Multiplex CRISPR/Cas9 Assembly System Kit protocol (Yamamoto lab)

Size: px
Start display at page:

Download "Multiplex CRISPR/Cas9 Assembly System Kit protocol (Yamamoto lab)"

Transcription

1 Multiplex CRISPR/Cas9 Assembly System Kit protocol (Yamamoto lab) Ver. 1.1 July 2014 Tetsushi Sakuma, Ph. D. Takashi Yamamoto Lab. Department of Mathematical and Life Sciences Graduate School of Science Hiroshima University Kagamiyama, Higashi-Hiroshima, Hiroshima, Japan TEL: This is a protocol for the construction of all-in-one CRISPR/Cas9 vector expressing multiple (2-7) grnas and a Cas9 nuclease or nickase described in Sakuma et al., Sci Rep, 2014 ( Table of Contents Materials 2 Methods 1. Multiplex CRISPR/Cas9 assembly -STEP Multiplex CRISPR/Cas9 assembly -STEP 2-4 Appendix 5 1

2 Materials Plasmids Multiplex CRISPR/Cas9 Assembly System Kit (Addgene) Insert plasmids: px330s-2, 3, 4, 5, 6, 7 (6 plasmids, Spectinomycin resistant) Vector plasmids for Cas9 nuclease expression: px330a-1x2, 1x3, 1x4, 1x5, 1x6, 1x7 (6 plasmids, Ampicillin resistant) Vector plasmids for Cas9 nickase expression: px330a_d10a-1x2, 1x3, 1x4, 1x5, 1x6, 1x7 (6 plasmids, Ampicillin resistant) Reagents (excluding standard PCR enzymes and reagents for bacterial culture) Maker Product name Cat. No. Size/Unit NEB Quick Ligation Kit M2200S 30 reactions M2200L 150 reactions Thermo Scientific Eco31I* ER units ER units NEB 10 T4 DNA Ligase Reaction Buffer B0202S 6 ml Life Technologies ChargeSwitch-Pro Plasmid Mini Kit CS reactions *BsaI (NEB, R0535S or R0535L) and BsaI-HF (NEB, R3535S or R3535L) can also be used. Primers CRISPR-step2-F: GCCTTTTGCTGGCCTTTTGCTC CRISPR-step2-R: CGGGCCATTTACCGTAAGTTATGTAACG 2

3 Methods 1. Multiplex CRISPR/Cas9 assembly -STEP 1- Insert the annealed oligonucleotides for grna templates. Since our vectors are derivatives of the Feng Zhang lab s px330 plasmid (Addgene, Plasmid 42230), oligonucleotides should be designed according to their previous report ( Using our system, you can make CRISPR/Cas9 vectors coexpressing 2-7 grnas and Cas9 nuclease/nickase. It is necessary that you choose appropriate combinations of vectors for the desired applications. DOI: /srep05400 To perform STEP1 reactions, you can conduct conventional BpiI (BbsI) digestion and ligation procedures. Alternatively, you can also conduct Golden Gate assembly-like method (see Appendix for detailed reaction conditions). Transform µl of the reaction product directly to chemical competent E. coli such as XL1-Blue and streak the transformant on Spectinomycin/Ampicillin-LB plate as described in Appendix. 3

4 Culture O/N at 37 C. Pick two clones for each sample and culture them with 100 ng/µl Spectinomycin/Ampicillin-LB media. Purify the plasmids using Miniprep kit. To check the insert, BpiI digestion should be performed. If the oligonucleotides are correctly inserted, the plasmids are no longer cut by BpiI. 2. Multiplex CRISPR/Cas9 assembly -STEP 2- Perform 2nd-step assembly using the plasmids constructed in the section 1, following protocols described in Appendix. Transform the reaction product to XL1-Blue and streak the transformant on Ampicillin/X-gal/IPTG-LB plate. Culture O/N at 37 C. Pick white colonies and screen for correctly assembled clones by colony PCR. You can use CRISPR-step2-F and CRISPR-step2-R primers both for px330a and px330a_d10a vectors. The detailed reaction condition is described in Appendix. DOI: /srep05400 Culture the desired clones and purify the plasmids using Miniprep kit. 4

5 Multiplex CRISPR/Cas9 Assembly System Kit protocol -Appendix- Bench protocol for STEP1 & 2 (Yamamoto lab) STEP1 Golden Gate reaction (µl) 25 ng/µl vector µm annealed oligos T4 DNA ligase buf. 0.2 BpiI 0.1 premix 1.2 µl each Quick ligase 0.1 SDW 0.8 Total Additional digestion: 5min. 10min. add 10 G buf. 0.2 µl, BpiI 0.1 µl. 3 premix 0.3 µl each 37, 1 hr / 80, 5min. / 4, Transformation Product 0.5 XL1-Blue (homemade) 10 on ice >5min. 42, 30 sec. on ice plating (100 µg/ml Spec or Amp plate) 5

