Supplemental data 1 220
|
|
- Bryan Beasley
- 6 years ago
- Views:
Transcription
1 Supplemental data Chemicals and reagents MTX (00 mg/ml Emthexate PF) was from Pharmachemie (Haarlem, The Netherlands), [ H]FEX was custom-made by GE Healthcare/Amersham Biosciences (UK), FEX, rifampicin, and ascorbate were from Sigma (St. Louis, USA), methoxyflurane (Metofane) from Medical Developments Australia (Springvale, Australia) and heparin (5,000 IE/ml) from Leo Pharma BV (Breda, The Netherlands). The Oatp antibodies M- (sc-846) and K-7 (sc-4770) were from Santa Cruz Biotechnology, Inc (Santa Cruz, USA). M III-5 and M 4 I-80 were kind gifts of Dr. G.L. Scheffer (Free University Hospital, Amsterdam, The Netherlands), M -8 was a kind gift of the group of Dr. P. Borst in our institute. BXP-5 was described before (Proc Natl Acad Sci 99: (00)). RNA isolation, cdna synthesis and RT-PCR DNA isolation from mouse liver, kidney, and small intestine and subsequent cdna synthesis and RT-PCR were performed as described (Mol Pharmacol 7:09-06 (008)). Specific primers (QIAGEN, Hilden, Germany) were used to detect expression levels of the following mouse genes: Slcoa, Slcoa4-6, Slcob, Slcob, Slc0a, Slca-, Slca6-0, Slca, Abcc-4, Abcba, Abcbb, Abcg, Aox, Aox, and Ugta. Western blot analysis Isolation of crude membrane fractions from liver, kidney and small intestine, and Western blotting were performed as described previously (Biochem Biophys Res Commun 0: (996)). Equal protein loading was confirmed by Ponceau S staining of the membranes after transfer. Oatpa4 and Oatpb were detected with respectively OATP (M-; sc-846) (dilution :00) and OATP4 antibodies (K-7; sc-4770) (dilution :00). For the detection of Abcc, Abcc, Abcc4 and Abcg the primary antibodies M III-5 (dilution :000), M -8 (dilution :5), M 4 I-80 (dilution :400) and BXP-5 (dilution :000) were used, respectively. Clinical-chemical analysis of plasma and urine and hematological analysis of blood Standard clinical-chemical analyses on EDTA plasma were performed on a Roche Hitachi 97 analyzer to determine levels of total and conjugated bilirubin, alkaline phosphatase, aspartate aminotransaminase, alanine aminotransaminase, γ-glutamyl transferase, lactate dehydrogenase, creatinine, urea, Na +, K +, Ca +, total protein, albumin, uric acid, cholesterol and triglyceride. Standard clinical-chemical analyses were also performed on urine (collected using Ruco Type M/ stainless steel metabolic cages [Valkenswaard, The Netherlands]) to determine the levels of
2 creatinine, glucose, Na +, K +, Ca +, urea, uric acid and total protein. Hemoglobin, hematocrit, mean corpuscular volume, red and white blood cells, and platelets were analyzed in peripheral EDTA blood on a Beckman Coulter Ac T Diff analyzer (Beckman Coulter, Fullerton, CA). Histological analysis Tissues were fixed in 4% phosphate-buffered formalin, embedded in paraffin, sectioned at 4 µm, and stained with hematoxylin and eosin according to standard procedures. Construction of targeting vectors for generation of mice. The mouse Slcoa and -b genes were mapped using data from the ENSEMBL database ( Total RPCI- female (9S6/SvEvTac) mouse PAC library-derived DNA was used as a template for the construction of suitable gene targeting vectors. For both the centromeric and telomeric side of the Slcoa/b cluster, targeting vectors were constructed allowing insertion of loxp sequences at the cluster flanks (i.e. Slcob and Slcoa5). For the telomeric side of the cluster, a targeting vector was made in which a.-kb fragment containing exon and 4 of Slcoa5 (according to ENSEMBL release 5, corresponding to the two exons after the exon containing the start codon) was replaced by a -kb Pgk-neomycin cassette in reverse transcriptional orientation with LoxP sequences. PCR primers used for generation of the Slcoa5 targeting construct were 5 - GCCTCTATCACATTGCCCTGTG- (forward) and 5 -GCTAGTGTATGCAATGGTGTC- (reverse). A 0.-kb ApaI/SacI (located in vector polylinker) linearized DNA fragment was used for electroporation into ES cells. For the centromeric side of the Slcoa/b cluster, a targeting vector was made in which a ~5.9-kb fragment containing exon 4 of Slcob (according to ENSEMBL release 5, corresponding to the first exon after the exon containing the start codon) was replaced by a ~5-kb Pgk-hygromycin cassette with LoxP sequences and a Pgk-thymidine kinase cassette, both in transcriptional orientation. PCR primers used for generation of the Slcob targeting construct were 5 -CAACCACTCTGGAAATCGGTCTG- (forward) and 5 - GGCTTCCACAGGATTGGCATAC- (reverse). A.9-kb PmeI/SfiI (located in vector polylinker) linearized DNA fragment was used for electroporation into targeted ES cells. Electroporation and selection for Slco-recombinant ES cells. 9/Ola-derived E4 embryonic stem (ES) cells were cultured as described before (Mol Cell Biol : (00)). Electroporation with linearized DNA of Slcob and Slcoa5 targeting vectors, or with circular DNA encoding Cre recombinase/puromycin selection genes, and subsequent selection were performed as described previously (Mol Cell Biol : (00)).
