Ioannis Economidis /Christina Naneva (European Commission) Sohi Rastegar (National Science Foundation)
|
|
- Harriet Rogers
- 6 years ago
- Views:
Transcription
1 Ioannis Economidis /Christina Naneva (European Commission) Sohi Rastegar (National Science Foundation)
2 Report 1. What is Synthetic Biology v 2. Towards standards in Synthetic Biology.. A Task Force Workshop, Segovia, ES (June 2010) 3. What is a Task Force Working Group on Synthetic Biology (Terms of reference/strategy plan) 4. Future activities 5. Actions in the granting systems taking into account the existence of the WG on Synthetic Biology
3
4 Synthetic Biology the design and fabrication of biological components and systems that do not already exist in the natural world and/or the re-design and refactoring of existing biological systems.
5 The basic notion behind SB Any biological system can be considered as a complex combination of functional, stand-alone elements (not unlike those found in man-made devices) It can be-deconstructed in a limited number of components and reconstructed in an entirely different configuration for the sake of modifying existing properties or creating altogether new ones. SB has an aspect of developing general-use technological and conceptual tools (biological parts, minimal genomes, artificial cells, DNA synthesis),
6
7 Addressing hitherto intractable problems Biosynthesis of complex molecules, breakdown or recycling of toxic chemicals, biological detection of explosives, biological production of H2 and other fuels raising utterly novel challenges DNA computing, design of biological pattern development targeting bacteria to tumor cells expanding the genetic code to non-natural amino acids
8 The central aspect of synthetic biology, is bound to have an immense impact in Biotechnology, The possibility of re-programming or creating new live organisms through the logical combination of standardized biological components that are otherwise decoupled from their natural context. Challenges: the reliable formatting of biological functionalities and the detailed description of the most basic biological constituents and their interfaces, similar to modern electronic circuits.
9 Facing the challenges The use of Systems Biology to understand the design and operation rules. The exploitation of such rules for re-engineer biological systems á la carte. The challenge is thus to set reliable Standard Operating Procedures, principles and actual units of measurement that are useful for biological engineering, even if we may still miss some fundamental facts.
10 Five hard truths for Synthetic biology Many of the parts are undefined The circuitry is unpredictable The complexity is unwieldy Many parts are incompatible Variability crashes the system Nature 463, (2010)
11 Report 1. What is Synthetic Biology v 2. Towards standards in Synthetic Biology.. A Task Force Workshop, Segovia, ES (June 2010) v 3. What is a Task Force Working Group on Synthetic Biology (Terms of reference/strategy plan) 4. Future activities 5. Actions in the granting systems taking into account the existence of the WG on Synthetic Biology
12 Towards Standards in Synthetic Biology An Exploratory Workshop of the US-EC Task Force in Biotechnology Parador de Segovia (Segovia, Spain). June 4-6, 2010
13 Standards and Standardisation [a] the adoption of specific geometric shapes and size formats for the physical assembly of the components of a man-made system (e.g. the sizes and shapes of screw turns), [b] the definition of units of measurement of relevant properties and parameters as well as conditions and procedures to calculate them (e.g. Amperes for current, Ohms for resistance, etc), [c] implementation of unambiguous protocols for the manufacture of the engineered objects.
14 Standards and Standardisation in SB the establishment of rules for the physical composition of biologial (expression) devices. the adoption of RNA polymerase per second (PoPs) units as a universal reference to express promoter strength The calculation of a translation efficacy index deduced from measuring the input/output function of the devices under the various growth and metabolic conditions.
15 The specific goals of the Workshop Review and discuss the latest technical standards having to do with vector architecture and physical assembly of genetic material, in vivo measures of biological functions and parametrization methods/algorithms, descriptive languages, graphical representations and formalisms for modelling genetic elements, and data exchange supporting registries of standard biological parts. Present and discuss the emerging standardisation requirements needed to develop one or more cellular operating systems supporting genome-scale engineering. Identify and prioritise scientific research areas that would critically accelerate standards-driven biological engineering at the genome scale. Identify new research programs or resources needed to support the preceeding goals
16 Deliverables - Platforms a list of top standardisation needs not met or realised yet via current practice; a set of fresh scientific research areas that might be strategically coupled to support current engineering goals in Synthetic Biology; a working list of now unmet programmatic or facility needs necessary to see such work carried out in a timely fashion. an US-EU Group on Biological Standards which will act as both as an observatory of bottom-up initiatives and as a think tank on research topics with a prenormative value.