6 STEP2 Number of grna cassettes Golden Gate reaction ng/µl px330s vector ng/µl px330a vector T4 DNA ligase buf. 2 Eco31I 1 premix 4 µl each Quick ligase 1 5min. 10min. SDW Total 20 Additional digestion: add 10 G buf. 2 µl, Eco31I 1 µl. premix 3 µl each 37, 30min. / 80, 5min. / 4, Transformation Product 2 XL1-Blue (homemade) 20 on ice >5min. 42, 30 sec. on ice plating (100 µg/ml Amp plate w/ X-gal+IPTG) Colony PCR 10X buf. for Hybripol 0.8 dntps µm primer (CRISPR-step2-F/R) Hybripol DNA polymerase (BIOLINE)* 0.04 MgCl SDW s. 15s. 15s. 90s. 50s. Total 8 27 *Any other standard Taq polymerase can be used. 6

Multiplex CRISPR/Cas9 Assembly System Kit protocol (Yamamoto lab)

Multiplex CRISPR/Cas9 Assembly System Kit protocol (Yamamoto lab) Multiplex CRISPR/Cas9 Assembly System Kit protocol (Yamamoto lab) Ver. 2.0 May 2015 Tetsushi Sakuma, Ph. D. E-mail: tetsushi-sakuma@hiroshima-u.ac.jp Takashi Yamamoto Lab. Department of Mathematical and

More information

Platinum Gate TALEN construction protocol (Yamamoto lab)

Platinum Gate TALEN construction protocol (Yamamoto lab) Platinum Gate TALEN construction protocol (Yamamoto lab) Ver. 1.0 Jan. 2014 Tetsushi Sakuma, Ph. D. E-mail: tetsushi-sakuma@hiroshima-u.ac.jp Takashi Yamamoto Lab. Department of Mathematical and Life Sciences

More information

Yamamoto lab TALEN construction & evaluation protocol

Yamamoto lab TALEN construction & evaluation protocol Yamamoto lab TALEN construction & evaluation protocol Ver. 1.0 Feb. 2013 Tetsushi Sakuma, Ph. D. E-mail: tetsushi-sakuma@hiroshima-u.ac.jp Takashi Yamamoto Lab. Department of Mathematical and Life Sciences

More information

Supplementary Methods pcfd5 cloning protocol

Supplementary Methods pcfd5 cloning protocol Supplementary Methods cloning protocol vermilion trna grna trna grna U6:3 Terminator AmpR attb is a vector for expressing one or multiple trna-flanked Cas9 grnas under the control of the strong, ubiquitous

More information

CELLTECHGEN For Research Only. Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector)

CELLTECHGEN For Research Only. Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector) Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector) Catalog number: CTG-CAS9-18 Introduction The vector Lenti-EF1 -Cas9-EGFP-U6 sgrna is designed for

More information

pgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20

pgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20 pgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20 1 Kit Contents Contents pgm-t Cloning Kit pgm-t Vector (50 ng/μl) 20 μl T4 DNA Ligase (3 U/μl) 20 μl 10X T4 DNA Ligation Buffer 30 μl

More information

CELLTECHGEN For Research Only. Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector)

CELLTECHGEN For Research Only. Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector) Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector) Catalog number: CTG-CAS9-11 Introduction The vector Lenti-U6 sgrna-ef1 -Puro is designed for expression

More information

pgm-t Cloning Kit For direct cloning of PCR products generated by Taq DNA polymerases For research use only Cat. # : GVT202 Size : 20 Reactions

pgm-t Cloning Kit For direct cloning of PCR products generated by Taq DNA polymerases For research use only Cat. # : GVT202 Size : 20 Reactions pgm-t Cloning Kit For direct cloning of PCR products generated by Taq DNA polymerases Cat. # : GVT202 Size : 20 Reactions Store at -20 For research use only 1 pgm-t Cloning Kit Cat. No.: GVT202 Kit Contents

More information

Farnham Lab Protocol for CRISPR/Cas 9- mediated enhancer deletion using a puromycin selection vector Created by Yu (Phoebe) Guo

Farnham Lab Protocol for CRISPR/Cas 9- mediated enhancer deletion using a puromycin selection vector Created by Yu (Phoebe) Guo Farnham Lab Protocol for CRISPR/Cas 9- mediated enhancer deletion using a puromycin selection vector Created by Yu (Phoebe) Guo 20151024 Part A. Design grna oligos 1. Design grnas Go to Optimized CRISPR

More information

HE Swift Cloning Kit

HE Swift Cloning Kit HE Swift Cloning Kit For high-efficient cloning of PCR products either blunt or sticky-end Kit Contents Contents VTT-BB05 phe Vector (35 ng/µl) 20 µl T4 DNA Ligase (3 U/µl) 20 µl 2 Reaction Buffer 100

More information

A protocol for the assembly of 2 or 3 sgrnas. Table of contents

A protocol for the assembly of 2 or 3 sgrnas. Table of contents A protocol for the assembly of 2 or 3 sgrnas Table of contents Simplified protocol... 2 Table 1 Nomenclature of PCR products/primers... 3 Table 2 Structure features of primers... 3 Sequence of DT1T2-PCR

More information

Data Sheet Quick PCR Cloning Kit

Data Sheet Quick PCR Cloning Kit Data Sheet Quick PCR Cloning Kit 6044 Cornerstone Ct. West, Ste. E DESCRIPTION: The Quick PCR Cloning Kit is a simple and highly efficient method to insert any gene or DNA fragment into a vector, without

More information

PrecisionX Multiplex grna Cloning Kit. Cat. # CAS9-GRNA-KIT. User Manual

PrecisionX Multiplex grna Cloning Kit. Cat. # CAS9-GRNA-KIT. User Manual PrecisionX Multiplex grna Cloning Kit Store at -20 C upon receipt A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in the Licensing

