Development of NGS metabarcoding. characterization of aerobiological samples. Lucia Muggia

Introduction to taxonomic analysis of metagenomic amplicon and shotgun data with QIIME. Peter Sterk EBI Metagenomics Course 2014

Introduction to taxonomic analysis of metagenomic amplicon and shotgun data with QIIME Peter Sterk EBI Metagenomics Course 2014 1 Taxonomic analysis using next-generation sequencing Objective we want to

Introduction to Bioinformatics analysis of Metabarcoding data

Introduction to Bioinformatics analysis of Metabarcoding data Theoretical part Alvaro Sebastián Yagüe Experimental design Sampling Sample processing Sequencing Sequence processing Experimental design Sampling

CBC Data Therapy. Metagenomics Discussion

CBC Data Therapy Metagenomics Discussion General Workflow Microbial sample Generate Metaomic data Process data (QC, etc.) Analysis Marker Genes Extract DNA Amplify with targeted primers Filter errors,

Applications of Next Generation Sequencing in Metagenomics Studies

Applications of Next Generation Sequencing in Metagenomics Studies Francesca Rizzo, PhD Genomix4life Laboratory of Molecular Medicine and Genomics Department of Medicine and Surgery University of Salerno

Fungal ITS Bioinformatics Efforts in Alaska

Fungal ITS Bioinformatics Efforts in Alaska D. Lee Taylor ltaylor@iab.alaska.edu Institute of Arctic Biology University of Alaska Fairbanks Shawn Houston Minnesota Supercomputing Institute University of

Evaluation of a Short-Term Scientific Mission (STSM) Cost Action ES1406 KEYSOM soil biodiversity of European transect

Evaluation of a Short-Term Scientific Mission (STSM) Cost Action ES1406 KEYSOM soil biodiversity of European transect Name: KEYSOM soil biodiversity of European transect COST STSM Reference Number: COST-STSM-ES1406-35328

Conducting Microbiome study, a How to guide

Conducting Microbiome study, a How to guide Sam Zhu Supervisor: Professor Margaret IP Joint Graduate Seminar Department of Microbiology 15 December 2015 Why study Microbiome? ü Essential component, e.g.

Microbiomes and metabolomes

Microbiomes and metabolomes Michael Inouye Baker Heart and Diabetes Institute Univ of Melbourne / Monash Univ Summer Institute in Statistical Genetics 2017 Integrative Genomics Module Seattle @minouye271

Tapping the Potentials of Lichens Experimental Lichenology. The way ahead

Tapping the Potentials of Lichens Experimental Lichenology. The way ahead Lichens as Novel sources of Secondary compounds and Genetic material Lichens are considered as the first colonizers terrestial

What is metagenomics?

Metagenomics What is metagenomics? Term first used in 1998 by Jo Handelsman "the application of modern genomics techniques to the study of communities of microbial organisms directly in their natural environments,

Microbiome Analysis. Research Day 2012 Ranjit Kumar

Microbiome Analysis Research Day 2012 Ranjit Kumar Human Microbiome Microorganisms Bad or good? Human colon contains up to 100 trillion bacteria. Human microbiome - The community of bacteria that live

An introduction into 16S rrna gene sequencing analysis. Stefan Boers

An introduction into 16S rrna gene sequencing analysis Stefan Boers Microbiome, microbiota or metagenomics? Microbiome The entire habitat, including the microorganisms, their genomes (i.e., genes) and

dbcamplicons pipeline Amplicons

dbcamplicons pipeline Amplicons Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu Microbial community analysis Goal:

Metagenomics Computational Genomics

Metagenomics 02-710 Computational Genomics Metagenomics Investigation of the microbes that inhabit oceans, soils, and the human body, etc. with sequencing technologies Cooperative interactions between

dbcamplicons pipeline Amplicons

dbcamplicons pipeline Amplicons Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu Microbial community analysis Goal:

HMP Data Set Documentation

HMP Data Set Documentation Introduction This document provides detail about files available via the DACC website. The goal of the HMP consortium is to make the metagenomics sequence data generated by the