3 PCR and Southern blot analysis of Slco-recombinant ES cells. Correct homologous recombination of the Slcoa5 targeting construct was confirmed by Southern blot analysis. Hybridization of XbaI-digested genomic DNA with the Slcoa5 probe (Figure A) yielded a band of.0 kb and a targeted band of 4.9 kb, and hybridization with the 5 Slcoa5 probe (Figure A) resulted in a band of.0 kb and a targeted band of 5 kb. Absence of additional Slcoa5 targeting construct integrations was confirmed with a neomycin-specific probe. An ES cell clone with correctly inserted loxp-neomycin into Slcoa5, and with the correct karyotype was electroporated with the loxp-hygromycin Slcob targeting construct. Correct homologous recombination of the Slcob targeting construct was confirmed by hybridization with the Slcob probe (Figure A) yielding a band of 8.9 kb and a targeted band of 8. kb, and hybridization with the 5 Slcob probe (Figure A) resulted in a band of 0.9 kb and a targeted band of 9. kb. Absence of additional Slcob targeting construct integrations was confirmed with a hygromycin-specific probe. Clones with correctly integrated loxp sites at both flanks of the cluster were cotransfected with Pgk-Cre recombinase and Pgkpuromycin expression plasmids in order to excise the cluster. After selection with puromycin, surviving ES cell clones were screened for correct Cre recombinase-mediated excision of the Slcoa/b cluster by PCR, using primers at the Slcob flank (5 -GCATTCTTGGCACTTGCC- ) and at the Slcoa5 flank (5 -CAGCACTTGTCCTGCAGG- ). Generation of mice. Chimeric mice were generated by micro-injection of independently targeted ES clones with the Slcoa/b cluster deleted (and with correct karyotype) into blastocysts derived from C57BL/6J mice. Subsequently, these blastocysts were implanted into the oviducts of pseudopregnant F fosters (C57BL/6J), which carried them to term. Crossbreeding of resulting mice yielded independent mouse lines. PCR analysis of mice. founder lines were detected by PCR. DNA was extracted from ear snips or tail tips of mice. Forward 5 -GCATTCTTGGCACTTGCC- (F) and reverse 5 -CAGCACTTGTCCTGCAGG- (R) specific primers were used for the detection of the Slcoa/b-deleted cluster allele, which resulted in a 88-bp band (Figure A). For the detection of the cluster allele, forward 5 -GCATAATGCAGGACATGAGG- (F) and reverse 5 -CAGCACTTGTCCTGCAGG- (R) specific primers were used, yielding a 54- bp band (Figure A). Southern blot analysis of mice. Slcoa* and Slcob probes to demonstrate absence of Slcoa/b genes in mice by Southern blot analysis were generated by PCR from liver cdna. Primers used for this PCR reaction were 5 -CCTCATTTCCTCATGGGC-
