Ioannis Economidis /Christina Naneva (European Commission) Sohi Rastegar (National Science Foundation)

Size: px
Start display at page:

Download "Ioannis Economidis /Christina Naneva (European Commission) Sohi Rastegar (National Science Foundation)"

Transcription

1 Ioannis Economidis /Christina Naneva (European Commission) Sohi Rastegar (National Science Foundation)

2 Report 1. What is Synthetic Biology v 2. Towards standards in Synthetic Biology.. A Task Force Workshop, Segovia, ES (June 2010) 3. What is a Task Force Working Group on Synthetic Biology (Terms of reference/strategy plan) 4. Future activities 5. Actions in the granting systems taking into account the existence of the WG on Synthetic Biology

3

4 Synthetic Biology the design and fabrication of biological components and systems that do not already exist in the natural world and/or the re-design and refactoring of existing biological systems.

5 The basic notion behind SB Any biological system can be considered as a complex combination of functional, stand-alone elements (not unlike those found in man-made devices) It can be-deconstructed in a limited number of components and reconstructed in an entirely different configuration for the sake of modifying existing properties or creating altogether new ones. SB has an aspect of developing general-use technological and conceptual tools (biological parts, minimal genomes, artificial cells, DNA synthesis),

6

7 Addressing hitherto intractable problems Biosynthesis of complex molecules, breakdown or recycling of toxic chemicals, biological detection of explosives, biological production of H2 and other fuels raising utterly novel challenges DNA computing, design of biological pattern development targeting bacteria to tumor cells expanding the genetic code to non-natural amino acids

8 The central aspect of synthetic biology, is bound to have an immense impact in Biotechnology, The possibility of re-programming or creating new live organisms through the logical combination of standardized biological components that are otherwise decoupled from their natural context. Challenges: the reliable formatting of biological functionalities and the detailed description of the most basic biological constituents and their interfaces, similar to modern electronic circuits.

9 Facing the challenges The use of Systems Biology to understand the design and operation rules. The exploitation of such rules for re-engineer biological systems á la carte. The challenge is thus to set reliable Standard Operating Procedures, principles and actual units of measurement that are useful for biological engineering, even if we may still miss some fundamental facts.

10 Five hard truths for Synthetic biology Many of the parts are undefined The circuitry is unpredictable The complexity is unwieldy Many parts are incompatible Variability crashes the system Nature 463, (2010)

11 Report 1. What is Synthetic Biology v 2. Towards standards in Synthetic Biology.. A Task Force Workshop, Segovia, ES (June 2010) v 3. What is a Task Force Working Group on Synthetic Biology (Terms of reference/strategy plan) 4. Future activities 5. Actions in the granting systems taking into account the existence of the WG on Synthetic Biology

12 Towards Standards in Synthetic Biology An Exploratory Workshop of the US-EC Task Force in Biotechnology Parador de Segovia (Segovia, Spain). June 4-6, 2010

13 Standards and Standardisation [a] the adoption of specific geometric shapes and size formats for the physical assembly of the components of a man-made system (e.g. the sizes and shapes of screw turns), [b] the definition of units of measurement of relevant properties and parameters as well as conditions and procedures to calculate them (e.g. Amperes for current, Ohms for resistance, etc), [c] implementation of unambiguous protocols for the manufacture of the engineered objects.

14 Standards and Standardisation in SB the establishment of rules for the physical composition of biologial (expression) devices. the adoption of RNA polymerase per second (PoPs) units as a universal reference to express promoter strength The calculation of a translation efficacy index deduced from measuring the input/output function of the devices under the various growth and metabolic conditions.

15 The specific goals of the Workshop Review and discuss the latest technical standards having to do with vector architecture and physical assembly of genetic material, in vivo measures of biological functions and parametrization methods/algorithms, descriptive languages, graphical representations and formalisms for modelling genetic elements, and data exchange supporting registries of standard biological parts. Present and discuss the emerging standardisation requirements needed to develop one or more cellular operating systems supporting genome-scale engineering. Identify and prioritise scientific research areas that would critically accelerate standards-driven biological engineering at the genome scale. Identify new research programs or resources needed to support the preceeding goals

16 Deliverables - Platforms a list of top standardisation needs not met or realised yet via current practice; a set of fresh scientific research areas that might be strategically coupled to support current engineering goals in Synthetic Biology; a working list of now unmet programmatic or facility needs necessary to see such work carried out in a timely fashion. an US-EU Group on Biological Standards which will act as both as an observatory of bottom-up initiatives and as a think tank on research topics with a prenormative value.

