supplementary Material Levels of protein drive the reparative process in acute muscle injury and muscular dystrophy Francesca Riuzzi 1,4 *, Sara Beccafico 1,4 *, Roberta Sagheddu 1,4, Sara Chiappalupi

More information

HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid

HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid SUPPLEMENTAL MATERIALS AND METHODS Cell culture, transfection and treatments. HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid encoding vmia (HeLa vmia) 1 were cultured

More information

Supplemental Information

Supplemental Information Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai

More information

Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells. in the injured sites

Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells. in the injured sites Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells in the injured sites Yunyuan Li, Reza Baradar Jalili, Aziz Ghahary Department of Surgery, University of British Columbia,

More information

In general, 8- to 10-week-old adult females were ovariectomized and rested for 10 days

In general, 8- to 10-week-old adult females were ovariectomized and rested for 10 days Animal injections and tissue processing In general, 8- to 10-week-old adult females were ovariectomized and rested for 10 days before they received any injections. Mice were injected with sesame seed oil

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Microarray Data Analysis Gene expression data were obtained by hybridising a total of 24 samples from 6 experimental groups (n=4 per group) to Illumina HumanHT-12 Expression BeadChips.

More information

Supplementary Infomation

Supplementary Infomation Supplementary Infomation Mycobacterium avium MAV2054 protein induces macrophage apoptosis through targeting to mitochondria and reduces intracellular growth of the bacteria. Kang-In Lee 1,2, Jake Whang

More information

hours after food deprivation hours after food deprivation

hours after food deprivation hours after food deprivation Figure S.6 protein (fasted / control).2.8.4 p47 p97 Rpt Ufd 3 24 48 hours after food deprivation mrn (fasted / control) C mrn (denervated / control) 2.5 2.5.5 3.5 3 2.5 2.5.5 p97 ** Npl4 Ufd p47 2 3 4

More information