What does standard plankton monitoring miss? Using meta-barcoding and an epibenthic sledge to reveal the hidden diversity of the shelf sea zooplankton

What does standard plankton monitoring miss? Using meta-barcoding and an epibenthic sledge to reveal the hidden diversity of the shelf sea zooplankton Pennie Lindeque, Helen Parry and Angus Atkinson Traditional

Diversity Profiling Service: Sample preparation guide

Diversity Profiling Service: Sample preparation guide CONTENTS 1 Overview: Microbial Diversity Profiling at AGRF... 2 2 Submission types to the Microbial Diversity Profiling Service... 3 2.1 Diversity

Microbiomics I August 24th, Introduction. Robert Kraaij, PhD Erasmus MC, Internal Medicine

Microbiomics I August 24th, 2017 Introduction Robert Kraaij, PhD Erasmus MC, Internal Medicine r.kraaij@erasmusmc.nl Welcome to Microbiomics I Infection & Immunity MSc students Only first day no practicals

Robert Edgar. Independent scientist

Robert Edgar Independent scientist robert@drive5.com www.drive5.com Reads FASTQ format Millions of reads Many Gb USEARCH commands "UPARSE pipeline" OTU sequences FASTA format >Otu1 GATTAGCTCATTCGTA >Otu2

Bioinformatics for Microbial Biology

Bioinformatics for Microbial Biology Chaochun Wei ( 韦朝春 ) ccwei@sjtu.edu.cn http://cbb.sjtu.edu.cn/~ccwei Fall 2013 1 Outline Part I: Visualization tools for microbial genomes Tools: Gbrowser Part II:

Bioinformatic tools for metagenomic data analysis

Bioinformatic tools for metagenomic data analysis MEGAN - blast-based tool for exploring taxonomic content MG-RAST (SEED, FIG) - rapid annotation of metagenomic data, phylogenetic classification and metabolic

SANBio BIOINFORMATICS TRAINING COURSE THE MICROBIOME: ANALYSIS OF NGS DATA CBIO-PIPELINE SAMSON, KM

SANBio BIOINFORMATICS TRAINING COURSE THE MICROBIOME: ANALYSIS OF NGS DATA CBIO-PIPELINE SAMSON, KM 10/23/2017 Microbiome : Analysis of NGS Data 1 Outline Background Wet Lab! Raw reads Quality Assessment

Carl Woese. Used 16S rrna to develop a method to Identify any bacterium, and discovered a novel domain of life

METAGENOMICS Carl Woese Used 16S rrna to develop a method to Identify any bacterium, and discovered a novel domain of life His amazing discovery, coupled with his solitary behaviour, made many contemporary

Microbiome: Metagenomics 4/4/2018

Microbiome: Metagenomics 4/4/2018 metagenomics is an extension of many things you have already learned! Genomics used to be computationally difficult, and now that s metagenomics! Still developing tools/algorithms

Analysis of milk microbial profiles using 16s rrna gene sequencing in milk somatic cells and fat

Analysis of milk microbial profiles using 16s rrna gene sequencing in milk somatic cells and fat Juan F. Medrano Anna Cuzco* Alma Islas-Trejo Armand Sanchez* Olga Francino* Dept. of Animal Science University

Getting of the representative sequences from the clusters (consensus/most abundant) *(MAFFT) Identification of OTUs *(BLAST)

Illumina pair-end data (R1 & R2 FASTQ) FASTA FASTQ TEXT joining of pair-end data *(fastq-join) v2.0 Quality filtering/sequence trimming/removing of ambiguous bases Grouping sequences by BARCODE motives

Introduction to OTU Clustering. Susan Huse August 4, 2016

Introduction to OTU Clustering Susan Huse August 4, 2016 What is an OTU? Operational Taxonomic Units a.k.a. phylotypes a.k.a. clusters aggregations of reads based only on sequence similarity, independent