17 Report 1. What is Synthetic Biology 2. Towards standards in Synthetic Biology.. A Task Force Workshop, Segovia, ES (June 2010) 3. What is a Task Force Working Group on Synthetic Biology (Terms of reference/strategy plan) v 4. Future activities 5. Actions in the granting systems taking into account the existence of the WG on Synthetic Biology

18

19 WORKING GROUPS & ACTIVITIES ENVIRONMENTAL BIOTECHNOLOGY PLANT BIOLOGY BIO-BASED PRODUCTS AND BIO-BASED ENERGY BIO- INFORMATICS ETHICS SOCIETAL NANO- BIOTECHNOLOG Y ANIMAL BIOTECHNOLOGY MARINE GENOMICS SYNTHETIC BIOLOGY

20 Mission The exchange of views and collaboration across the Atlantic on Synthetic Biology.

21 Focus on Scientific and Technical progress in implementing Synthetic Biology principles (standards, orthogonality, minimal genomes, etc.) Outstanding issues of Ethics, Biosafety (including environmental safety) and Biosecurity. Educational approaches.

22 Structure Secretarial EU/EC: Christina Naneva; Ioannis Economidis US/NSF: Sohi Rastegar Members EU US V. De Lorenzo (ES) Drew Endy X X Y Y Z Z

23 Report 1. What is Synthetic Biology 2. Towards standards in Synthetic Biology.. A Task Force Workshop, Segovia, ES (June 2010) 3. What is a Task Force Working Group on Synthetic Biology (Terms of reference/strategy plan) 4. Future activities v 5. Actions in the granting systems taking into account the existence of the WG on Synthetic Biology

24 Planned activities All five years Telephone/video conferences/webinars Meetings in conjunction to international relevant scientific event. Workshops (Possible ideas) - "Orthogonality and orthogonal systems in Biology", Cell operative systems and Deep metabolic engineering Workshop on Ethical, Legal, and Social issues in relationship (or in juxtaposition) to the scientific and technical progress of Synthetic Biology. Workshop on relevant contribution of Synthetic Biology to different domains of Biotechnology

25 Questions to be answered by these workshops and follow up discussions Define accurately the nature and boundaries of biological functions Formalization and nonambiguous representation of biological information is a major bottleneck for the development of SB Development of consensus criteria for Biological Standards What is a biological part? Its it possible to convert a natural, context-dependent module into an autonomous component?

26 Planned activities Training Activities Short term courses with theoretical and practical (laboratory) sessions focused on basic techniques and principles of synthetic biology. Exploration of funding possibilities for short term exchanges of US young scholars to EU research institutions with reciprocity of short term exchanges of EU young scholars to US research establishments.

27 Ethics and beyond Safety Biosecurity, prevention of bioterrorism and dual use Governance Patenting and common heritage Trade and global justice Science and society dialogue Research

28 Public beneficence Public Funding Review and Disclosure Support for Promising Research Innovation Through Sharing Responsible stewardship Coordinated Approach to Synthetic Biology Risk Assessment Review and Field Release Gap Analysis Monitoring, Containment, and Control Risk Assessment Prior to Field Release International Coordination and Dialogue Ethics Education Ongoing Evaluation of Objections Intellectual freedom and responsibility Fostering Responsibility and Accountability Periodic Assessment of Security and Safety Risks Oversight Controls Democratic deliberation Scientific, Religious, and Civic Engagement Information Accuracy Public Education Justice and fairness. Risks in Research Risks and Benefits in Commercial Production and Distribution

29 Report 1. What is Synthetic Biology 2. Towards standards in Synthetic Biology.. A Task Force Workshop, Segovia, ES (June 2010) 3. What is a Task Force Working Group on Synthetic Biology (Terms of reference/strategy plan) 4. Future activities 5. Actions in the granting systems taking into account the existence of the WG on Synthetic Biology v

30 Synthetic Biology in KBBE 2011 Towards standardisation in Synthetic Biology Applying Synthetic Biology principles towards the cell factory notion in biotechnology Ensuring the safety of Synthetic Biology applications Synthetic Biology ERA-NET

31 Towards standardisation in Synthetic Biology Standardization and orthogonalization of the gene expression flow for robust engineering of NTN (new-tonature) biological properties (ST-FLOW) The ST-FLOW Project merges the efforts of 15 leading European and US research groups for developing material and computational standards that enable the forward-design of prokaryotic systems with a degree of robustness and predictability that is not possible with customary Genetic Engineering.