17 Report 1. What is Synthetic Biology 2. Towards standards in Synthetic Biology.. A Task Force Workshop, Segovia, ES (June 2010) 3. What is a Task Force Working Group on Synthetic Biology (Terms of reference/strategy plan) v 4. Future activities 5. Actions in the granting systems taking into account the existence of the WG on Synthetic Biology
18
19 WORKING GROUPS & ACTIVITIES ENVIRONMENTAL BIOTECHNOLOGY PLANT BIOLOGY BIO-BASED PRODUCTS AND BIO-BASED ENERGY BIO- INFORMATICS ETHICS SOCIETAL NANO- BIOTECHNOLOG Y ANIMAL BIOTECHNOLOGY MARINE GENOMICS SYNTHETIC BIOLOGY
20 Mission The exchange of views and collaboration across the Atlantic on Synthetic Biology.
21 Focus on Scientific and Technical progress in implementing Synthetic Biology principles (standards, orthogonality, minimal genomes, etc.) Outstanding issues of Ethics, Biosafety (including environmental safety) and Biosecurity. Educational approaches.
22 Structure Secretarial EU/EC: Christina Naneva; Ioannis Economidis US/NSF: Sohi Rastegar Members EU US V. De Lorenzo (ES) Drew Endy X X Y Y Z Z
23 Report 1. What is Synthetic Biology 2. Towards standards in Synthetic Biology.. A Task Force Workshop, Segovia, ES (June 2010) 3. What is a Task Force Working Group on Synthetic Biology (Terms of reference/strategy plan) 4. Future activities v 5. Actions in the granting systems taking into account the existence of the WG on Synthetic Biology
24 Planned activities All five years Telephone/video conferences/webinars Meetings in conjunction to international relevant scientific event. Workshops (Possible ideas) - "Orthogonality and orthogonal systems in Biology", Cell operative systems and Deep metabolic engineering Workshop on Ethical, Legal, and Social issues in relationship (or in juxtaposition) to the scientific and technical progress of Synthetic Biology. Workshop on relevant contribution of Synthetic Biology to different domains of Biotechnology
25 Questions to be answered by these workshops and follow up discussions Define accurately the nature and boundaries of biological functions Formalization and nonambiguous representation of biological information is a major bottleneck for the development of SB Development of consensus criteria for Biological Standards What is a biological part? Its it possible to convert a natural, context-dependent module into an autonomous component?
26 Planned activities Training Activities Short term courses with theoretical and practical (laboratory) sessions focused on basic techniques and principles of synthetic biology. Exploration of funding possibilities for short term exchanges of US young scholars to EU research institutions with reciprocity of short term exchanges of EU young scholars to US research establishments.
27 Ethics and beyond Safety Biosecurity, prevention of bioterrorism and dual use Governance Patenting and common heritage Trade and global justice Science and society dialogue Research
28 Public beneficence Public Funding Review and Disclosure Support for Promising Research Innovation Through Sharing Responsible stewardship Coordinated Approach to Synthetic Biology Risk Assessment Review and Field Release Gap Analysis Monitoring, Containment, and Control Risk Assessment Prior to Field Release International Coordination and Dialogue Ethics Education Ongoing Evaluation of Objections Intellectual freedom and responsibility Fostering Responsibility and Accountability Periodic Assessment of Security and Safety Risks Oversight Controls Democratic deliberation Scientific, Religious, and Civic Engagement Information Accuracy Public Education Justice and fairness. Risks in Research Risks and Benefits in Commercial Production and Distribution
29 Report 1. What is Synthetic Biology 2. Towards standards in Synthetic Biology.. A Task Force Workshop, Segovia, ES (June 2010) 3. What is a Task Force Working Group on Synthetic Biology (Terms of reference/strategy plan) 4. Future activities 5. Actions in the granting systems taking into account the existence of the WG on Synthetic Biology v
30 Synthetic Biology in KBBE 2011 Towards standardisation in Synthetic Biology Applying Synthetic Biology principles towards the cell factory notion in biotechnology Ensuring the safety of Synthetic Biology applications Synthetic Biology ERA-NET
31 Towards standardisation in Synthetic Biology Standardization and orthogonalization of the gene expression flow for robust engineering of NTN (new-tonature) biological properties (ST-FLOW) The ST-FLOW Project merges the efforts of 15 leading European and US research groups for developing material and computational standards that enable the forward-design of prokaryotic systems with a degree of robustness and predictability that is not possible with customary Genetic Engineering.