4 (forward) and 5 -GGATGCTGGTCAGGATATTC- (reverse) for Slcoa* and 5 - CCTGACTGGTTTTCTATGG- (forward) and 5 -CTATGTGAGAGTCCACTGGG- (reverse) for the Slcob probe. Sequences of these probes were verified and revealed sequence identity of the Slcoa* probe with Slcoa genes (and not with Slcob, -c or -b) and of the Slcob probe with Slcob (and not with Slcoa, -c or -b). Genomic DNA from tail tips of founders was digested with Asp78 and probed with either Slcoa* or Slcob probe. Detection of BMG, BDG, and UCB in plasma and urine. The protocol was adapted from the method described by Spivak and Carey (Biochem J 5: (985)). In brief, urine and plasma samples were deproteinized with volumes of MeOH after the addition of KOH (final concentration 5 µm). Following centrifugation for minutes at 4000 rpm, the supernatant was injected. 00 µl was applied to a Pursuit C8, 5 µm, 0 cm HPLC column (Varian, Middelburg, The Netherlands). Starting eluent consisted of 50% MeOH/ 50% ammonium acetate (%, ph 4.5), followed by a linear gradient to 00% MeOH in 0 minutes. BDG, BMG and UCB eluted from the column at retention times of 8, and min, respectively. Detection of bilirubin was performed at 450 nm. Quantification of BDG, BMG and UCB was done by using a calibration curve of UCB. Determination of total bile acid pool. To determine the total bile acid pool, the protocol described by Pawlikowska et al (Hum Mol Genet :88-89 (004)) was slightly adapted. In brief, wildtype and mice were i.v. injected with 0.5 µci [ H]taurocholate and after 5 hours bile was collected for 0 min by gall bladder cannulation. Total radioactivity was analyzed by liquid scintillation counting and total bile acids as described (J Inherit Metab Dis :07-0 (999)). The obtained specific radioactivity was used to calculate the total bile acid pool size from the total radioactivity that was injected.
5 Supplemental data Overview of Ct values of the RT-PCR analysis to investigate expression of several endogenous uptake and efflux transporters in liver, kidney and small intestine of male and mice (n = ; each sample was assayed in duplicate). Part of these data are also shown in Figure C. Analysis of the results was done by comparative Ct method. Quantification of the target cdnas in all samples was normalized against the endogenous control β-actin (Ct target Ct β- actin = Ct). Accordingly, the lower the value, the higher the expression level. Liver Wild-type Slcoa (Oatpa) 0.76 ± ±.65 C Slcoa4 (Oatpa4). ± ±.79 C Slcoa5 (Oatpa5) 5.8 ± ± 0.90 Slcoa6 (Oatpa6) 6.9 ± ± 0.99 Slcob (Oatpb) -9 ± ±.4 C Slcob (Oatpb) 4.46 ± ± 0.50 Slca (Oct).48 ± ± 0.4 Slca (Oct). ±.5.6 ± 0.9 Slca7 (Oat).5 ± ±.9 Slc0a (Ntcp) 0.99 ± ± 0.5 Abcba (Mdra) 0. ± ± 0.5 A Abcbb (Mdrb) 0. ± ±.7 Abcb (Bsep).06 ± ± 0.84 Abcc (Mrp).6 ± ± 0.74 Abcc (Mrp) 7. ± ± 0.5 Abcc4 (Mrp4) 0.9 ± 0.7. ± 0.70 Abcg (Bcrp) 5.8 ± ± 0.78 Aox 6.67 ± ± 0.6 Aox.7 ± ± 0.68 Ugta.49 ± ± 0.5