Processing Ion AmpliSeq Data using NextGENe Software v2.3.0

Processing Ion AmpliSeq Data using NextGENe Software v2.3.0 July 2012 John McGuigan, Megan Manion, Kevin LeVan, CS Jonathan Liu Introduction The Ion AmpliSeq Panels use highly multiplexed PCR in order

Sequencing Errors, Diversity Estimates, and the Rare Biosphere

Sequencing Errors, Diversity Estimates, and the Rare Biosphere or Living in the shadow of Errares Susan Huse Marine Biological Laboratory June 13, 2012 Consistent Community Profile across samples and environments

A comparison of sequencing platforms and bioinformatics pipelines for compositional analysis of the gut microbiome

Allali et al. BMC Microbiology (2017) 17:194 DOI 10.1186/s12866-017-1101-8 RESEARCH ARTICLE Open Access A comparison of sequencing platforms and bioinformatics pipelines for compositional analysis of the

Introduc)on to QIIME on the IPython Notebook

Strategies and Techniques for Analyzing Microbial Population Structures Introduc)on to QIIME on the IPython Notebook Rob Knight Adam Robbins- Pianka Will Van Treuren Yoshiki Vázquez- Baeza ( @yosmark )

choose MBL-REGISTER user: dm00834 password: dm00834 http://register.mbl.edu/ stamps.mbl.edu this uses the username and password on your STAMPS name badge Strategies for Analysis of Microbial Population

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)

Guideline for the submission of DNA sequences derived from genetically modified organisms and associated annotations within the framework of Directive 2001/18/EC and Regulation (EC) No 1829/2003 European

I AM NOT A METAGENOMIC EXPERT. I am merely the MESSENGER. Blaise T.F. Alako, PhD EBI Ambassador

I AM NOT A METAGENOMIC EXPERT I am merely the MESSENGER Blaise T.F. Alako, PhD EBI Ambassador blaise@ebi.ac.uk Hubert Denise Alex Mitchell Peter Sterk Sarah Hunter http://www.ebi.ac.uk/metagenomics Blaise

Diversity Profiling Service: Sample preparation guide

Diversity Profiling Service: Sample preparation guide CONTENTS 1 Overview: Microbial Diversity Profiling at AGRF... 2 2 Submission types to the Microbial Diversity Profiling Service... 3 2.1 Diversity

Carl Woese. Used 16S rrna to developed a method to Identify any bacterium, and discovered a novel domain of life

METAGENOMICS Carl Woese Used 16S rrna to developed a method to Identify any bacterium, and discovered a novel domain of life His amazing discovery, coupled with his solitary behaviour, made many contemporary

COMPARING MICROBIAL COMMUNITY RESULTS FROM DIFFERENT SEQUENCING TECHNOLOGIES

COMPARING MICROBIAL COMMUNITY RESULTS FROM DIFFERENT SEQUENCING TECHNOLOGIES Tyler Bradley * Jacob R. Price * Christopher M. Sales * * Department of Civil, Architectural, and Environmental Engineering,

PREDICT Host DNA Barcoding Guide

PREDICT Host DNA Barcoding Guide Contents: 1. Rationale for Barcoding.. Page 2 2. Implementation... Page 2 3. PCR Protocols.... Page 3 4. Data Interpretation... Page 5 5. Data Entry into EIDITH.... Page

edna and Plant Pathogen Metabarcoding

Use of Technology in the Natural Environment SNH Sharing Good Practice day June 7 2017 edna and Plant Pathogen Metabarcoding David Cooke Leighton Pritchard & Peter Thorpe Sarah Green Tree Health and Plant

A step towards understanding Polycyclic Aromatic Hydrocarbons degradation by microbial communities

7th Annual Conference on the Advances in Land Contamination Assessment and Remediation A step towards understanding Polycyclic Aromatic Hydrocarbons degradation by microbial communities Kevin Bayle Ph.D.

TECHNIQUES FOR STUDYING METAGENOME DATASETS METAGENOMES TO SYSTEMS.