More information

Mutagenesis PCR I (Multiple Site Directed Mutagenesis)

Mutagenesis PCR I (Multiple Site Directed Mutagenesis) Mutagenesis Mutagenesis PCR I (Multiple Site Directed Mutagenesis) Mixture 25µl total reaction volume : 1. 2.5 µl of 10X Taq lligase buffer (need the NAD for Taq ligase) 2. 0.5 µl 100mM ATP 3. X µl (50-100

More information

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Instruction manual Blunting high 0810 Blunting high F0990K BLK-101 20 reactions Store at -20 C. Contents [1] Introduction [2] Components [3] Protocol 1. Blunting 2. Ligation [4] Troubleshooting [5] References

More information

Supplementary Information

Supplementary Information Supplementary Information Vidigal and Ventura a wt locus 5 region 3 region CCTCTGCCACTGCGAGGGCGTCCAATGGTGCTTG(...)AACAGGTGGAATATCCCTACTCTA predicted deletion clone 1 clone 2 clone 3 CCTCTGCCACTGCGAGGGCGTC-AGGTGGAATATCCCTACTCTA

More information

Golden Gate TALEN assembly

Golden Gate TALEN assembly Golden Gate TALEN assembly This is an expanded and slightly modified TAL assembly protocol published in the original form in Cermak, et al., 2011 (http://dx.doi.org/10.1093/nar/gkr218) Modifications to

More information

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction Amplify your insert or verify its presence 3H Taq platinum PCR mix primers Ultrapure Water PCR tubes PCR machine A. Insert amplification For insert amplification, use the Taq

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

YG1 Control. YG1 PstI XbaI. YG5 PstI XbaI Water Buffer DNA Enzyme1 Enzyme2

YG1 Control. YG1 PstI XbaI. YG5 PstI XbaI Water Buffer DNA Enzyme1 Enzyme2 9/9/03 Aim: Digestion and gel extraction of YG, YG3, YG5 and 8/C. Strain: E. coli DH5α Plasmid: Bba_J600, psbc3 4,, 3 6 7, 8 9 0, 3, 4 8/C 8/C SpeI PstI 3 3 x3 YG YG PstI XbaI.5 3.5 x YG3 YG3 PstI XbaI

More information

Ready_to_use Fast Seamless Cloning Kit. User Manual

Ready_to_use Fast Seamless Cloning Kit. User Manual For general laboratory use. Not for use in diagnostic procedures. FOR IN VITRO USE ONLY. Ready_to_use Fast Seamless Cloning Kit User Manual 1 / 6 Tel: 021-58975266 Fax: 021-50800270 Email:tech@dogene.com

More information

Conversion of plasmids into Gateway compatible cloning

Conversion of plasmids into Gateway compatible cloning Conversion of plasmids into Gateway compatible cloning Rafael Martinez 14072011 Overview: 1. Select the right Gateway cassette (A, B or C). 2. Design primers to amplify the right Gateway cassette from

More information

Guide-it Indel Identification Kit User Manual

Guide-it Indel Identification Kit User Manual Clontech Laboratories, Inc. Guide-it Indel Identification Kit User Manual Cat. No. 631444 (120114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA

More information

Ligation Independent Cloning (LIC) Procedure

Ligation Independent Cloning (LIC) Procedure Ligation Independent Cloning (LIC) Procedure Ligation Independent Cloning (LIC) LIC cloning allows insertion of DNA fragments without using restriction enzymes into specific vectors containing engineered

More information

Generation of gene knockout vectors for Dictyostelium discoideum

Generation of gene knockout vectors for Dictyostelium discoideum Generation of gene knockout vectors for Dictyostelium discoideum Instruction manual Last date of revision April 2012 2015 Version PR29-0001 PR29-0003 www.stargate.com This manual can be downloaded under

More information

TYPE IIS MEDIATED PARALLEL DNA ASSEMBLY THE ONE STEP DIGESTION-LIGATION PROTOCOL

TYPE IIS MEDIATED PARALLEL DNA ASSEMBLY THE ONE STEP DIGESTION-LIGATION PROTOCOL TYPE IIS MEDIATED PARALLEL DNA ASSEMBLY THE ONE STEP DIGESTION-LIGATION PROTOCOL 1. REFERENCES Patron et al (2015) Standards for Plant Synthetic Biology: A Common Syntax for Exchange of DNA Parts Patron

More information

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual Fusion Cloning technology Cold Fusion Cloning Kit Store the master mixture and positive controls at -20 C Store the competent cells at -80 C. (ver. 120909) A limited-use label license covers this product.