EC-US Task Force Activities on Synthetic Biology. Ioannis Economidis, EC DG Research Sohi Rastegar, NSF June 2010

EC-US Task Force Activities on Synthetic Biology. Ioannis Economidis, EC DG Research Sohi Rastegar, NSF June 2010 EC-US Task Force Activities on Synthetic Biology Ioannis Economidis, EC DG Research Sohi Rastegar, NSF June 2010 Questions Greatest challenges in Synbio Opportunities for collaboration between EU and US

More information

EC-US Working Group on Environmental Biotechnology. Ioannis Economidis, EC DG Research Anna Palmisano and Pete Burfening, USDA/CSREES July 20, 2006

EC-US Working Group on Environmental Biotechnology. Ioannis Economidis, EC DG Research Anna Palmisano and Pete Burfening, USDA/CSREES July 20, 2006 EC-US Working Group on Environmental Biotechnology Ioannis Economidis, EC DG Research Anna Palmisano and Pete Burfening, USDA/CSREES July 20, 2006 Working Group Mission To foster the collaboration of researchers

More information

US-EU Task Force on Biotechnology Research Five-Year Strategic Plan

US-EU Task Force on Biotechnology Research Five-Year Strategic Plan US-EU Task Force on Biotechnology Research Five-Year Strategic Plan 2011-2015 June 23. 2011 1 2 TABLE OF CONTENTS CO-CHAIRS' FORWARD 5 SUMMARY 6 ANIMAL BIOTECHNOLOGY WORKING GROUP 9 Membership 10 Programming

More information

Design Principles in Synthetic Biology

Design Principles in Synthetic Biology Design Principles in Synthetic Biology Chris Myers 1, Nathan Barker 2, Hiroyuki Kuwahara 3, Curtis Madsen 1, Nam Nguyen 1, Michael Samoilov 4, and Adam Arkin 4 1 University of Utah 2 Southern Utah University

More information

Synthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design.

Synthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design. Synthetic Biology Accelerating Discoveries, Expanding Possibilities Sustainable Energy Therapeutics Industrial Enzymes Agriculture Design Build Generate Solutions to Advance Synthetic Biology Research

More information

From the Quest for Fire to GATTACA: Systems and Synthetic Biology as the Next Wave of Technology Disruption in the Anthropocene

From the Quest for Fire to GATTACA: Systems and Synthetic Biology as the Next Wave of Technology Disruption in the Anthropocene From the Quest for Fire to GATTACA: Systems and Synthetic Biology as the Next Wave of Technology Disruption in the Anthropocene Dr. George Poste Chief Scientist, Complex Adaptive Systems Initiative and

More information

Updates to the NIH Guidelines for Research Involving Recombinant DNA Molecules (NIH Guidelines)

Updates to the NIH Guidelines for Research Involving Recombinant DNA Molecules (NIH Guidelines) Updates to the NIH Guidelines for Research Involving Recombinant DNA Molecules (NIH Guidelines) Jacqueline Corrigan-Curay, J.D. M.D. Acting Director Office of Biotechnology Activities National Institute

More information

Synthetic Biology: A New Application Area for Design Automation Research

Synthetic Biology: A New Application Area for Design Automation Research Synthetic Biology: A New Application Area for Design Automation Research Chris Myers 1, Nathan Barker 2, Hiroyuki Kuwahara 3, Curtis Madsen 1, Nam Nguyen 4, Chris Winstead 5 1 University of Utah 2 Southern

More information

Trend analysis Biotechnology 2016

Trend analysis Biotechnology 2016 Trend analysis Biotechnology 2016 Summary april 2016 1 Trendanalyse Biotechnologie 2016 - Regelgeving ontregeld Scientific advances in biotechnology have taken off in recent years. New techniques and applications

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

The Integrated Biomedical Sciences Graduate Program

The Integrated Biomedical Sciences Graduate Program The Integrated Biomedical Sciences Graduate Program at the university of notre dame Cutting-edge biomedical research and training that transcends traditional departmental and disciplinary boundaries to

More information

Rules and Regulations on GMO-derived food products in the European Union Lynn Insall UK Food and Drink Federation

Rules and Regulations on GMO-derived food products in the European Union Lynn Insall UK Food and Drink Federation Rules and Regulations on GMO-derived food products in the European Union Lynn Insall UK Food and Drink Federation Food Safety Workshop, Cairo, 17 April 2005 About the UK Food and Drink Manufacturing Industry

More information

Genetic Engineering for Biofuels Production

Genetic Engineering for Biofuels Production Genetic Engineering for Biofuels Production WSE 573 Spring 2013 Greeley Beck INTRODUCTION Alternative transportation fuels are needed in the United States because of oil supply insecurity, oil price increases,

More information

Challenges for biosafety in the rapid changing field of biotechnology

Challenges for biosafety in the rapid changing field of biotechnology Challenges for biosafety in the rapid changing field of biotechnology Gijsbert van Willigen, PhD Coordinator CBRN Safety & Security LEIDEN UNIVERSITY MEDICAL HOSPITAL 1Insert > Header & footer 14-Apr-17

More information

The 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential

The 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential The 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential Applications Richard Finkers Researcher Plant Breeding, Wageningen UR Plant Breeding, P.O. Box 16, 6700 AA, Wageningen, The Netherlands,

More information

Principles for the Oversight of Synthetic Biology- Precautionary Principle

Principles for the Oversight of Synthetic Biology- Precautionary Principle 1 Principles for the Oversight of Synthetic Biology- Precautionary Principle When an activity raises threats of harm to human health or the environment, precautionary measures should be taken even if some