6 Kidney Wild-type Slcoa (Oatpa).6 ± ±.97 C Slcoa4 (Oatpa4) 0.7 ± 0..9 ±.69 B Slcoa5 (Oatpa5) ± ±.5 Slcoa6 (Oatpa6).0 ± ± 0.87 C Slcob (Oatpb) 4.8 ± ±.59 B Slcob (Oatpb) 7.0 ± ± 0. Slca (Oct).00 ± ± 0.7 Slca (Oct) 4.0 ± ± 0.8 Slca (Oct) 4.4 ± ± 0.64 Slca6 (Oat) 0.94 ± ± 0.8 Slca7 (Oat) 9.0 ± ± 0.86 Slca8 (Oat).90 ± ± 9 Slca9 (Oat5) 6.05 ± ± 0.4 Slca (Urat-).44 ± 0..7 ± 0. Abcba (Mdra) 9.88 ± ± 0. Abcbb (Mdrb) 8. ± ±.8 Abcc (Mrp) 4.8 ± ± 0. Abcc (Mrp).9 ± ± 0.5 Abcc4 (Mrp4) 6.67 ± ± 0.8 Abcg (Bcrp).4 ± ± 0.6 Small intestine Wild-type Slcoa (Oatpa) 7.7 ± ± 0.6 Slcoa4 (Oatpa4) 0.6 ±.56.9 ±.70 B Slcoa5 (Oatpa5) ±.47. ±.70 Slcoa6 (Oatpa6) 8.8 ± ±.6 B Slcob (Oatpb) 5.5 ± ±.57 Slcob (Oatpb) 9.47 ± ± 0. Slc0a (Asbt).9 ±.45.4 ± 0.98 Slca (Oct) 9.5 ± ± 0.67 Slca (Oct) 5.4 ± ± 0.57 Abcba (Mdra) 7.9 ± ± 0. Abcbb (Mdrb) 4.4 ± ± 0.54 Abcc (Mrp) 7.50 ± ± 0. Abcc (Mrp).7 ± ± 0. Abcc4 (Mrp4).4 ± ± 0.6 Abcg (Bcrp) 7.60 ± ± 0.0 Ostα 8.4 ± ±.0 Ostβ 7.6 ± ± 0.79 Note: All data are presented as means ± S.D. (n =, male). A P < 5; B P < ; C P < 0 when compared with.
7 A 4 cholic acid B.5 taurocholic acid * C 0. ursodeoxycholic acid * D 0. tauro-ursodeoxycholic acid 0. E 0. chenodeoxycholic acid F 0. tauro-chenodeoxycholic acid 0. G α-muri-cholic acid H 4 tauro-α-muri-cholic acid 0 - I 5 deoxycholic acid 4 0 Supplemental data. Levels of individual bile acids in plasma of male and mice (A-I). Data are presented as means ± S.D. (n = 5-7; *, P < 5; **, P < ;, P < 0 when compared with ). The logarithm of the data was determined prior to assess the statistical significance of the data by two-sided unpaired Student s t test., lower limit of detection. Detection limit was 0. µm for all bile acids, except for cholic acid and α-muri-cholic acid, for which it was µm.
8 A B Liver MTX (% of dose) Liver [ H]FEX (% of dose) Wild-type * ** ** Time (min) Time (min) Supplemental data 4. Liver accumulation (% of dose) after oral dosing of MTX (0 mg/kg) (A) and [ H]FEX ( mg/kg) (B) to and mice. All data are presented as means ± S.D. (n = 4-8; *, P < 5; **, P < ;, P < 0 when compared with ).
9 Supplemental data 5 Plasma AUCs of MTX and [ H]FEX in the portal vein (AUC PV ) and systemic circulation (AUC SC ) after oral administration of, respectively, MTX (0 mg/kg) and FEX ( mg/kg). MTX [ H]FEX AUC PV AUC SC AUC PV AUC SC (A) Wild-type 49.6 ±. 4.4 ± ± ± (B) 94. ± 4.6 B 54.5 ±.9 A. ± 0. A.90 ± 0. B Difference (B) (A) ~44.5 ~40. ~.0 ~.5 Note: AUCs are represented as min µg/ml. All values represent means ± S.E. (n = 4-8). A P < 5; B P < when compared with.
Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
More informationIntroducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.
Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid
More informationRamp1 EPD0843_4_B11. EUCOMM/KOMP-CSD Knockout-First Genotyping
EUCOMM/KOMP-CSD Knockout-First Genotyping Introduction The majority of animals produced from the EUCOMM/KOMP-CSD ES cell resource contain the Knockout-First-Reporter Tagged Insertion allele. As well as
More informationUsp14 EPD0582_2_G09. EUCOMM/KOMP-CSD Knockout-First Genotyping
EUCOMM/KOMP-CSD Knockout-First Genotyping Introduction The majority of animals produced from the EUCOMM/KOMP-CSD ES cell resource contain the Knockout-First-Reporter Tagged Insertion allele. As well as
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10163 Supplementary Table 1 Efficiency of vector construction. Process wells recovered efficiency (%) Recombineering* 480 461 96 Intermediate plasmids 461 381 83 Recombineering efficiency
More informationGenetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms
Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination
More information64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl
Number of DOTA per antibody The average number of DOTA chelators per antibody was measured using a reported procedure with modifications (1,2). Briefly, nonradioactive CuCl 2 (80-fold excess of DOTA antibodies)
More informationSupplemental Materials and Methods
Supplemental Materials and Methods Proteins and reagents Proteins were purified as described previously: RecA, RecQ, and SSB proteins (Harmon and Kowalczykowski 1998); RecF protein (Morimatsu and Kowalczykowski
More informationThe Use of Genetically-Modified Mouse Models to Study the Actin Cytoskeleton
The Use of Genetically-Modified Mouse Models to Study the Actin Cytoskeleton Anthony Kee (PhD) Cellular and Genetic Medicine Unit School of Medical Sciences (a.kee@unsw.edu.au) 2017 Structure of the Prac
More informationSupplementary Figure 1
Supplementary Figure 1 Ex2 promotor region Cre IRES cherry pa Ex4 Ex5 Ex1 untranslated Ex3 Ex5 untranslated EYFP pa Rosa26 STOP loxp loxp Cre recombinase EYFP pa Rosa26 loxp 1 kb Interleukin-9 fate reporter
More informationTRANSGENIC TECHNOLOGIES: Gene-targeting
TRANSGENIC TECHNOLOGIES: Gene-targeting Reverse Genetics Wild-type Bmp7 -/- Forward Genetics Phenotype Gene or Mutations First Molecular Analysis Second Reverse Genetics Gene Phenotype or Molecular Analysis
More informationFatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationHigh Pure PCR Template Preparation Kit for preparation of 100 nucleic acid samples Cat. No
for preparation of 100 nucleic acid samples Cat. No. 1 796 88 Principle Cells are lysed during a short incubation with Proteinase K in the presence of a chaotropic salt (guanidine HCl), which immediately
More informationSupplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans
Supplemental Materials Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Madhusudhan Budatha, Shayzreen Roshanravan, Qian Zheng, Cecilia Weislander, Shelby L. Chapman,
More informationTheoretical cloning project
Theoretical cloning project Needed to get credits Make it up yourself, don't copy Possible to do in groups of 2-4 students If you need help or an idea, ask! If you have no idea what to clone, I can give
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationMouse Engineering Technology. Musculoskeletal Research Center 2016 Summer Educational Series David M. Ornitz Department of Developmental Biology
Mouse Engineering Technology Musculoskeletal Research Center 2016 Summer Educational Series David M. Ornitz Department of Developmental Biology Core service and new technologies Mouse ES core Discussions
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationTITLE: Mammary Specific Expression of Cre Recombinase Under the Control of an Endogenous MMTV LTR: A Conditional Knock-out System
AD Award Number: DAMD17-98-1-8233 TITLE: Mammary Specific Expression of Cre Recombinase Under the Control of an Endogenous MMTV LTR: A Conditional Knock-out System PRINCIPAL INVESTIGATOR: Rama Kudaravalli,
More informationMaterials and Methods
Materials and Methods Construction of noxa / mice and genotyping The targeting vector (see Fig. S) was prepared from a C57BL/6 DNA λ phage library (Stratagene) by replacing a 2.7 kb region encompassing
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationM Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour
Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries
More informationQuantitative Real Time PCR USING SYBR GREEN
Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to
More informationSupplementary Materials
Supplementary Materials Construction of Synthetic Nucleoli in Human Cells Reveals How a Major Functional Nuclear Domain is Formed and Propagated Through Cell Divisision Authors: Alice Grob, Christine Colleran
More informationQuantification of ADME Proteins: An Inter-laboratory Comparison
Quantification of ADME Proteins: An Inter-laboratory Comparison Christine Wegler Department of Pharmacy, Uppsala University Cardiovascular Metabolic Diseases DMPK, AstraZeneca R&D, Mölndal, Sweden Outline
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationRoche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
More informationPrimePCR Assay Validation Report
Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha
More informationBacterial DNA replication
Bacterial DNA replication Summary: What problems do these proteins solve? Tyr OH attacks PO4 and forms a covalent intermediate Structural changes in the protein open the gap by 20 Å! 1 Summary: What problems
More informationRoche Molecular Biochemicals Technical Note No. LC 9/2000
Roche Molecular Biochemicals Technical Note No. LC 9/2000 LightCycler Optimization Strategy Introduction Purpose of this Note Table of Contents The LightCycler system provides different detection formats
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationPureSpin DNA Clean Up Kit
PureSpin DNA Clean Up Kit Micro Columns INSTRUCTION MANUAL KIT COMPONENTS For Research Use Only PureSpin DNA Clean Up Kit, Micro Columns w/out Caps (Kit Size) OD2080 (50 Preps.) OD2080-2 (200 Preps.) Storage
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationChapter 3. Enzyme manipulation of DNA and RNA
Chapter 3 Enzyme manipulation of DNA and RNA To measure incorporation of radioactivity (to see if the probe is good or not for hybridization) Acid precipitation method: - Add sonicated salmon sperm DNA
More informationMRC-Holland MLPA. Description version 12; 27 November 2015
SALSA MLPA probemix P079-A3 OTC Lot A3-1015. As compared to previous version (lot A2-0211), 5 reference probes have been replaced. Also, 8 reference probes and the TSPAN7 flanking probe have been removed.