More information

Hetero-Stagger PCR Cloning Kit

Hetero-Stagger PCR Cloning Kit Product Name: Code No: Size: DynaExpress Hetero-Stagger PCR Cloning Kit DS150 20 reactions Kit Components: Box 1 (-20 ) phst-1 Vector, linearized Annealing Buffer Ligase Mixture phst Forward Sequence Primer

More information

Ben- Shahar Lab CRISPR/RMCE Protocol May 2015

Ben- Shahar Lab CRISPR/RMCE Protocol May 2015 Ben- Shahar Lab CRISPR/RMCE Protocol May 2015 1. Before you begin a. Useful CRISPR overview for beginners: https://www.addgene.org/crispr/guide/ b. This protocol combines techniques described in these

More information

igem2016 Microbiology BMB SDU

igem2016 Microbiology BMB SDU igem2016 Microbiology BMB SDU Project type: Plastic Project title: Additional promoter RBS biobricks Sub project: 1. K2018000 2. K2018038 & K2018039 3. K2018033, K2018034, K2018035 & K2018036 Creation

More information

Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab

Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab With the Gateway cloning system, a PCR fragment is

More information

NZYGene Synthesis kit

NZYGene Synthesis kit Kit components Component Concentration Amount NZYGene Synthesis kit Catalogue number: MB33901, 10 reactions GS DNA Polymerase 1U/ μl 30 μl Reaction Buffer for GS DNA Polymerase 10 150 μl dntp mix 2 mm

More information

Fast and efficient site-directed mutagenesis with Platinum SuperFi DNA Polymerase

Fast and efficient site-directed mutagenesis with Platinum SuperFi DNA Polymerase APPLICATION NOTE Platinum Superi Polymerase ast and efficient site-directed mutagenesis with Platinum Superi Polymerase Introduction Site-directed mutagenesis is one of the most essential techniques to

More information

THE UNIVERSITY OF NEWCASTLE- DISCIPLINE OF MEDICAL BIOCHEMISTRY. STANDARD OPERATING PROCEDURE PROCEDURE NO: GLP 084 MOD: 1st Issue Page: 1 of 11

THE UNIVERSITY OF NEWCASTLE- DISCIPLINE OF MEDICAL BIOCHEMISTRY. STANDARD OPERATING PROCEDURE PROCEDURE NO: GLP 084 MOD: 1st Issue Page: 1 of 11 Page: 1 of 11 1. Risk Assessment: This Risk Assessment is to be used as a general guide and as such, cannot accommodate all the varying factors that may be encountered when using this procedure. Therefore,

More information

BIO/CHEM 475 Molecular Biology Laboratory Spring 2007 Biol/Chem 475 Part 2 of Cloning Lab

BIO/CHEM 475 Molecular Biology Laboratory Spring 2007 Biol/Chem 475 Part 2 of Cloning Lab BIO/CHEM 475 Molecular Biology Laboratory Spring 2007 Biol/Chem 475 Part 2 of Cloning Lab Week 5 Analysis of pgem recombinant clones using PCR Clonecheck to determine size of insert; select clones for

More information

Q5 Site-Directed Mutagenesis Kit

Q5 Site-Directed Mutagenesis Kit DNA MODIFYING ENZYMES Q5 Site-Directed Mutagenesis Kit Instruction Manual NEB #E0554S 10 reactions Version 1.0 1/13 be INSPIRED drive DISCOVERY stay GENUINE This product is intended for research purposes

More information

Golden Gate TALEN assembly

Golden Gate TALEN assembly Golden Gate TALEN assembly This is an expanded and slightly modified TAL assembly protocol published in the original form in Cermak, et al., 2011 (http://dx.doi.org/10.1093/nar/gkr218) Modifications to

More information

KOD -Plus- Mutagenesis Kit

KOD -Plus- Mutagenesis Kit Instruction manual KOD -Plus- Mutagenesis Kit 0811 F0936K KOD -Plus- Mutagenesis Kit SMK-101 20 reactions Store at -20 C Contents [1] Introduction [2] Flow chart [3] Components [4] Notes [5] Protocol 1.

More information

Application of Molecular Biology tools for cloning of a foreign gene

Application of Molecular Biology tools for cloning of a foreign gene IFM/Kemi Linköpings Universitet September 2013/LGM Labmanual Project course Application of Molecular Biology tools for cloning of a foreign gene Table of contents Introduction... 3 Amplification of a gene

More information

Lentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors

Lentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors Lentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors Cat# Product Name Amount Application grna-h1-gb grna-h1-gp grna-h1-rb grna-h1-rp grna-h1-puro grna-h1-bsd grna-u6-gb

More information

Puro. Knockout Detection (KOD) Kit

Puro. Knockout Detection (KOD) Kit Puro Knockout Detection (KOD) Kit Cat. No. CC-03 18 Oct. 2016 Contents I. Kit Contents and Storage II. Product Overview III. Methods Experimental Outline Genomic DNA Preparation Obtain Hybrid DNA Digest

More information

For designing necessary primers and oligos for grna, online CRISPR designing tools can be used (e.g.

For designing necessary primers and oligos for grna, online CRISPR designing tools can be used (e.g. DESIGN OF grnas For designing necessary primers and oligos for grna, online CRISPR designing tools can be used (e.g. http://crispr.mit.edu/, https://benchling.com). Assembly of grna transcriptional cassettes

More information

5 µl 10X NEB µl ddh 2 O 5 µl StuI (10 units/µl) 2.5 µl XhoI (20 units/µl) *********************************** Incubate at 37 C overnight.