EC-US Task Force Activities on Synthetic Biology. Ioannis Economidis, EC DG Research Sohi Rastegar, NSF June 2010
EC-US Task Force Activities on Synthetic Biology Ioannis Economidis, EC DG Research Sohi Rastegar, NSF June 2010 Questions Greatest challenges in Synbio Opportunities for collaboration between EU and US
More informationEC-US Working Group on Environmental Biotechnology. Ioannis Economidis, EC DG Research Anna Palmisano and Pete Burfening, USDA/CSREES July 20, 2006
EC-US Working Group on Environmental Biotechnology Ioannis Economidis, EC DG Research Anna Palmisano and Pete Burfening, USDA/CSREES July 20, 2006 Working Group Mission To foster the collaboration of researchers
More informationUS-EU Task Force on Biotechnology Research Five-Year Strategic Plan
US-EU Task Force on Biotechnology Research Five-Year Strategic Plan 2011-2015 June 23. 2011 1 2 TABLE OF CONTENTS CO-CHAIRS' FORWARD 5 SUMMARY 6 ANIMAL BIOTECHNOLOGY WORKING GROUP 9 Membership 10 Programming
More informationDesign Principles in Synthetic Biology
Design Principles in Synthetic Biology Chris Myers 1, Nathan Barker 2, Hiroyuki Kuwahara 3, Curtis Madsen 1, Nam Nguyen 1, Michael Samoilov 4, and Adam Arkin 4 1 University of Utah 2 Southern Utah University
More informationSynthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design.
Synthetic Biology Accelerating Discoveries, Expanding Possibilities Sustainable Energy Therapeutics Industrial Enzymes Agriculture Design Build Generate Solutions to Advance Synthetic Biology Research
More informationFrom the Quest for Fire to GATTACA: Systems and Synthetic Biology as the Next Wave of Technology Disruption in the Anthropocene
From the Quest for Fire to GATTACA: Systems and Synthetic Biology as the Next Wave of Technology Disruption in the Anthropocene Dr. George Poste Chief Scientist, Complex Adaptive Systems Initiative and
More informationUpdates to the NIH Guidelines for Research Involving Recombinant DNA Molecules (NIH Guidelines)
Updates to the NIH Guidelines for Research Involving Recombinant DNA Molecules (NIH Guidelines) Jacqueline Corrigan-Curay, J.D. M.D. Acting Director Office of Biotechnology Activities National Institute
More informationSynthetic Biology: A New Application Area for Design Automation Research
Synthetic Biology: A New Application Area for Design Automation Research Chris Myers 1, Nathan Barker 2, Hiroyuki Kuwahara 3, Curtis Madsen 1, Nam Nguyen 4, Chris Winstead 5 1 University of Utah 2 Southern
More informationTrend analysis Biotechnology 2016
Trend analysis Biotechnology 2016 Summary april 2016 1 Trendanalyse Biotechnologie 2016 - Regelgeving ontregeld Scientific advances in biotechnology have taken off in recent years. New techniques and applications
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationEngineering Genetic Circuits
Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art
More informationThe Integrated Biomedical Sciences Graduate Program
The Integrated Biomedical Sciences Graduate Program at the university of notre dame Cutting-edge biomedical research and training that transcends traditional departmental and disciplinary boundaries to
More informationRules and Regulations on GMO-derived food products in the European Union Lynn Insall UK Food and Drink Federation
Rules and Regulations on GMO-derived food products in the European Union Lynn Insall UK Food and Drink Federation Food Safety Workshop, Cairo, 17 April 2005 About the UK Food and Drink Manufacturing Industry
More informationGenetic Engineering for Biofuels Production
Genetic Engineering for Biofuels Production WSE 573 Spring 2013 Greeley Beck INTRODUCTION Alternative transportation fuels are needed in the United States because of oil supply insecurity, oil price increases,
More informationChallenges for biosafety in the rapid changing field of biotechnology
Challenges for biosafety in the rapid changing field of biotechnology Gijsbert van Willigen, PhD Coordinator CBRN Safety & Security LEIDEN UNIVERSITY MEDICAL HOSPITAL 1Insert > Header & footer 14-Apr-17
More informationThe 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential
The 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential Applications Richard Finkers Researcher Plant Breeding, Wageningen UR Plant Breeding, P.O. Box 16, 6700 AA, Wageningen, The Netherlands,
More informationPrinciples for the Oversight of Synthetic Biology- Precautionary Principle
1 Principles for the Oversight of Synthetic Biology- Precautionary Principle When an activity raises threats of harm to human health or the environment, precautionary measures should be taken even if some
More informationSynthetic Biology and Patents
Synthetic Biology and Patents Dr. Berthold Rutz, Directorate 2.4.01 Biotechnology European Patent Office Munich "Patenting Synthetic Biology? A Transatlantic Perspective" WWICS, Washington D.C. 30.11.2009
More informationBiotechnology, Synthetic Biology, and Genetic Circuit Design Module Lesson Plan. 1 day. 1 P age
1 P age Biotechnology, Synthetic Biology, and Genetic Circuit Design Module Lesson Plan 1 day 2 P age Introduction In this single module students will build upon their previous knowledge of basic molecular
More informationA. What can we infer about the design of a genome by considering the physical problems that a biological systems solves?
Genome Engineering Drew Endy (http://mit.edu/endy/) Questions Introduced Last Time A. What can we infer about the design of a genome by considering the physical problems that a biological systems solves?
More informationDigitally Programmed Cells
Digitally Programmed Cells Ron Weiss PI: Tom Knight MIT Artificial Intelligence Laboratory Goal Process-Control Cellular Computers -- Microbial Robotics Unique features: small, self-replicating, energy-efficient
More informationTotal Test Questions: 66 Levels: Grades Units of Credit: 1.0 STANDARD 2. Demonstrate appropriate use of personal protective devices.
DESCRIPTION Biotechnology is designed to create an awareness of career possibilities in the field of biotechnology. Students are introduced to diagnostic and therapeutic laboratory procedures that support
More informationTools and Opportunities to Enhance Risk Analysis. Nathan J. Hillson
Tools and Opportunities to Enhance Risk Analysis Nathan J. Hillson njhillson@lbl.gov Future Biotechnology Products and Opportunities to Enhance the Capabilities of the Biotechnology Regulatory System National
More informationCHAPTERS , 17: Eukaryotic Genetics
CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationBioinformatics. Lecturer: Antinisca Di Marco Tutor: Francesco Gallo
Bioinformatics Lecturer: Antinisca Di Marco Tutor: Francesco Gallo E mails: nome.cognome@univaq.it For appointment Di Marco: Tuersday 3.30 4:30 p.m. Friday 10:00-11:00 a.m. please ask appointment via email
More informationAlgorithms in Bioinformatics
Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline Central Dogma of Molecular
More informationControlling DNA. Ethical guidelines for the use of DNA technology. Module Type: Discussion, literature review, and debate
Ethical guidelines for the use of DNA technology Author: Tara Cornelisse, Ph.D. Candidate, Environmental Studies, University of California Santa Cruz. Field-tested with: 11 th -12 th grade students in
More informationCITI Certificates
CITI Certificates 2017-2018 Adu.Research.Office@adu.edu Room CC340 Table of Contents Human Subjects Research... 1 Biomedical Research - Basic/Refresher - Basic Course:... 1 Required Courses:... 1 Human
More informationBiosafety and the NIH Guidelines
Biosafety and the NIH Guidelines This section will explore: Why the NIH Guidelines are important The definition of recombinant or synthetic nucleic acid research Content of the NIH Guidelines Section III
More informationGMO Technology Conference
GMO Technology Conference The regulation of Clinical Trials on humans involving therapies containing or consisting of genetically modified organisms The Printworks, Dublin Castle 10 th & 11 th October
More informationNIH Guidelines for rdna Research: Tutorial for Completing Penn s rdna Registration Document
NIH Guidelines for rdna Research: Tutorial for Completing Penn s rdna Registration Document Revision March 3, 2011 Penn s rdna Registration Document Dual Use Research Definition: Research that yields information