More informationSupporting Information
Supporting Information Wiley-VCH 26 69451 Weinheim, Germany A new homogenous assay for studying mira maturation Brian Patrick Davies and Christoph Arenz General Information For MALDI-TF measurements a
More informationReverTra Ace qpcr RT Master Mix
Instruction manual ReverTra Ace qpcr RT Master Mix 1203 F1173K ReverTra Ace qpcr RT Master Mix FSQ-201 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Protocol 1. RNA template
More informationGuide-it Indel Identification Kit User Manual
Clontech Laboratories, Inc. Guide-it Indel Identification Kit User Manual Cat. No. 631444 (120114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA
More informationConstruction of plant complementation vector and generation of transgenic plants
MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological
More informationTransfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
More informationDNA isolation from tissue DNA isolation from eukaryotic cells (max. 5 x 106 cells) DNA isolation from paraffin embedded tissue
INDEX KIT COMPONENTS 3 STORAGE AND STABILITY 3 BINDING CAPACITY 3 INTRODUCTION 3 IMPORTANT NOTES 4 EUROGOLD TISSUE DNA MINI KIT PROTOCOLS 5 A. DNA isolation from tissue 5 B. DNA isolation from eukaryotic
More informationProtocols for cloning SEC-based repair templates using SapTrap assembly
Protocols for cloning SEC-based repair templates using SapTrap assembly Written by Dan Dickinson (ddickins@live.unc.edu) and last updated July 2016. Overview SapTrap (Schwartz and Jorgensen, 2016) is a
More informationColor-Switch CRE recombinase stable cell line
Color-Switch CRE recombinase stable cell line Catalog Number Product Name / Description Amount SC018-Bsd CRE reporter cell line (Bsd): HEK293-loxP-GFP- RFP (Bsd). RFP" cassette with blasticidin antibiotic
More informationFOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.
Instruction manual RNA-direct SYBR Green Realtime PCR Master Mix 0810 F0930K RNA-direct SYBR Green Realtime PCR Master Mix Contents QRT-201T QRT-201 0.5mLx2 0.5mLx5 Store at -20 C, protected from light
More informationRecombinant DNA Technology
Recombinant DNA Technology Common General Cloning Strategy Target DNA from donor organism extracted, cut with restriction endonuclease and ligated into a cloning vector cut with compatible restriction
More informationSupplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-
#1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/317/5837/477/dc1 Supporting Online Material for AAV Vector Integration Sites in Mouse Hepatocellular Carcinoma Anthony Donsante, Daniel G. Miller, Yi Li, Carole Vogler,
More informationCRISPR/Cas9 Mouse Production
CRISPR/Cas9 Mouse Production Emory Transgenic and Gene Targeting Core http://cores.emory.edu/tmc Tamara Caspary, Ph.D. Scientific Director Teresa Quackenbush --- Lab Operations and Communications Coordinator
More informationGel Extraction Mini Spin Column Kit. UltraPrep Gel-Ex. Purification of DNA fragments and plasmids from agarose gels
Gel Extraction Mini Spin Column Kit UltraPrep Gel-Ex Purification of DNA fragments and plasmids from agarose gels 2006 Molzym, all rights reserved 1 UltraPrep Gel-Ex Manual 01/2006 Contents Kit contents
More informationSupplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl
Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl, loxp sites flanking exons 3-6 (red arrowheads) were introduced into
More informationSupporting Online Material, Matsumoto et al.