More information

Synthetic Biology and Patents

Synthetic Biology and Patents Synthetic Biology and Patents Dr. Berthold Rutz, Directorate 2.4.01 Biotechnology European Patent Office Munich "Patenting Synthetic Biology? A Transatlantic Perspective" WWICS, Washington D.C. 30.11.2009

More information

Biotechnology, Synthetic Biology, and Genetic Circuit Design Module Lesson Plan. 1 day. 1 P age

Biotechnology, Synthetic Biology, and Genetic Circuit Design Module Lesson Plan. 1 day. 1 P age 1 P age Biotechnology, Synthetic Biology, and Genetic Circuit Design Module Lesson Plan 1 day 2 P age Introduction In this single module students will build upon their previous knowledge of basic molecular

More information

A. What can we infer about the design of a genome by considering the physical problems that a biological systems solves?

A. What can we infer about the design of a genome by considering the physical problems that a biological systems solves? Genome Engineering Drew Endy (http://mit.edu/endy/) Questions Introduced Last Time A. What can we infer about the design of a genome by considering the physical problems that a biological systems solves?

More information

Digitally Programmed Cells

Digitally Programmed Cells Digitally Programmed Cells Ron Weiss PI: Tom Knight MIT Artificial Intelligence Laboratory Goal Process-Control Cellular Computers -- Microbial Robotics Unique features: small, self-replicating, energy-efficient

More information

Total Test Questions: 66 Levels: Grades Units of Credit: 1.0 STANDARD 2. Demonstrate appropriate use of personal protective devices.

Total Test Questions: 66 Levels: Grades Units of Credit: 1.0 STANDARD 2. Demonstrate appropriate use of personal protective devices. DESCRIPTION Biotechnology is designed to create an awareness of career possibilities in the field of biotechnology. Students are introduced to diagnostic and therapeutic laboratory procedures that support

More information

Tools and Opportunities to Enhance Risk Analysis. Nathan J. Hillson

Tools and Opportunities to Enhance Risk Analysis. Nathan J. Hillson Tools and Opportunities to Enhance Risk Analysis Nathan J. Hillson njhillson@lbl.gov Future Biotechnology Products and Opportunities to Enhance the Capabilities of the Biotechnology Regulatory System National

More information

CHAPTERS , 17: Eukaryotic Genetics

CHAPTERS , 17: Eukaryotic Genetics CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions

More information

AP Biology Gene Expression/Biotechnology REVIEW

AP Biology Gene Expression/Biotechnology REVIEW AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.

More information

Bioinformatics. Lecturer: Antinisca Di Marco Tutor: Francesco Gallo

Bioinformatics. Lecturer: Antinisca Di Marco Tutor: Francesco Gallo Bioinformatics Lecturer: Antinisca Di Marco Tutor: Francesco Gallo E mails: nome.cognome@univaq.it For appointment Di Marco: Tuersday 3.30 4:30 p.m. Friday 10:00-11:00 a.m. please ask appointment via email

More information

Algorithms in Bioinformatics

Algorithms in Bioinformatics Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline Central Dogma of Molecular

More information

Controlling DNA. Ethical guidelines for the use of DNA technology. Module Type: Discussion, literature review, and debate

Controlling DNA. Ethical guidelines for the use of DNA technology. Module Type: Discussion, literature review, and debate Ethical guidelines for the use of DNA technology Author: Tara Cornelisse, Ph.D. Candidate, Environmental Studies, University of California Santa Cruz. Field-tested with: 11 th -12 th grade students in

More information

CITI Certificates

CITI Certificates CITI Certificates 2017-2018 Adu.Research.Office@adu.edu Room CC340 Table of Contents Human Subjects Research... 1 Biomedical Research - Basic/Refresher - Basic Course:... 1 Required Courses:... 1 Human

More information

Biosafety and the NIH Guidelines

Biosafety and the NIH Guidelines Biosafety and the NIH Guidelines This section will explore: Why the NIH Guidelines are important The definition of recombinant or synthetic nucleic acid research Content of the NIH Guidelines Section III

More information

GMO Technology Conference

GMO Technology Conference GMO Technology Conference The regulation of Clinical Trials on humans involving therapies containing or consisting of genetically modified organisms The Printworks, Dublin Castle 10 th & 11 th October

More information

NIH Guidelines for rdna Research: Tutorial for Completing Penn s rdna Registration Document

NIH Guidelines for rdna Research: Tutorial for Completing Penn s rdna Registration Document NIH Guidelines for rdna Research: Tutorial for Completing Penn s rdna Registration Document Revision March 3, 2011 Penn s rdna Registration Document Dual Use Research Definition: Research that yields information