More informationRNA-Seq with the Tuxedo Suite
RNA-Seq with the Tuxedo Suite Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 2015 Workshop The Basic Tuxedo Suite References Trapnell C, et al. 2009 TopHat: discovering splice junctions with
More informationThe European Research Council. CRISPR-Cas9 research in ERCEA Ethics Process. Filipa Ferraz de Oliveira ERCEA Scientific Officer
The European Research Council CRISPR-Cas9 research in ERCEA Ethics Process Filipa Ferraz de Oliveira ERCEA Scientific Officer Fostering Responsible Research With CRISPR-Cas9, Paris, March 2016 1 CRISPR-Cas9
More informationAnalytics of Biomedical Data INFO B585
Analytics of Biomedical Data INFO B585 Course Info Location Prerequisites: 3 Credit hours Online None COURSE DESCRIPTION This introductory course teaches students how to apply biomedical analytics methods
More informationDNA Logic Gates to Design a 4*4 bit Carry Select Adder Circuit
DNA Logic Gates to Design a 4*4 bit Carry Select Adder Circuit Seeja V M Bannari Amman Institute of Technology Sathyamangalam, Erode seejavm@gmail.com Daniel Raj A Bannari Amman Institute of Technology
More informationSoil bacteria to produce new antibiotics
Powered by Website address: https://www.gesundheitsindustriebw.de/en/article/news/soil-bacteria-to-produce-newantibiotics/ Soil bacteria to produce new antibiotics An ever-growing number of genomes of
More informationAnnex IV: Competency Framework
Making the railway system work better for society. NSA Monitoring 120 Rue Marc Lefrancq BP 20392 FR-59307 Valenciennes Cedex 1 / 11 Contents 1. Introduction... 3 2. Roles and responsibilities... 3 2.1.
More informationGenome Editing Technology - Principle -
Effective Date: 31.10.2017 Doc ID: 20290213 Version: 1.0 Status: Approved Planned Effective Date: 31-Oct-2017 00:00 CET (Server Date) Genome Editing Technology - Principle - Rationale Genome editing is
More informationMolecular Genetics Student Objectives
Molecular Genetics Student Objectives Exam 1: Enduring understanding 3.A: Heritable information provides for continuity of life. Essential knowledge 3.A.1: DNA, and in some cases RNA, is the primary source
More informationIn order to achieve major productivity and cost-efficient breakthroughs, a solution is
Igor Juricic, Intergraph, Italy, examines the advances made in vessel design software. In order to achieve major productivity and cost-efficient breakthroughs, a solution is required that can manage today
More informationEuropean Technology Platform for Global Animal Health. Action Plan
European Technology Platform for Global Animal Health Action Plan European Technology T Platform for Global Animal Health Action Plan 2 Table of contents Executive Summary 7 Chapter 1: The Action Plan
More informatione-sens white paper D3.4 Preliminary Proposal for a governance body Instruments Deliverable 3.4, version 3
e-sens white paper D3.4 Preliminary Proposal for a governance body Instruments Deliverable 3.4, version 3 Abstract of the Deliverable 3.4, version 3: The deliverable D3.4v3 presents a concrete proposal
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationTesting of Web Services A Systematic Mapping
Testing of Web Services A Systematic Mapping Abhishek Sharma, Theodore D. Hellmann, Frank Maurer Department of Computer Science University of Calgary Calgary, Canada {absharma, tdhellma, frank.maurer}@ucalgary.ca
More informationTutorial for Completing Penn s r s DNA Registration Document
NIH GUIDELINES FOR RESEARCH INVOLVING RECOMBINANT OR SYNTHETIC NUCLEIC ACID MOLECULES NIH GUIDELINES Tutorial for Completing Penn s r s DNA Registration Document Revision March 7, 2013 Penn s r s DNA Registration
More informationIBC protocol Risk Assessment and Determination of NIH Guidelines
IBC protocol Risk Assessment and Determination of NIH Guidelines The following are points to consider when reviewing all protocols for risk, recommended containment conditions, and determine applicable
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More information1. Page 90: Cellular Metabolism Explain what the everyday use of the word metabolism means to you.