Supporting Online Material, Matsumoto et al. Material and Methods Library. Poly(A) + mrna was purified from RAW264.7 cells stimulated with murine IFN-γ (100 units/ml) and bacterial LPS (100 ng/ml) for
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationSupplementary Figure 1. Isolation of GFPHigh cells.
Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding
More informationE.Z.N.A. MicroElute Genomic DNA Kit. D preps D preps D preps
E.Z.N.A. MicroElute Genomic DNA Kit D3096-00 5 preps D3096-01 50 preps D3096-02 200 preps December 2013 E.Z.N.A. MicroElute Genomic DNA Kit Table of Contents Introduction...2 Kit Contents/Storage and Stability...3
More informationCRISPR/Cas9 Genome Editing: Transfection Methods
CRISPR/ Genome Editing: Transfection Methods For over 20 years Mirus Bio has developed and manufactured high performance transfection products and technologies. That expertise is now being applied to the
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template
Catalog # Description 172-5085 SingleShot SYBR Green Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot SYBR Green Kit prepares genomic DNA (gdna) free RNA directly from
More informationExtensive phenotypic characterization of a new transgenic. mouse reveals pleiotropic perturbations in physiology due to
Extensive phenotypic characterization of a new transgenic mouse reveals pleiotropic perturbations in physiology due to mesenchymal hgh minigene expression. Aimilios Kaklamanos 1,+, Jan Rozman 4,5,+, Manolis
More informationPrimePCR Assay Validation Report
Gene Information Gene Name laminin, beta 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID LAMB3 Human The product encoded by this gene is a laminin that
More informationGenomes summary. Bacterial genome sizes
Genomes summary 1. >930 bacterial genomes sequenced. 2. Circular. Genes densely packed. 3. 2-10 Mbases, 470-7,000 genes 4. Genomes of >200 eukaryotes (45 higher ) sequenced. 5. Linear chromosomes 6. On
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*
More informationSupplemental Data. Lee et al. Plant Cell. (2010) /tpc Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2.
Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2. (A) Protein structures of DWA1 and DWA2. WD40 region was determined based on the NCBI conserved domain databases (B, C) Schematic representation
More informationTECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits
In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits Catalog Numbers APPA001 In Vitro Bacterial Split GFP "Fold 'n' Glow" Solubility Assay Kit (Green) APPA008 In Vitro Bacterial
More informationPrimePCR Assay Validation Report
Gene Information Gene Name SRY (sex determining region Y)-box 6 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SOX6 Human This gene encodes a member of the
More informationBiotech Applications Nucleic acid therapeutics, Antibiotics, Transgenics. BIT 220 End of Chapter 22 (Snustad/Simmons)
Biotech Applications Nucleic acid therapeutics, Antibiotics, Transgenics BIT 220 End of Chapter 22 (Snustad/Simmons) Nucleic Acids as Therapeutic Agents Many diseases (cancer, inflammatory diseases) from
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationAmpliScribe T 7 Aminoallyl-RNA Transcription Kit
Cat. No. AA50125 The AmpliScribe T7 Aminoallyl-RNA Transcription Kit enables high-yield production of aminoallyl-labeled RNA. The kit utilizes Epicentre s high yielding AmpliScribe T7-Flash in vitro transcription
More informationIn Situ Hybridization
In Situ Hybridization Modified from C. Henry, M. Halpern and Thisse labs April 17, 2013 Table of Contents Reagents... 2 AP Buffer... 2 Developing Solution... 2 Hybridization buffer... 2 PBT... 2 PI Buffer
More informationChapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
More informationIsolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
More informationBrdU IHC Kit. For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells
K-ASSAY BrdU IHC Kit For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells Cat. No. KT-077 For Research Use Only. Not for Use in
More informationCold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual
Fusion Cloning technology Cold Fusion Cloning Kit Store the master mixture and positive controls at -20 C Store the competent cells at -80 C. (ver. 120909) A limited-use label license covers this product.