More information

RNA-Seq with the Tuxedo Suite

RNA-Seq with the Tuxedo Suite RNA-Seq with the Tuxedo Suite Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 2015 Workshop The Basic Tuxedo Suite References Trapnell C, et al. 2009 TopHat: discovering splice junctions with

More information

The European Research Council. CRISPR-Cas9 research in ERCEA Ethics Process. Filipa Ferraz de Oliveira ERCEA Scientific Officer

The European Research Council. CRISPR-Cas9 research in ERCEA Ethics Process. Filipa Ferraz de Oliveira ERCEA Scientific Officer The European Research Council CRISPR-Cas9 research in ERCEA Ethics Process Filipa Ferraz de Oliveira ERCEA Scientific Officer Fostering Responsible Research With CRISPR-Cas9, Paris, March 2016 1 CRISPR-Cas9

More information

Analytics of Biomedical Data INFO B585

Analytics of Biomedical Data INFO B585 Analytics of Biomedical Data INFO B585 Course Info Location Prerequisites: 3 Credit hours Online None COURSE DESCRIPTION This introductory course teaches students how to apply biomedical analytics methods

More information

DNA Logic Gates to Design a 4*4 bit Carry Select Adder Circuit

DNA Logic Gates to Design a 4*4 bit Carry Select Adder Circuit DNA Logic Gates to Design a 4*4 bit Carry Select Adder Circuit Seeja V M Bannari Amman Institute of Technology Sathyamangalam, Erode seejavm@gmail.com Daniel Raj A Bannari Amman Institute of Technology

More information

Soil bacteria to produce new antibiotics

Soil bacteria to produce new antibiotics Powered by Website address: https://www.gesundheitsindustriebw.de/en/article/news/soil-bacteria-to-produce-newantibiotics/ Soil bacteria to produce new antibiotics An ever-growing number of genomes of

More information

Annex IV: Competency Framework

Annex IV: Competency Framework Making the railway system work better for society. NSA Monitoring 120 Rue Marc Lefrancq BP 20392 FR-59307 Valenciennes Cedex 1 / 11 Contents 1. Introduction... 3 2. Roles and responsibilities... 3 2.1.

More information

Genome Editing Technology - Principle -

Genome Editing Technology - Principle - Effective Date: 31.10.2017 Doc ID: 20290213 Version: 1.0 Status: Approved Planned Effective Date: 31-Oct-2017 00:00 CET (Server Date) Genome Editing Technology - Principle - Rationale Genome editing is

More information

Molecular Genetics Student Objectives

Molecular Genetics Student Objectives Molecular Genetics Student Objectives Exam 1: Enduring understanding 3.A: Heritable information provides for continuity of life. Essential knowledge 3.A.1: DNA, and in some cases RNA, is the primary source

More information

In order to achieve major productivity and cost-efficient breakthroughs, a solution is

In order to achieve major productivity and cost-efficient breakthroughs, a solution is Igor Juricic, Intergraph, Italy, examines the advances made in vessel design software. In order to achieve major productivity and cost-efficient breakthroughs, a solution is required that can manage today

More information

European Technology Platform for Global Animal Health. Action Plan

European Technology Platform for Global Animal Health. Action Plan European Technology Platform for Global Animal Health Action Plan European Technology T Platform for Global Animal Health Action Plan 2 Table of contents Executive Summary 7 Chapter 1: The Action Plan

More information

e-sens white paper D3.4 Preliminary Proposal for a governance body Instruments Deliverable 3.4, version 3

e-sens white paper D3.4 Preliminary Proposal for a governance body Instruments Deliverable 3.4, version 3 e-sens white paper D3.4 Preliminary Proposal for a governance body Instruments Deliverable 3.4, version 3 Abstract of the Deliverable 3.4, version 3: The deliverable D3.4v3 presents a concrete proposal

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

Testing of Web Services A Systematic Mapping

Testing of Web Services A Systematic Mapping Testing of Web Services A Systematic Mapping Abhishek Sharma, Theodore D. Hellmann, Frank Maurer Department of Computer Science University of Calgary Calgary, Canada {absharma, tdhellma, frank.maurer}@ucalgary.ca

More information

Tutorial for Completing Penn s r s DNA Registration Document

Tutorial for Completing Penn s r s DNA Registration Document NIH GUIDELINES FOR RESEARCH INVOLVING RECOMBINANT OR SYNTHETIC NUCLEIC ACID MOLECULES NIH GUIDELINES Tutorial for Completing Penn s r s DNA Registration Document Revision March 7, 2013 Penn s r s DNA Registration

More information

IBC protocol Risk Assessment and Determination of NIH Guidelines

IBC protocol Risk Assessment and Determination of NIH Guidelines IBC protocol Risk Assessment and Determination of NIH Guidelines The following are points to consider when reviewing all protocols for risk, recommended containment conditions, and determine applicable

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

1. Page 90: Cellular Metabolism Explain what the everyday use of the word metabolism means to you.

1. Page 90: Cellular Metabolism Explain what the everyday use of the word metabolism means to you. Biology 100 Winter 2013 North Seattle Community College Reading Guide 10 Metabolism, Enzymes, and Building a Protein Reading: 1) Chapter 5 (various pages) in Microbiology Demystified 2) Chapter 7 (various

More information

D.B.E. Digital Business Ecosystem. WP33: Dissemination and Community Building. D33.1: DBE Brand Identity Definition.