TECHNIQUES FOR STUDYING METAGENOME DATASETS METAGENOMES TO SYSTEMS. Ian Jeffery I.Jeffery@ucc.ie What is metagenomics Metagenomics is the study of genetic material recovered directly from environmental

Contents 16S rrna SEQUENCING DATA ANALYSIS TUTORIAL WITH QIIME... 5

QIIME Analysis 1 Contents 16S rrna SEQUENCING DATA ANALYSIS TUTORIAL WITH QIIME... 5 Report Overview... 5 How to Obtain Microbiome Data... 6 How to Setup QIIME... 7 Essential files for QIIME... 7 Sequence

Next-Gen Sequencing in the High School Classroom. April 11, 2017 BOSLAB Mark Hartman

Next-Gen Sequencing in the High School Classroom April 11, 2017 BOSLAB Mark Hartman Outline Introduce the BioSeq program Walk through one of our favorite projects as an example of what we do Technical

arxiv: v1 [q-bio.gn] 25 Nov 2015

MetaScope - Fast and accurate identification of microbes in metagenomic sequencing data Benjamin Buchfink 1, Daniel H. Huson 1,2 & Chao Xie 2,3 arxiv:1511.08753v1 [q-bio.gn] 25 Nov 2015 1 Department of

ngs metagenomics target variation amplicon bioinformatics diagnostics dna trio indel high-throughput gene structural variation ChIP-seq mendelian

Metagenomics T TM storage genetics assembly ncrna custom genotyping RNA-seq de novo mendelian ChIP-seq exome genomics indel ngs trio prediction metagenomics SNP resequencing bioinformatics diagnostics

Methods for the phylogenetic inference from whole genome sequences and their use in Prokaryote taxonomy. M. Göker, A.F. Auch, H. P.

Methods for the phylogenetic inference from whole genome sequences and their use in Prokaryote taxonomy M. Göker, A.F. Auch, H. P. Klenk Contents 1. Short introduction into the role of DNA DNA hybridization

Welcome to the NGS webinar series

Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic

Getting of the representative sequences from the clusters (consensus/most abundant) *(MAFFT) Identification of OTUs *(BLAST)

Illumina pair-end data (R1 & R2 FASTQ) FASTA FASTQ TEXT joining of pair-end data *(fastq-join) v2.0 Quality filtering/sequence trimming/removing of ambiguous bases Grouping sequences by BARCODE motives

CBC Data Therapy. Metatranscriptomics Discussion

CBC Data Therapy Metatranscriptomics Discussion Metatranscriptomics Extract RNA, subtract rrna Sequence cdna QC Gene expression, function Institute for Systems Genomics: Computational Biology Core bioinformatics.uconn.edu

Monitoring the air quality plans actions: emissions inventory. Elisabetta Angelino ARPA Lombardia

Monitoring the air quality plans actions: emissions inventory Elisabetta Angelino ARPA Lombardia ThematicPillars ASSISTANT TO ADMINISTRATIVE AND FINANCIAL MANAGER ADMINISTRATIVE AND FINANCIAL MANAGER MANAGEMENT

An innovative DNA analysis to control raw materials and finished products : Metabarcoding analysis Fabienne MOREAU Qualtech Group/ADNid Company

An innovative DNA analysis to control raw materials and finished products : Metabarcoding analysis Fabienne MOREAU Qualtech Group/ADNid Company Qualtech group/adnid ADNid is a provider of DNA analyses

Protist diversity along a salinity gradient in a coastal lagoon

The following supplement accompanies the article Protist diversity along a salinity gradient in a coastal lagoon Sergio Balzano*, Elsa Abs, Sophie C. Leterme *Corresponding author: sergio.balzano@nioz.nl

Supplementary Online Content

Supplementary Online Content Pannaraj PS, Li F, Cerini C, et al. Association between breast milk bacterial communities and establishment and development of the infant gut microbiome. JAMA Pediatr. Published

Non-biological synthetic spike-in controls and the AMPtk software pipeline improve mycobiome data

Non-biological synthetic spike-in controls and the AMPtk software pipeline improve mycobiome data Jonathan M. Palmer*, Michelle A. Jusino*, Mark T. Banik and Daniel L. Lindner Center for Forest Mycology