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationSupplementary Fig. 1. Characteristics of transcription elongation by YonO. a. YonO forms a saltstable EC. Immobilized ECs were washed with
Supplementary Fig. 1. Characteristics of transcription elongation by YonO. a. YonO forms a saltstable EC. Immobilized ECs were washed with transcription buffer with or without a high salt concentration
More informationLearning Objectives :
Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in
More informationMir-X mirna First-Strand Synthesis and SYBR qrt-pcr
User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,
More informationSuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes
WHITE PAPER SuperScript IV Reverse Transcriptase SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes Abstract Reverse transcriptases (RTs) from avian myeloblastosis virus
More informationmab Titer Analysis with the Agilent Bio-Monolith Protein A Column
mab Titer Analysis with the Agilent Bio-Monolith Protein A Column Application Note Biopharmaceuticals and Biosimilars Authors Emmie Dumont, Isabel Vandenheede, Pat Sandra, and Koen Sandra Research Institute
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationGenome editing. Knock-ins
Genome editing Knock-ins Experiment design? Should we even do it? In mouse or rat, the HR-mediated knock-in of homologous fragments derived from a donor vector functions well. However, HR-dependent knock-in
More information7 Gene Isolation and Analysis of Multiple
Genetic Techniques for Biological Research Corinne A. Michels Copyright q 2002 John Wiley & Sons, Ltd ISBNs: 0-471-89921-6 (Hardback); 0-470-84662-3 (Electronic) 7 Gene Isolation and Analysis of Multiple
More informationBiology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.
Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After
More informationE.Z.N.A. Tissue DNA Kit. D preps D preps D preps
E.Z.N.A. Tissue DNA Kit D3396-00 5 preps D3396-01 50 preps D3396-02 200 preps August 2016 E.Z.N.A. Tissue DNA Kit Table of Contents Introduction and Overview...2 Yield and Quality of DNA...3 Illustrated
More informationSUPPLEMENTARY MATERIAL AND METHODS
SUPPLEMENTARY MATERIAL AND METHODS Amplification of HEV ORF1, ORF2 and ORF3 genome regions Total RNA was extracted from 200 µl EDTA plasma using Cobas AmpliPrep total nucleic acid isolation kit (Roche,
More informationSupplementary Material
Supplementary Material Gene Inactivation Study on gntk, a Putative C-methyltransferase Gene in Gentamicin Biosynthesis from Micromonospora echinospora Suman Karki Jin-Yong Kim Si-Hyung Park Hyung-Jin Kwon
More informationBS 50 Genetics and Genomics Week of Nov 29
BS 50 Genetics and Genomics Week of Nov 29 Additional Practice Problems for Section Problem 1. A linear piece of DNA is digested with restriction enzymes EcoRI and HinDIII, and the products are separated
More information2-3. Real-time PCR conditions using Roche LightCycler Nano Real-time PCR conditions using Bio-Rad MiniOpticon
Instruction manual for KOD SYBR qpcr Mix 1305 1236 KOD SYBR qpcr Mix Contents [1] Introduction [2] Components [3] Primer design [4] Template DNA [5] Protocol 1. Reaction mixture set up QKD-201T 1 ml 1
More informationSupplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
More informationPrimePCR Assay Validation Report
Gene Information Gene Name transforming growth factor, beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID TGFB1 Human This gene encodes a member of the
More informationLectures 28 and 29 applications of recombinant technology I. Manipulate gene of interest
Lectures 28 and 29 applications of recombinant technology I. Manipulate gene of interest C A. site-directed mutagenesis A C A T A DNA B. in vitro mutagenesis by PCR T A 1. anneal primer 1 C A 1. fill in
More informationSupplemental Data. Chromosomal Translocation Mechanisms. at Intronic Alu Elements in Mammalian Cells
Supplemental Data Chromosomal Translocation Mechanisms at Intronic Alu Elements in Mammalian Cells Beth Elliott, Christine Richardson, and Maria Jasin Supplemental Experimental Procedures DNA manipulations
More informationConcepts: What are RFLPs and how do they act like genetic marker loci?
Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th
More informationPrime-It II Random Primer Labeling Kit
Prime-It II Random Primer Labeling Kit Instruction Manual Catalog #300385 Revision C0 For Research Use Only. Not for use in diagnostic procedures. 300385-12 LIMITED PRODUCT WARRANTY This warranty limits
More information