D.B.E. Digital Business Ecosystem. WP33: Dissemination and Community Building. D33.1: DBE Brand Identity Definition. D.B.E. Digital Business Ecosystem Contract n 507953 WP33: Dissemination and Community Building D33.1: DBE Brand Identity Definition Project funded by the European Community under the Information Society

More information

The European partnership for alternative approaches to animal testing

The European partnership for alternative approaches to animal testing AATEX 14, Special Issue, 769-773 Proc. 6th World Congress on Alternatives & Animal Use in the Life Sciences August 21-25, 2007, Tokyo, Japan The European partnership for alternative approaches to animal

More information

Genetics Lecture 21 Recombinant DNA

Genetics Lecture 21 Recombinant DNA Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of

More information

Biomedical Research on Human Participants

Biomedical Research on Human Participants Ethical Guidelines for Biomedical Research on Human Participants Dr P Paul Kumaran MBBS, BA (Psychology), MPH Scientist E [Deputy Director Medical] National Institute for Research in Tuberculosis (ICMR)

More information

Call Title: KBBE 2009: general call for proposals

Call Title: KBBE 2009: general call for proposals Call Title: KBBE 2009: general call for proposals Call identifier: FP7-KBBE-2009-3 Date of publication: 3 September 2008 Deadline: 15 January 2009 at 17.00.00 (Brussels local time) Indicative budget: EUR

More information

26 STNews October 2008

26 STNews October 2008 26 STNews October 2008 Knowing whether to use U or T when searching RNA sequences on STN Introduction When you are designing a search query for sequence information on STN, it is important to consider

More information

Setting the scene - recent development and future challanges

Setting the scene - recent development and future challanges Mitglied der Helmholtz-Gemeinschaft Setting the scene - recent development and future challanges Ulrich Schurr, Forschungszentrum Jülich, IBG-2: Plant Sciences Major societal challenges: plants are key

More information

Victoria Grygoryevna Tretiakova

Victoria Grygoryevna Tretiakova ISSN 1392 1274. TEISĖ 2013 87 The international community must take care of bioethical protection of every person to form unified system of international and national bioethical courts Victoria Grygoryevna

More information

Total Test Questions: 71 Levels: Grades Units of Credit: 1.0 STANDARD 1 STUDENTS WILL INVESTIGATE THE PAST, PRESENT, AND FUTURE APPLICATIONS OF

Total Test Questions: 71 Levels: Grades Units of Credit: 1.0 STANDARD 1 STUDENTS WILL INVESTIGATE THE PAST, PRESENT, AND FUTURE APPLICATIONS OF DESCRIPTION Biotechnology is designed to create an awareness of career possibilities in the field of biotechnology. Students are introduced to diagnostic and therapeutic laboratory procedures that support

More information

Network System Inference

Network System Inference Network System Inference Francis J. Doyle III University of California, Santa Barbara Douglas Lauffenburger Massachusetts Institute of Technology WTEC Systems Biology Final Workshop March 11, 2005 What

More information

Applied Blue Biotechnology Master

Applied Blue Biotechnology Master Applied Blue Biotechnology Master 1/8 Applied Blue Biotechnology Master Field : Sciences, Technologies, Santé Initial training Continuing training Block/release program 60 ECTS credits 2 semesters Course

More information

Stalking the Genetic Basis of a Trait

Stalking the Genetic Basis of a Trait INTRODUCTION The short film Popped Secret: The Mysterious Origin of Corn describes how the evolution of corn was mostly a mystery until George Beadle proposed a bold new hypothesis in 1939: corn evolved

More information

2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided.