Biology 100 Winter 2013 North Seattle Community College Reading Guide 10 Metabolism, Enzymes, and Building a Protein Reading: 1) Chapter 5 (various pages) in Microbiology Demystified 2) Chapter 7 (various
More informationD.B.E. Digital Business Ecosystem. WP33: Dissemination and Community Building. D33.1: DBE Brand Identity Definition.
D.B.E. Digital Business Ecosystem Contract n 507953 WP33: Dissemination and Community Building D33.1: DBE Brand Identity Definition Project funded by the European Community under the Information Society
More informationThe European partnership for alternative approaches to animal testing
AATEX 14, Special Issue, 769-773 Proc. 6th World Congress on Alternatives & Animal Use in the Life Sciences August 21-25, 2007, Tokyo, Japan The European partnership for alternative approaches to animal
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationBiomedical Research on Human Participants
Ethical Guidelines for Biomedical Research on Human Participants Dr P Paul Kumaran MBBS, BA (Psychology), MPH Scientist E [Deputy Director Medical] National Institute for Research in Tuberculosis (ICMR)
More informationCall Title: KBBE 2009: general call for proposals
Call Title: KBBE 2009: general call for proposals Call identifier: FP7-KBBE-2009-3 Date of publication: 3 September 2008 Deadline: 15 January 2009 at 17.00.00 (Brussels local time) Indicative budget: EUR
More information26 STNews October 2008
26 STNews October 2008 Knowing whether to use U or T when searching RNA sequences on STN Introduction When you are designing a search query for sequence information on STN, it is important to consider
More informationSetting the scene - recent development and future challanges
Mitglied der Helmholtz-Gemeinschaft Setting the scene - recent development and future challanges Ulrich Schurr, Forschungszentrum Jülich, IBG-2: Plant Sciences Major societal challenges: plants are key
More informationVictoria Grygoryevna Tretiakova
ISSN 1392 1274. TEISĖ 2013 87 The international community must take care of bioethical protection of every person to form unified system of international and national bioethical courts Victoria Grygoryevna
More informationTotal Test Questions: 71 Levels: Grades Units of Credit: 1.0 STANDARD 1 STUDENTS WILL INVESTIGATE THE PAST, PRESENT, AND FUTURE APPLICATIONS OF
DESCRIPTION Biotechnology is designed to create an awareness of career possibilities in the field of biotechnology. Students are introduced to diagnostic and therapeutic laboratory procedures that support
More informationNetwork System Inference
Network System Inference Francis J. Doyle III University of California, Santa Barbara Douglas Lauffenburger Massachusetts Institute of Technology WTEC Systems Biology Final Workshop March 11, 2005 What
More informationApplied Blue Biotechnology Master
Applied Blue Biotechnology Master 1/8 Applied Blue Biotechnology Master Field : Sciences, Technologies, Santé Initial training Continuing training Block/release program 60 ECTS credits 2 semesters Course
More informationStalking the Genetic Basis of a Trait
INTRODUCTION The short film Popped Secret: The Mysterious Origin of Corn describes how the evolution of corn was mostly a mystery until George Beadle proposed a bold new hypothesis in 1939: corn evolved
More information2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided.