5 µl 10X NEB µl ddh 2 O 5 µl StuI (10 units/µl) 2.5 µl XhoI (20 units/µl) *********************************** Incubate at 37 C overnight. Flowchart_Cassette Mutagenesis (Steps 0. A-L) 0. Original plasmid pt7-αhl-rl3-d8 In our strategy, for double-mutant E111C-K147C, we will make first K147C by a couple of oligo-pairs shorter than 40 bp (so

More information

Targeted Gene Mutation in Rice Using a CRISPR-Cas9 System Kabin Xie 1, Bastian Minkenberg 2 and Yinong Yang 2*

Targeted Gene Mutation in Rice Using a CRISPR-Cas9 System Kabin Xie 1, Bastian Minkenberg 2 and Yinong Yang 2* Targeted Gene Mutation in Rice Using a CRISPR-Cas9 System Kabin Xie 1, Bastian Minkenberg 2 and Yinong Yang 2* 1 Department of Plant Pathology and Environmental Microbiology, Pennsylvania State University,

More information

PCR Protocol Cooke Lab July 30, 2012

PCR Protocol Cooke Lab July 30, 2012 PCR Protocol Cooke Lab July 30, 2012 Contact Adriana Arango-Velez Contents 1. Before performing the PCR 2. Recommendations for the PCR 3. Performing the PCR 4. General Thermocycler program 5. Stock solutions

More information

Protocols for cell lines using CRISPR/CAS

Protocols for cell lines using CRISPR/CAS Protocols for cell lines using CRISPR/CAS Procedure overview Map Preparation of CRISPR/CAS plasmids Expression vectors for guide RNA (U6-gRNA) and Cas9 gene (CMV-p-Cas9) are ampicillin-resist ant and stable

More information

Lab Book igem Stockholm Lysostaphin. Week 6

Lab Book igem Stockholm Lysostaphin. Week 6 Lysostaphin Week 6 Summarized below are the experiments conducted this week in chronological order. Click on the experiment name to view it. To go back to this summary, click Summary in the footer. Summary

More information

2009/7/24 10:30 There are six clones on the plate. Shake those clones in the incubator. PCR clones to test if they are correct.

2009/7/24 10:30 There are six clones on the plate. Shake those clones in the incubator. PCR clones to test if they are correct. 2009/7/23 11:30 Recycle all the inserts of SupD and terminator. 12:20 Digest high-copy bi-stable plasmids. 8μL 8μL 12:30 Start to digest. 12:40 Ligation of SupD+terminator and 1-18A (strongest promoter).

More information

Mighty TA-cloning Kit

Mighty TA-cloning Kit Cat. # 6028 For Research Use Mighty TA-cloning Kit Product Manual Table of Contents I. Introduction... 3 II. Components... 3 III. Materials Required but not Provided... 3 IV. Storage... 3 V. Vector Map...

More information

Protocols for cloning SEC-based repair templates using SapTrap assembly

Protocols for cloning SEC-based repair templates using SapTrap assembly Protocols for cloning SEC-based repair templates using SapTrap assembly Written by Dan Dickinson (ddickins@live.unc.edu) and last updated July 2016. Overview SapTrap (Schwartz and Jorgensen, 2016) is a

More information

Simple protocol for gene editing using GenCrisprTM Cas9 nuclease

Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Contents Protocol Step 1: Choose the target DNA sequence Step 2: Design sgrna Step 3: Preparation for sgrna 3.1 In vitro transcription of

More information

igem LMU- Munich Munich Cloning procedure

igem LMU- Munich Munich Cloning procedure igem LM- Munich 2014 - igem@bio.lmu.de - http://2014.igem.org/team:lm- Munich Cloning procedure Overview of a cloning procedure: 1. Digestion of a PCR product ( insert) and a vector 2. Dephosphorylation

More information

Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in. Zebrafish Embryos 1

Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in. Zebrafish Embryos 1 Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in Zebrafish Embryos 1 1. In vitro synthesis of capped Cas9 mrna The full length of humanized Cas9 cdnas with double NLS were cloned into pxt7

More information

HelixClone. PCR Cloning Kit. Simple and Fast technique for Cloning

HelixClone. PCR Cloning Kit. Simple and Fast technique for Cloning HelixClone PCR Cloning Kit Simple and Fast technique for Cloning www.nanohelix.net Contents Co ontents 1. Kit Contents 1) Product Types of PCR Cloning Kit 3 2) PCR Cloning Kit Reagents 3 3) Contents of

More information

Supplementary Information

Supplementary Information Single day construction of multi-gene circuits with 3G assembly Andrew D. Halleran 1, Anandh Swaminathan 2, and Richard M. Murray 1, 2 1. Bioengineering, California Institute of Technology, Pasadena, CA.

More information

Table of contents. I. Description II. Kit Components III. Reagents and Instruments Required IV. Storage V. Protocols...

Table of contents. I. Description II. Kit Components III. Reagents and Instruments Required IV. Storage V. Protocols... Table of contents I. Description... 2 II. Kit Components... 2 III. Reagents and Instruments Required... 2 IV. Storage... 2 V. Protocols... 3 VI-1. Procedure... 3 VI-2. Note... 4 VI. Control experiment...

More information

igem 2016 Microbiology BMB SDU

igem 2016 Microbiology BMB SDU igem 2016 Microbiology BMB SDU Project type: Bacteriocin Project title: IMPACT (Intein Mediated Purification with an Affinity Chitin-binding Tag) Sub project: Purify hybrid-bacteriocin Laterosporulin-Thuricin

More information

MacBlunt PCR Cloning Kit Manual

MacBlunt PCR Cloning Kit Manual MacBlunt PCR Cloning Kit Manual Shipping and Storage MacBlunt PCR Cloning Kits are shipped on dry ice. Each kit contains a box with cloning reagents and an attached bag with Eco-Blue Competent Cells (optional).