2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided. AP Biology Reading Packet 6- Molecular Genetics Part 2 Name Chapter 19: Eukaryotic Genomes 1. Define the following terms: a. Euchromatin b. Heterochromatin c. Nucleosome 2. Outline the levels of DNA packing

More information

Course Descriptions. BIOL: Biology. MICB: Microbiology. [1]

Course Descriptions. BIOL: Biology. MICB: Microbiology.  [1] Course Descriptions BIOL: Biology http://www.calendar.ubc.ca/vancouver/courses.cfm?code=biol [1] BIOL 112 (3) Biology of the Cell The principles of cellular and molecular biology using bacterial and eukaryotic

More information

COMPUTER RESOURCES II:

COMPUTER RESOURCES II: COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

ATIP Avenir Program 2018 Young group leader

ATIP Avenir Program 2018 Young group leader ATIP Avenir Program 2018 Young group leader Important dates - October 17th (4 pm) 2017 : opening of the registrations online - November 23 th 2017: deadline for the online submission, the mailing of the

More information

Recombinant DNA: Basics and Advanced Applications

Recombinant DNA: Basics and Advanced Applications Recombinant DNA: Basics and Advanced Applications 2015/2016 Code: 42895 ECTS Credits: 9 Degree Type Year Semester 4313794 Biochemistry, Molecular Biology and Biomedicine OT 0 A Contact Name: Antonio Casamayor

More information

EUnetHTA. European network for Health Technology Assessment. European network for Health Technology Assessment JA

EUnetHTA. European network for Health Technology Assessment. European network for Health Technology Assessment JA EUnetHTA European network for Health Technology Assessment Outline The Making of EUnetHTA EUnetHTA and the HTA Network EUnetHTA Achievements and Tools General Information about HTA 2 The Making of EUnetHTA

More information

Personalized. Health in Canada

Personalized. Health in Canada Personalized Health in Canada Canadian Institutes of Health Research Personalized Medicine Signature Initiative 2010-2013 0 Dr. Morag Park CIHR Institute of Cancer Research Dr. Paul Lasko CIHR Institute

More information

ECSEL MASRIA Smart Energy Core topics. Wolfgang Dettmann Vienna November 2016

ECSEL MASRIA Smart Energy Core topics. Wolfgang Dettmann Vienna November 2016 ECSEL MASRIA Smart Energy Core topics Wolfgang Dettmann Vienna November 2016 ECSEL MASRIA Smart Energy MASRIA 2014 2016 MASRIA 2017 Electrical Energy Production Efficiency measures and installation of

More information

Nanotechnology and Advanced Materials for more effective Healthcare

Nanotechnology and Advanced Materials for more effective Healthcare Nanotechnology and Advanced Materials for more effective Healthcare This challenge taps into the potential of nanotechnologies and advanced materials to enable more effective therapies and diagnostics

More information

Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.

Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. by Altogen Labs, 11200 Manchaca Road, Suite 203 Austin TX 78748 USA Tel. (512) 433-6177

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

Examination Assignments

Examination Assignments Bioinformatics Institute of India H-109, Ground Floor, Sector-63, Noida-201307, UP. INDIA Tel.: 0120-4320801 / 02, M. 09818473366, 09810535368 Email: info@bii.in, Website: www.bii.in INDUSTRY PROGRAM IN

More information

Division Ave. High School AP Biology

Division Ave. High School AP Biology Control of Eukaryotic Genes 2007-2008 The BIG Questions n How are genes turned on & off in eukaryotes? n How do cells with the same genes differentiate to perform completely different, specialized functions?

More information

Government Response to the House of Lords Science and Technology Committee Report: Waste or Resource? Stimulating a bioeconomy.

Government Response to the House of Lords Science and Technology Committee Report: Waste or Resource? Stimulating a bioeconomy. Government Response to the House of Lords Science and Technology Committee Report: Waste or Resource? Stimulating a bioeconomy Introduction The Government thanks the Committee for its report on the opportunity

More information

BIOMOLECULAR SCIENCE PROGRAM

BIOMOLECULAR SCIENCE PROGRAM Program Director: Michael Joesten Advances in biology, particularly at the cellular and molecular level, are changing the world that we live in. The basic knowledge of the way nature functions to create

More information

Glossary Capitalist markets Capitalist Trade Civil association

Glossary Capitalist markets Capitalist Trade Civil association Glossary Capitalist markets Capitalist markets are systems of exchange that emphasize economic values. An ideal type that explains them would include certain attributes such as efficiency, productivity,

More information

Synthetic Biology for the Calvin-Cycle- Channeled (Photobiological) Synthesis of Butanol & Pentanol Utilizing Carbon Dioxide as the Sole Feedstock

Synthetic Biology for the Calvin-Cycle- Channeled (Photobiological) Synthesis of Butanol & Pentanol Utilizing Carbon Dioxide as the Sole Feedstock Synthetic Biology for the Calvin-Cycle- Channeled (Photobiological) Synthesis of Butanol & Pentanol Utilizing Carbon Dioxide as the Sole Feedstock 2012 Pacific Rim Summit on Industrial Biotechnology and

More information

27 September Introduction

27 September Introduction 27 September 2017 Possible solutions to improve the European regulatory procedures for clinical trials with Advanced Therapy Medicinal Products consisting of or containing Genetically Modified Organisms

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and

More information

Scientific Advice Mechanism. Scoping paper: New techniques in agricultural biotechnology