Infectious Disease Omics

Infectious Disease Omics Metagenomics Ernest Diez Benavente LSHTM ernest.diezbenavente@lshtm.ac.uk Course outline What is metagenomics? In situ, culture-free genomic characterization of the taxonomic and

ADN environnemental et biodiversité

ADN environnemental et biodiversité Pierre Taberlet Laboratoire d'ecologie Alpine, CNRS UMR 5553 Université Grenoble Alpes, Grenoble, France AFB, Paris, 18 Octobre 2017 Environmental DNA and biodiversity

15:30-16:15 Sean Prosser New Developments for Natural History Collection Barcoding. DNA Barcoding Natural History Collections

15:30-16:15 Sean Prosser New Developments for Natural History Collection Barcoding DNA Barcoding Natural History Collections Recap Barcoding Museum Specimens Age Target Amplicons Final Sequence Length

Biotechnology Project Lab

Only for teaching purposes - not for reproduction or sale Advanced Cell Biology & Biotechnology Biotechnology Project Lab Giovanna Gambarotta COMPETENCES THAT YOU WILL ACQUIRE - compare DNA sequences -

The use of bioinformatic analysis in support of HGT from plants to microorganisms. Meeting with applicants Parma, 26 November 2015

The use of bioinformatic analysis in support of HGT from plants to microorganisms Meeting with applicants Parma, 26 November 2015 WHY WE NEED TO CONSIDER HGT IN GM PLANT RA Directive 2001/18/EC As general

Nature Biotechnology: doi: /nbt Supplementary Figure 1. MBQC base beta diversity, major protocol variables, and taxonomic profiles.

Supplementary Figure 1 MBQC base beta diversity, major protocol variables, and taxonomic profiles. A) Multidimensional scaling of MBQC sample Bray-Curtis dissimilarities (see Fig. 1). Labels indicate centroids

mothur Workshop for Amplicon Analysis Michigan State University, 2013

mothur Workshop for Amplicon Analysis Michigan State University, 2013 Tracy Teal MMG / ICER tkteal@msu.edu Kevin Theis Zoology / BEACON theiskev@msu.edu mothur Mission to develop a single piece of open-source,

Bioinformatics- Data Analysis

Bioinformatics- Data Analysis Erin H. Graf, PhD, D(ABMM) Infectious Disease Diagnostics Laboratory, Children s Hospital of Philadelphia Department of Pathology and Laboratory Medicine, University of Pennsylvania

Construction and operation of the LifeWatchGreece Research Infrastructure (ESFRI): examples of Biodiversity Informatics virtual laboratories

Construction and operation of the LifeWatchGreece Research Infrastructure (ESFRI): examples of Biodiversity Informatics virtual laboratories Christos Arvanitidis, Anastasis Oulas, Christina Pavloudi, Jacques

Comparative Analysis of Fungal Primers

Comparative Analysis of Fungal Primers Background Most eukaryotes encode ribosomal genes in an operon, with a relatively unconserved internal transcribed spacer (ITS) between conserved genes (order = 18S

Experimental Design Microbial Sequencing

Experimental Design Microbial Sequencing Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu General rules for preparing

Assigning Sequences to Taxa CMSC828G

Assigning Sequences to Taxa CMSC828G Outline Objective (1 slide) MEGAN (17 slides) SAP (33 slides) Conclusion (1 slide) Objective Given an unknown, environmental DNA sequence: Make a taxonomic assignment

SMRT Analysis Barcoding Overview

SMRT Analysis Barcoding Overview Introduction This document is for users with Sequel Systems using SMRT Link v5.0.0 or v5.0.1. This document covers: Barcoding designs, strategies and modes for preparing

Computing for Metagenome Analysis

New Horizons of Computational Science with Heterogeneous Many-Core Processors Computing for Metagenome Analysis National Institute of Genetics Hiroshi Mori & Ken Kurokawa Contents Metagenome Sequence similarity

Chapter 7. Motif finding (week 11) Chapter 8. Sequence binning (week 11)