More information

Molecular Techniques Third-year Biology

Molecular Techniques Third-year Biology PLANNING Genetics Lab practices Molecular Techniques. Genetics Lab practices protocol. 2015-16 PCR-DIRECTED MUTAGENESIS, MOLECULAR CLONING AND RESTRICTION ANALYSIS Sessions 1 & 2 (2x3 hours): PCR-directed

More information

Creating pentr vectors by BP reaction

Creating pentr vectors by BP reaction Creating pentr vectors by BP reaction Tanya Lepikhova and Rafael Martinez 15072011 Overview: 1. Design primers to add the attb sites to gene of interest 2. Perform PCR with a high fidelity DNA polymerase

More information

California Institute of Technology. Directed evolution. Dr. F.H. Arnold s lab

California Institute of Technology. Directed evolution. Dr. F.H. Arnold s lab Directed evolution. Dr. F.H. Arnold s lab May 4, 1999 Mutagenic PCR -[Mn] The amount of Mn used in the reaction should be titrated to produce the desired mutagenic rate. Libraries that have close to 30%

More information

CLONING INVERTED REPEATS IN HIGH THROUGHPUT

CLONING INVERTED REPEATS IN HIGH THROUGHPUT CLONING INVERTED REPEATS IN HIGH THROUGHPUT This protocol is calculated for cloning one 96 well plate 1. design primers: as standard we include a EcoRI restriction site on the 5 primer and XbaI on the

More information

Recombineering Manual

Recombineering Manual Recombineering Manual Anthony Popkie The Phiel Laboratory The Research Institute at Nationwide Childrenʼs Hospital 1 BAC Transformation BACs may be transformed into either DY380, EL250 or EL350 cells.

More information

10x Hot-Taq Buffer 1 ml 1 ml x 2ea 1 ml x 10ea. dntp Mix (each 10 mm) None / 0.2 ml None / 0.4 ml None / 0.4 ml x 5ea

10x Hot-Taq Buffer 1 ml 1 ml x 2ea 1 ml x 10ea. dntp Mix (each 10 mm) None / 0.2 ml None / 0.4 ml None / 0.4 ml x 5ea HelixAmp TM Hot-Taq Polymerase (Ver. 2.0) CERTIFICATE OF ANALYSIS (1603-V01R03) Contents HelixAmp TM Hot-Taq Polymerase (Ver. 2.0) Cat. No. HT250/HT250N HT500/HT500N HT2500/HT2500N Hot-Taq (2.5 units/μl)

More information

igem 2016 Microbiology BMB SDU

igem 2016 Microbiology BMB SDU igem 2016 Microbiology BMB SDU Project type: Bacteriocin Project title: Cloning composite part into igem standard plasmid. Sub project: Insertion of k2018014 (Laterosporulin-Thuricin) into psb1c3 plasmid

More information

Systems assembly. 12 July

Systems assembly. 12 July Systems assembly 12 July ZR Miniprep Kit from all the genes o AppA o PpsR o PrrA o PrrB o PrrA Promoter o PpsR Promoter Transformation of E. coli TOP10 13 July Colony PCR o Taq Buffer o MgCl2 o dntp s

More information

Table of contents. I. Flowchart of blunt end cloning of PCR products...2. II. Description...3. III. Kit Components...3

Table of contents. I. Flowchart of blunt end cloning of PCR products...2. II. Description...3. III. Kit Components...3 Table of contents I. Flowchart of blunt end cloning of PCR products...2 II. Description...3 III. Kit Components...3 IV. Reagents and Instruments Required...3 V. Storage...3 VI. About puc118 Hinc II/BAP...4

More information

User s Guide Catalog number (8 reactions), (16 reactions), and (24 reactions)

User s Guide Catalog number (8 reactions), (16 reactions), and (24 reactions) EZ Mutation Site-Directed DNA Mutagenesis Kit For Small Plasmids User s Guide Catalog number 201304 (8 reactions), 201305 (16 reactions), and 201306 (24 reactions) For Research Use Only Not for Use in

More information

pget1.1 Vector (50 ng/μl) 23 μl pget-for Primer (10 μm) 100 μl pget-rev Primer (10 μm) 100 μl

pget1.1 Vector (50 ng/μl) 23 μl pget-for Primer (10 μm) 100 μl pget-rev Primer (10 μm) 100 μl www.smobio.com Product Information GetClone PCR Cloning Vector CV1000 20 RXN pget1.1 Vector (50 ng/μl) 23 μl pget-for Primer (10 μm) 100 μl pget-rev Primer (10 μm) 100 μl Storage -20 C for 24 months Features

More information

Lab Book igem Stockholm Lysostaphin. Week 8

Lab Book igem Stockholm Lysostaphin. Week 8 Lysostaphin Week 8 Summarized below are the experiments conducted this week in chronological order. Click on the experiment name to view it. To go back to this summary, click Summary in the footer. Summary

More information

E. 1 Isolation of smmo genes form M. capsulatus

E. 1 Isolation of smmo genes form M. capsulatus E. 1 Isolation of smmo genes form M. capsulatus Standard Protocols: QuikChange II Site-Directed Mutagenesis Kit In order to isolate all subunit encoding genes of the smmo from M. capsulatus colony PCR