AP Biology Reading Packet 6- Molecular Genetics Part 2 Name Chapter 19: Eukaryotic Genomes 1. Define the following terms: a. Euchromatin b. Heterochromatin c. Nucleosome 2. Outline the levels of DNA packing
More informationCourse Descriptions. BIOL: Biology. MICB: Microbiology. [1]
Course Descriptions BIOL: Biology http://www.calendar.ubc.ca/vancouver/courses.cfm?code=biol [1] BIOL 112 (3) Biology of the Cell The principles of cellular and molecular biology using bacterial and eukaryotic
More informationCOMPUTER RESOURCES II:
COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer
More informationChapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationATIP Avenir Program 2018 Young group leader
ATIP Avenir Program 2018 Young group leader Important dates - October 17th (4 pm) 2017 : opening of the registrations online - November 23 th 2017: deadline for the online submission, the mailing of the
More informationRecombinant DNA: Basics and Advanced Applications
Recombinant DNA: Basics and Advanced Applications 2015/2016 Code: 42895 ECTS Credits: 9 Degree Type Year Semester 4313794 Biochemistry, Molecular Biology and Biomedicine OT 0 A Contact Name: Antonio Casamayor
More informationEUnetHTA. European network for Health Technology Assessment. European network for Health Technology Assessment JA
EUnetHTA European network for Health Technology Assessment Outline The Making of EUnetHTA EUnetHTA and the HTA Network EUnetHTA Achievements and Tools General Information about HTA 2 The Making of EUnetHTA
More informationPersonalized. Health in Canada
Personalized Health in Canada Canadian Institutes of Health Research Personalized Medicine Signature Initiative 2010-2013 0 Dr. Morag Park CIHR Institute of Cancer Research Dr. Paul Lasko CIHR Institute
More informationECSEL MASRIA Smart Energy Core topics. Wolfgang Dettmann Vienna November 2016
ECSEL MASRIA Smart Energy Core topics Wolfgang Dettmann Vienna November 2016 ECSEL MASRIA Smart Energy MASRIA 2014 2016 MASRIA 2017 Electrical Energy Production Efficiency measures and installation of
More informationNanotechnology and Advanced Materials for more effective Healthcare
Nanotechnology and Advanced Materials for more effective Healthcare This challenge taps into the potential of nanotechnologies and advanced materials to enable more effective therapies and diagnostics
More informationComparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.
Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. by Altogen Labs, 11200 Manchaca Road, Suite 203 Austin TX 78748 USA Tel. (512) 433-6177
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationExamination Assignments
Bioinformatics Institute of India H-109, Ground Floor, Sector-63, Noida-201307, UP. INDIA Tel.: 0120-4320801 / 02, M. 09818473366, 09810535368 Email: info@bii.in, Website: www.bii.in INDUSTRY PROGRAM IN
More informationDivision Ave. High School AP Biology
Control of Eukaryotic Genes 2007-2008 The BIG Questions n How are genes turned on & off in eukaryotes? n How do cells with the same genes differentiate to perform completely different, specialized functions?
More informationGovernment Response to the House of Lords Science and Technology Committee Report: Waste or Resource? Stimulating a bioeconomy.