Course organization Introduction ( Week 1) Part I: Algorithms for Sequence Analysis (Week 1-11) Chapter 1-3, Models and theories» Probability theory and Statistics (Week 2)» Algorithm complexity analysis

Jennifer D. Churchill, Maiko Takahashi, Christina Strobl, Dixie Peters, Christina Capt, Walther Parson, Bruce Budowle

Validation of a Massively Parallel Sequencing Workflow for Mitochondrial DNA Analysis at UNTHSC Center for Human Identification for Missing Persons and Traditional Casework Analyses Jennifer D. Churchill,

Lezione 8. Metagenomica ed environmental DNA (edna)

Lezione 8 Metagenomica ed environmental DNA (edna) Quali campioni e quali dati sono tipici della metagenomica? Target capture and variant calling Alcune definizioni Metagenomics: is the study of all genomes

Quality control for Sequencing Experiments

Quality control for Sequencing Experiments v2018-04 Simon Andrews simon.andrews@babraham.ac.uk Support service for bioinformatics Academic Babraham Institute Commercial Consultancy Support BI Sequencing

Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility

2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,

Spectral Counting Approaches and PEAKS

Spectral Counting Approaches and PEAKS INBRE Proteomics Workshop, April 5, 2017 Boris Zybailov Department of Biochemistry and Molecular Biology University of Arkansas for Medical Sciences 1. Introduction

Sequence variation in the short tandem repeat system SE33 discovered by next generation sequencing

Sequence variation in the short tandem repeat system SE33 discovered by next generation sequencing Eszter Rockenbauer, MSc, PhD and Line Møller, MSc Forensic Geneticist Section of Forensic Genetics Department

Sequencing techniques

Sequencing techniques Workshop on Whole Genome Sequencing and Analysis, 2-4 Oct. 2017 Learning objective: After this lecture, you should be able to account for different techniques for whole genome sequencing

HmmUFOtu: An HMM and phylogenetic placement based ultra-fast taxonomic assignment and OTU picking tool for microbiome amplicon sequencing studies

Zheng et al. Genome Biology (2018) 19:82 https://doi.org/10.1186/s13059-018-1450-0 SOFTWARE HmmUFOtu: An HMM and phylogenetic placement based ultra-fast taxonomic assignment and OTU picking tool for microbiome

Assessing barley malt associated microbial diversity using next generation sequencing

Assessing barley malt associated microbial diversity using next generation sequencing Mandeep Kaur 1, Evan Evans 1, Doug Stewart 2, Agnieszka Janusz 2, Barbara Holland 1 and John Bowman 1 1 University

Exercices: Metagenomics. Find Rapidly OTU with Galaxy Solution

Exercices: Metagenomics Find Rapidly OTU with Galaxy Solution F R É D É R I C E S C U D I É * a n d L U C A S A U E R *, M A R I A B E R N A R D, L A U R E N T C A U Q U I L, K AT I A V I D A L, S A R

Joint RuminOmics/Rumen Microbial Genomics Network Workshop

Joint RuminOmics/Rumen Microbial Genomics Network Workshop Microbiome analysis - Amplicon sequencing Dr. Sinéad Waters Animal and Bioscience Research Department, Teagasc Grange, Ireland Prof. Leluo Guan

PRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5

Molecular Biology-2017 1 PRESENTING SEQUENCES As you know, sequences may either be double stranded or single stranded and have a polarity described as 5 and 3. The 5 end always contains a free phosphate

SMRT Analysis Barcoding Overview (v6.0.0)

SMRT Analysis Barcoding Overview (v6.0.0) Introduction This document applies to PacBio RS II and Sequel Systems using SMRT Link v6.0.0. Note: For information on earlier versions of SMRT Link, see the document

Bioinformatics Course AA 2017/2018 Tutorial 2

UNIVERSITÀ DEGLI STUDI DI PAVIA - FACOLTÀ DI SCIENZE MM.FF.NN. - LM MOLECULAR BIOLOGY AND GENETICS Bioinformatics Course AA 2017/2018 Tutorial 2 Anna Maria Floriano annamaria.floriano01@universitadipavia.it