More information

The RNAi Core Version 3 (10/07/09)

The RNAi Core Version 3 (10/07/09) Protocol for shrna construction I: PCR method Preparation of cloning vector: 1. Incubate 3 μg of shrna cloning vector with 5 units (NEB) of EcoRI and 10 units of AgeI, (double digestion) in a reaction

More information

Product Information GetClone PCR Cloning Vector II. Storage -20 C for 24 months

Product Information GetClone PCR Cloning Vector II. Storage -20 C for 24 months www.smobio.com Product Information GetClone PCR Cloning Vector II CV1100 20 RXN pget II Vector (25 ng/μl) pget-for Primer (10 μm) pget-rev Primer (10 μm) Storage -20 C for 24 months 23 μl 100 μl 100 μl

More information

Cloning a Fluorescent Gene

Cloning a Fluorescent Gene Cloning a Fluorescent Gene Laboratory Protocols Handout v1.10 Table of Contents Lab 1: Pipettes and Pipetting... 2 Lab 2: Polymerase Chain Reaction... 5 Lab 3: Ligation... 7 Lab 4: Transformation... 9

More information

SpeedSTAR HS DNA Polymerase

SpeedSTAR HS DNA Polymerase Cat. # RR070A For Research Use SpeedSTAR HS DNA Polymerase Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Supplied buffers... 3 V. General reaction mixture...

More information

SuperiorScript III cdna Synthesis Kit Instruction Manual

SuperiorScript III cdna Synthesis Kit Instruction Manual SuperiorScript III cdna Synthesis Kit Instruction Manual Cat.# EZ405S, EZ405M SuperiorScript III cdna Synthesis Kit Table of Contents I. Description... 3 II. Kit... 4 III. Procedure... 5 IV. Control Experiment

More information

igem2013 Microbiology BMB SDU

igem2013 Microbiology BMB SDU igem2013 Microbiology BMB SDU Project type: BioBrick Project title: DXS biobrick from B. subtilis#168 Sub project: Creation date: 12.07.13 Written by: Hwj Performed by: Hwj, MH, AK, PRA, SIS 1. SOPs in

More information

Petra, Tamannae. Made new 1:10 dilutions of P001 and P ul primer to 18 ul water

Petra, Tamannae. Made new 1:10 dilutions of P001 and P ul primer to 18 ul water 20.7.2015 MONDAY, 7/20 Petra, Tamannae Made new 1:10 dilutions of P001 and P015. 2 ul primer to 18 ul water Made new 1 ng/µl template dilution of CAR part 1. 2 µl DNA stock and 18 µl H2O Gradient PCR for

More information

Vector Linearization. igem TU/e 2016 Biomedical Engineering

Vector Linearization. igem TU/e 2016 Biomedical Engineering igem TU/e 2016 Biomedical Engineering Eindhoven University of Technology Room: Ceres 0.04 Den Dolech 2, 5612 AZ Eindhoven The Netherlands Tel. no. +31 50 247 55 59 2016.igem.org/Team:TU_Eindhoven Vector

More information

Version(1(*(July(14 th,(2014(

Version(1(*(July(14 th,(2014( Morrisey(Lab(Protocol:(( Generating(Large((>1kb)(Genomic(Deletions(Using(CRISPRs( bydanswarr&davefrank GeneralComments ThisprotocolisintendedtousetheCRISPR@Cas9systemforgenerationoflarge genomicdeletions(>1kb),inordertoremoveorinactivateagenomicelementof

More information

Ligation high Ver.2. (Code No. LGK-201) Instruction Manual. TOYOBO CO., LTD. Life Science Department OSAKA JAPAN. High-Efficient Ligation Reagent

Ligation high Ver.2. (Code No. LGK-201) Instruction Manual. TOYOBO CO., LTD. Life Science Department OSAKA JAPAN. High-Efficient Ligation Reagent 7-1 High-Efficient Ligation Reagent Ligation high Ver.2 (Code No. LGK-21) Instruction Manual TOYOBO CO., LTD. Life Science Department OSAKA JAPAN A376K INDEX [1] Introduction... 1 [2] Contents... 2 [3]

More information

Classic cloning with pask-iba and pexpr-iba vectors

Classic cloning with pask-iba and pexpr-iba vectors Classic cloning with pask-iba and pexpr-iba vectors General protocol Last date of revision March 2017 Version PR08-0008 For research use only Important licensing information Products featuring CMV promoter,

More information

Molecular cloning: 6 RBS+ arac/ laci

Molecular cloning: 6 RBS+ arac/ laci Molecular cloning: 6 RBS+ arac/ laci Resource: 6 RBS: from the parts: B0030, B0032, B0034, J61100, J61107, J61127; renamed as RBS1 RBS2 RBS6; arac: C0080 laci: C0012 July 6 th Plasmid mini prep: 6 RBS;

More information

The RNAi Core Version 2 (12/04/08)

The RNAi Core Version 2 (12/04/08) Protocol for shrna construction-i: PCR method Preparation of cloning vector: 1. Incubate 3 μg of shrna cloning vector with 10 units restriction enzymes (RE; NEB) of EcoRI and AgeI, (double digestion),