Government Response to the House of Lords Science and Technology Committee Report: Waste or Resource? Stimulating a bioeconomy Introduction The Government thanks the Committee for its report on the opportunity
More informationBIOMOLECULAR SCIENCE PROGRAM
Program Director: Michael Joesten Advances in biology, particularly at the cellular and molecular level, are changing the world that we live in. The basic knowledge of the way nature functions to create
More informationGlossary Capitalist markets Capitalist Trade Civil association
Glossary Capitalist markets Capitalist markets are systems of exchange that emphasize economic values. An ideal type that explains them would include certain attributes such as efficiency, productivity,
More informationSynthetic Biology for the Calvin-Cycle- Channeled (Photobiological) Synthesis of Butanol & Pentanol Utilizing Carbon Dioxide as the Sole Feedstock
Synthetic Biology for the Calvin-Cycle- Channeled (Photobiological) Synthesis of Butanol & Pentanol Utilizing Carbon Dioxide as the Sole Feedstock 2012 Pacific Rim Summit on Industrial Biotechnology and
More information27 September Introduction
27 September 2017 Possible solutions to improve the European regulatory procedures for clinical trials with Advanced Therapy Medicinal Products consisting of or containing Genetically Modified Organisms
More informationRNA and Protein Synthesis
RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and
More informationScientific Advice Mechanism. Scoping paper: New techniques in agricultural biotechnology
Scientific Advice Mechanism Scoping paper: New techniques in agricultural biotechnology 25 November, 2016 Policy context New techniques in agricultural biotechnology During the past decade a number of
More informationActivity 2.3 Life sciences, biotechnologies and biochemistry for sustainable non-food products and processes
Activity 2.3 Life sciences, biotechnologies and biochemistry for sustainable non-food products and processes Presentación Tema 2 FP7 CDTI, Madrid 11 de mayo de 2011 INFO-DAY KBBE Bruxelles, 15 July 2011
More informationBOARD STANDING COMMITTEE CHARTER
BOARD STANDING COMMITTEE CHARTER Version #: 1 Date: 19 July 2017 Description: 2018 Governance Committee Charter COMMITTEE NAME: GOVERNANCE COMMITTEE CHARTER EFFECTIVE DATE AND DURATION: 1 JANUARY 2018
More informationAGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1
AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1 - Genetics: Progress from Mendel to DNA: Gregor Mendel, in the mid 19 th century provided the
More informationWebinar IMI2 - Call 9 Data quality in preclinical research and development. Thomas Steckler IMI webinar
Webinar IMI2 - Call 9 Data quality in preclinical research and development Thomas Steckler 11.04.2016 IMI webinar Need for public-private collaboration Low quality data hamper innovation and progress in
More informationDesign of Arithmetic and Control Cells for a DNA Binary Processor
2015 International Conference on Computational Science and Computational Intelligence Design of Arithmetic and Control Cells for a DNA Binary Processor Aby K George Electrical and Computer Engineering
More informationMARINE GENETIC RESOURCES AND LAW. Jean-Dominique WAHICHE MNHN/UMR 7206
MARINE GENETIC RESOURCES AND LAW Jean-Dominique WAHICHE MNHN/UMR 7206 INTRODUCTION: A LEGAL CHALLENGE The need for environmental protection The need for an economical balance Regulating the access Regulating
More informationC. Incorrect! Threonine is an amino acid, not a nucleotide base.
MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of 10 1. Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine.
More informationPresentation to the Committee on Accelerating Rare Disease Research and Orphan Product Development
Presentation to the Committee on Accelerating Rare Disease Research and Orphan Product Development 23 November 2009 Sharon F. Terry, MA President & CEO, Genetic Alliance Executive Director, PXE International
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationEthics and Synthetic Biology: Showstopper or Sideshow?
Ethics and Synthetic Biology: Showstopper or Sideshow? Arthur L. Caplan PhD Department of Medical Ethics University of Pennsylvania School of Medicine COI I declare No financial Conflicts of Interest Key
More informationThe Two-Hybrid System
Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine The Two-Hybrid System Carolina Vollert & Peter Uetz Institut für Genetik Forschungszentrum Karlsruhe PO Box 3640 D-76021 Karlsruhe
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationProkaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
More informationFSC PROCEDURE. The Development and Approval of Controlled Wood National Risk Assessments. Forest Stewardship Council FSC-PRO V3-0 D1-0 EN
Forest Stewardship Council FSC PROCEDURE The Development and Approval of Controlled Wood National Risk Assessments FSC-PRO-60-002 V3-0 D1-0 EN FSC NETWORK Title: Document reference code: Scope: Approval:
More informationWorkshop on Access to and Uptake of Biosimilar Medicinal Products
EUROPEAN COMMISSION Directorate-General for Internal Market, Industry, Entrepreneurship and SMEs Consumer, Environmental and Health Technologies Biotechnology and Food Supply Chain Workshop on Access to
More informationOpportunities in Eco-Innovation. Chemistry
pportunities in EcoInnovation Chemistry Washington US National Academies/ECD/The Royal Society 09 July 2009 Sven Panke Department of Biosystems Science and Engineering ETH Zurich @ Basel 1. Synthetic biology
More information