Analysis of Microbial Diversity in Disturbed Soil

The University of Akron IdeaExchange@UAkron Honors Research Projects The Dr. Gary B. and Pamela S. Williams Honors College Spring 2017 Analysis of Microbial Diversity in Disturbed Soil Tyler G. Sanda University

SAMPLE. Interpretive Criteria for Identification of Bacteria and Fungi by Targeted DNA Sequencing

MM18 Interpretive Criteria for Identification of Bacteria and Fungi by Targeted DNA Sequencing This guideline includes information on sequencing DNA targets of cultured isolates, provides a quantitative

Molecular methods to characterize the microbiota in the mouse tissues

Molecular methods to characterize the microbiota in the mouse tissues Olivier Bouchez, GeT-PlaGe, INRA Toulouse @GeT_Genotoul Who are we? Genomic and transcriptomic core facility spreads on 5 sites GeT

Sanger vs Next-Gen Sequencing

Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics

PrimePCR Assay Validation Report

Gene Information Gene Name major histocompatibility complex, class II, DR beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID HLA-DRB1 Human HLA-DRB1 belongs

MicroSEQ Rapid Microbial Identification System

MicroSEQ Rapid Microbial Identification System Giving you complete control over microbial identification using the gold-standard genotypic method The MicroSEQ ID microbial identification system, based

Incorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits

Incorporating Molecular ID Technology Accel-NGS 2S MID Indexing Kits Molecular Identifiers (MIDs) MIDs are indices used to label unique library molecules MIDs can assess duplicate molecules in sequencing

Report on database pre-processing

Multiscale Immune System SImulator for the Onset of Type 2 Diabetes integrating genetic, metabolic and nutritional data Work Package 2 Deliverable 2.3 Report on database pre-processing FP7-600803 [D2.3

Molecular Sequencing of the Humus Layer in Catskill Soils: Using Deep Sequencing to Characterize Resident Bacterial and Fungal Communities

Molecular Sequencing of the Humus Layer in Catskill Soils: Using Deep Sequencing to Characterize Resident Bacterial and Fungal Communities Julie Urban, PhD Department of Entomology Penn State University

DATA FORMATS AND QUALITY CONTROL

HTS Summer School 12-16th September 2016 DATA FORMATS AND QUALITY CONTROL Romina Petersen, University of Cambridge (rp520@medschl.cam.ac.uk) Luigi Grassi, University of Cambridge (lg490@medschl.cam.ac.uk)

BSC 4445C Genomics Lab: Methods in Data Collection and Analysis

1 BSC 4445C: Special Topics Genomics Lab: Fall 2017 (Forsman) 4 credits Course Description The field of genomics focuses on understanding the collective function of all components encoded in an organism

MicroSEQ Rapid Microbial Identifi cation System

APPLICATION NOTE MicroSEQ Rapid Microbial Identifi cation System MicroSEQ Rapid Microbial Identification System Giving you complete control over microbial identifi cation using the gold-standard genotypic

NGS part 2: applications. Tobias Österlund

NGS part 2: applications Tobias Österlund tobiaso@chalmers.se NGS part of the course Week 4 Friday 13/2 15.15-17.00 NGS lecture 1: Introduction to NGS, alignment, assembly Week 6 Thursday 26/2 08.00-09.45

Student Learning Outcomes (SLOS)

Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get

Microbial Diversity and Assessment (III) Spring, 2007 Guangyi Wang, Ph.D. POST103B

Microbial Diversity and Assessment (III) Spring, 2007 Guangyi Wang, Ph.D. POST103B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm Overview of Last Lecture Taxonomy (three

Evaluation of the liver abscess microbiome and liver abscess prevalence in cattle reared for production of natural branded beef

Evaluation of the liver abscess microbiome and liver abscess prevalence in cattle reared for production of natural branded beef K.L. Huebner, J.N. Martin C.J. Weissend, K.L. Holzer, M. Weinroth, Z. Abdo,