More information

Subcloning 1. Overview 2. Method

Subcloning 1. Overview 2. Method Subcloning 1. Overview: 1.1. Digest plasmids for vector + insert 1.2. CIP treat vector 1.3. Gel purify vector + insert 1.4. Ligate 1.5. Transform bacteria with ligation reactions 1.6. Qiagen or Eppendorf

More information

igem 2016 Microbiology BMB SDU

igem 2016 Microbiology BMB SDU igem 2016 Microbiology BMB SDU Project type: Silk MaSp1 CA Project title: Cloning composite part into igem standard plasmid psb1c3. Sub project: Insertion of K-1763012 (MaSp1 CA) into psb1c3 plasmid Creation

More information

PCR Cloning Protocol

PCR Cloning Protocol Modifications to EXPERIMENTS 21 and 24: PCR and Molecular Cloning This experiment was designed by Dylan Dodd, based on research completed in Dr. Isaac Cann s lab*, with modifications and editing of content

More information

Mighty Cloning Reagent Set (Blunt End)

Mighty Cloning Reagent Set (Blunt End) Cat. # 6027 For Research Use Mighty Cloning Reagent Set (Blunt End) Product Manual Table of Contents I. Flowchart of blunt end cloning of PCR products...3 II. Description...4 III. Components...4 IV. Materials

More information

Basic Protocol (v. 2.0, May, 2003)

Basic Protocol (v. 2.0, May, 2003) Basic Protocol (v. 2.0, May, 2003) Preparation of RNA:DNA Handles For the two handles (called A and B), you will need the following oligos: Product 1 : Name=B_reverse : Synthesis=1 umole : Purification=HPLC

More information

Amplified restriction fragments for genomic enrichment. 1 Reagents and Equipment. Tom Parchman Zach Gompert

Amplified restriction fragments for genomic enrichment. 1 Reagents and Equipment. Tom Parchman Zach Gompert 1 Amplified restriction fragments for genomic enrichment (version 2.3 August 2011) Tom Parchman (tparchma@uwyo.edu) Zach Gompert (zgompert@uwyo.edu) Alex Buerkle (buerkle@uwyo.edu) University of Wyoming

More information

Ran 2 most promising samples: 3 and 5 using all materials and equipment from Isaacs lab, but still not successfully:

Ran 2 most promising samples: 3 and 5 using all materials and equipment from Isaacs lab, but still not successfully: Thursday, 7/5 Redid colony PCR, and imaged the resulting gel with no apparent success: Protocol/guidelines for Taq DNA polymerase used: http://www.neb.com/nebecomm/products/protocol567.asp Carried out

More information

Product Analysis Certificate

Product Analysis Certificate Product: Catalog #: CRISPR (Linearized) SVCRU6H16-L Lot #: 17062801 Description: The Linearized sgrna Cloning and Expression Vector is a human immunodeficiency virus (HIV) lentiviral vector with a constitutive

More information

Mighty Cloning Reagent Set (Blunt End)

Mighty Cloning Reagent Set (Blunt End) Cat. # 6027 For Research Use Mighty Cloning Reagent Set (Blunt End) Product Manual Table of Contents I. Flowchart of blunt end cloning of PCR products...3 II. Description...4 III. Components...4 IV. Materials

More information

Lab Book igem Stockholm Nuclease. Week 8

Lab Book igem Stockholm Nuclease. Week 8 Nuclease Week 8 Summarized below are the experiments conducted this week in chronological order. Click on the experiment name to view it. To go back to this summary, click Summary in the footer. Summary

More information

Targeted Protein Degradation

Targeted Protein Degradation The PITCh dtag vectors for rapid protein degradation of endogenous targets The dissection of complex biological systems requires target-specific control of protein function or abundance. Genetic perturbations

More information

Cloning,! 免付費客服專線 TEL (02) TEL (05) TEL (03) TEL (06) TEL (04) TEL (07) U040114

Cloning,! 免付費客服專線 TEL (02) TEL (05) TEL (03) TEL (06) TEL (04) TEL (07) U040114 2015 Cloning, Cloning,! U040114 TEL (02)2720-2215 TEL (05)2844-162 TEL (03)6684-5 8 6 TEL (06)2890-665 TEL (04)2463-3591 TEL (07)3470-143 免付費客服專線 (Genetic Cloning) Cloning, (Molecular Cloning), (Restriction

More information

Supplementary Figure 1. Diagram for CATCHA construct. Nature Biotechnology doi: /nbt.3444

Supplementary Figure 1. Diagram for CATCHA construct. Nature Biotechnology doi: /nbt.3444 Supplementary Figure 1 Diagram for CATCHA construct. Supplementary Figure 2 Representative view of ebony (left) and non-ebony (right) F2 flies from experiments described in Fig. 1c. F0 #1 F0 #2 F0 #3 F0

More information

Protocols. We used a buffer mix with polymerase (either Mango Mix (forhandler) or 2x High Fidelity) and the appropriate primers and template DNA.

Protocols. We used a buffer mix with polymerase (either Mango Mix (forhandler) or 2x High Fidelity) and the appropriate primers and template DNA. Protocols PCRs Colony PCRs We used a buffer mix with polymerase (either Mango Mix (forhandler) or 2x High Fidelity) and the appropriate primers and template DNA. For a 10 µl reaction 2x Mango Mix/2x High

More information