Scientific Advice Mechanism. Scoping paper: New techniques in agricultural biotechnology Scientific Advice Mechanism Scoping paper: New techniques in agricultural biotechnology 25 November, 2016 Policy context New techniques in agricultural biotechnology During the past decade a number of

More information

Activity 2.3 Life sciences, biotechnologies and biochemistry for sustainable non-food products and processes

Activity 2.3 Life sciences, biotechnologies and biochemistry for sustainable non-food products and processes Activity 2.3 Life sciences, biotechnologies and biochemistry for sustainable non-food products and processes Presentación Tema 2 FP7 CDTI, Madrid 11 de mayo de 2011 INFO-DAY KBBE Bruxelles, 15 July 2011

More information

BOARD STANDING COMMITTEE CHARTER

BOARD STANDING COMMITTEE CHARTER BOARD STANDING COMMITTEE CHARTER Version #: 1 Date: 19 July 2017 Description: 2018 Governance Committee Charter COMMITTEE NAME: GOVERNANCE COMMITTEE CHARTER EFFECTIVE DATE AND DURATION: 1 JANUARY 2018

More information

AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1

AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1 AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1 - Genetics: Progress from Mendel to DNA: Gregor Mendel, in the mid 19 th century provided the

More information

Webinar IMI2 - Call 9 Data quality in preclinical research and development. Thomas Steckler IMI webinar

Webinar IMI2 - Call 9 Data quality in preclinical research and development. Thomas Steckler IMI webinar Webinar IMI2 - Call 9 Data quality in preclinical research and development Thomas Steckler 11.04.2016 IMI webinar Need for public-private collaboration Low quality data hamper innovation and progress in

More information

Design of Arithmetic and Control Cells for a DNA Binary Processor

Design of Arithmetic and Control Cells for a DNA Binary Processor 2015 International Conference on Computational Science and Computational Intelligence Design of Arithmetic and Control Cells for a DNA Binary Processor Aby K George Electrical and Computer Engineering

More information

MARINE GENETIC RESOURCES AND LAW. Jean-Dominique WAHICHE MNHN/UMR 7206

MARINE GENETIC RESOURCES AND LAW. Jean-Dominique WAHICHE MNHN/UMR 7206 MARINE GENETIC RESOURCES AND LAW Jean-Dominique WAHICHE MNHN/UMR 7206 INTRODUCTION: A LEGAL CHALLENGE The need for environmental protection The need for an economical balance Regulating the access Regulating

More information

C. Incorrect! Threonine is an amino acid, not a nucleotide base.

C. Incorrect! Threonine is an amino acid, not a nucleotide base. MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of 10 1. Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine.

More information

Presentation to the Committee on Accelerating Rare Disease Research and Orphan Product Development

Presentation to the Committee on Accelerating Rare Disease Research and Orphan Product Development Presentation to the Committee on Accelerating Rare Disease Research and Orphan Product Development 23 November 2009 Sharon F. Terry, MA President & CEO, Genetic Alliance Executive Director, PXE International

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

Ethics and Synthetic Biology: Showstopper or Sideshow?

Ethics and Synthetic Biology: Showstopper or Sideshow? Ethics and Synthetic Biology: Showstopper or Sideshow? Arthur L. Caplan PhD Department of Medical Ethics University of Pennsylvania School of Medicine COI I declare No financial Conflicts of Interest Key

More information

The Two-Hybrid System

The Two-Hybrid System Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine The Two-Hybrid System Carolina Vollert & Peter Uetz Institut für Genetik Forschungszentrum Karlsruhe PO Box 3640 D-76021 Karlsruhe

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Prokaryotic Transcription

Prokaryotic Transcription Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are

More information

FSC PROCEDURE. The Development and Approval of Controlled Wood National Risk Assessments. Forest Stewardship Council FSC-PRO V3-0 D1-0 EN

FSC PROCEDURE. The Development and Approval of Controlled Wood National Risk Assessments. Forest Stewardship Council FSC-PRO V3-0 D1-0 EN Forest Stewardship Council FSC PROCEDURE The Development and Approval of Controlled Wood National Risk Assessments FSC-PRO-60-002 V3-0 D1-0 EN FSC NETWORK Title: Document reference code: Scope: Approval:

More information

Workshop on Access to and Uptake of Biosimilar Medicinal Products

Workshop on Access to and Uptake of Biosimilar Medicinal Products EUROPEAN COMMISSION Directorate-General for Internal Market, Industry, Entrepreneurship and SMEs Consumer, Environmental and Health Technologies Biotechnology and Food Supply Chain Workshop on Access to

More information

Opportunities in Eco-Innovation. Chemistry

Opportunities in Eco-Innovation. Chemistry pportunities in EcoInnovation Chemistry Washington US National Academies/ECD/The Royal Society 09 July 2009 Sven Panke Department of Biosystems Science and Engineering ETH Zurich @ Basel 1. Synthetic biology

More information