Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl
|
|
|
- Jessie Roberts
- 6 years ago
- Views:
Transcription
1 Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl, loxp sites flanking exons 3-6 (red arrowheads) were introduced into Pax6 locus by homologous recombination in embryonic stem cells. The paired domain of Pax6 is encoded by exons 5, 5a, 6 and 7. Blue arrowheads represent positions of loxp sites in Pax6 fl/fl mice generated previously (Ashery-Padan et al., 2000). Details of gene targeting are available upon request. (B) To generate mrx-cre, BAC containing 200kb covering the Rx locus was modified by BAC recombineering. The Cre coding region (Cre-pA) was inserted into the Rx translational initiation start site (ATG). Exons are indicated by black boxes. (C) Pax6 fl/fl mice generated in this study were crossed with α-cre to show that amacrine cells are generated in Pax6 fl/fl /α-cre mutants as previously reported (Marquardt et al., 2001). Adult retinal sections were stained with antibodies against amacrine cell markers syntaxin and Vc1.1 (HNK-1 epitope); retinal areas with amacrine cells are indicated with arrowheads. le, lens; ONL, outer nuclear layer; INL, inner nuclear layer; GCL, ganglion cell layer.
2 Supplementary Fig. S2. Apoptosis in Pax6-deficient retina. (A-J) Retinal sections of wild-type (Pax6 fl/fl ) and mutant (Pax6 fl/fl /mrx- Cre) embryos were stained with antibody against cleaved Caspase3 (Cas3) at indicated stages. Retina is indicated with dashed line. (K) Quantification of apoptotic cells determined as proportion of Cas3 + cells versus DAPI + cells in wild-type (wt) and Pax6-deficient (mut) retinae. Error bars indicate s.d. P-values are by Student s t-test.
3 Supplementary Fig. S3. M-phase cell cycle arrest does not contribute to early proliferation phenotype in Pax6-deficient retina. (A) Sections stained with antibody against phosphorylated histone H3 (PH3) at E10.5, E11.5 and E14.5. (B) Quantification of M-phase cells determined as proportion of PH3+ cells versus DAPI+ cells in wild-type (wt) and Pax6-deficient (mut) retinae (indicated with dashed lines). Error bars indicate s.d. P-values are by Student s t-test. le, lens Supplementary Fig. S4. Expression of bhlhb5, Vc1.1 and Crx in Pax6-deficient retina. (A-D) Confocal images showing bhlhb5 (A,B) and Vc1.1 (HNK-1 epitope) (C,D) immunoreactivity in wild-type (Pax6fl/fl) and Pax6-deficient (Pax6fl/fl/mRx-Cre) retina at E15.5. Arrowheads indicate Vc1.1 immunoreactivity in non-retinal tissue (B,C). (E-H) Crx protein expression assessed using Crx/Otx2 antibody at E11.5 (E, F) and E14.5 (G,H). Dashed lines indicate the position of retina. le, lens; GCL, ganglion cell layer; ONL, outer nuclear layer; RPE, retinal pigmented epithelium. Scale bar: 100 µm.
4 Supplementary Fig. S5. Pax6 elimination from early RPCs or OV neuroepithelium interferes with optic cup/lens pit morphogenesis. (A-B ) Transversal sections of E10.5 wild-type (Pax6 fl/fl ) and mutant (Pax6 fl/fl /mrx-cre) eyes of littermate embryos stained with DAPI (grey). Forming lens pit is indicated with dashed line. (C-D ) Section of control (Pax6 Sey/fl ) and mutant (Pax6 Sey/fl / mrx-cre) eyes of littermate embryos at E14.5 stained with hematoxylin-eosin. (E-H ) Sections of control (Pax6 fl/fl ) and mutant (Pax6 fl/ fl /EmRx-Cre) eyes stained with antibody against Pax6 at indicated stages. (H ) Expression of EYFP showing area of Cre-mediated deletion visualized using R-EYFP reporter mouse line. OV, optic vesicle; SE, surface ectoderm; le, lens; re, retina. Scale bar: 100 µm.
5 Supplementary Fig. S6. Wnt/β-catenin inhibitors Sfrp1 and Sfrp2 are downregulated upon OV-specific Pax6 inactivation but Wnt signaling is not responsible for the arrested lens development. (A-F) Sfrp2 (A-C) and Sfrp1 (D-F) mrna expression in control (Pax6 fl and Pax6 Sey/fl ) and mutant (Pax6 Sey/fl /mrx-cre) E11.0 eyes. (G-I) Dkk1 mrna expression at E10.5; eye region indicated with arrowheads. (J,K) Activity of Wnt/β-catenin signaling assessed using a BAT-gal reporter mouse in control (Catnb lox(ex3)/+ ) (J) and retinal mutant (Catnb lox(ex3)/+ /mrx-cre) (K) with activated Wnt/β-catenin pathway in developing neuroretina. Retina is indicated with black dashed line; lens or the corresponding tissue with white dashed line.
6 Table S1. Primary antibodies and RNA probes Primary antibodies Antibody Host Dilution Source Pax6 Rabbit 1:500 Covance (PRP-278P) Sox2 Goat 1:400 Santa-Cruz (sc-17320) cyclin D1 Mouse 1:500 Santa-Cruz (sc-450) p27 Kip1 Mouse 1:1000 BD Biosciences (610241) p57 Kip2 Goat 1:70 Santa-Cruz (sc-1039) Tuj1 Mouse 1:1500 R&D Systems (MAB1199) cleaved caspase 3 Rabbit 1:300 Cell Signaling (D175) PH3 Rabbit 1:1000 Upstate (06-570) Lef1 Rabbit 1:500 Cell Signaling (C12A5) Pcna Mouse 1:3000 Sigma, P8825 Crx/Otx2 Rabbit 1:500 Kind gift from Dr Craft (Zhu and Craft, 2000) Six3 Rabbit 1:2000 Kind gift from Dr P. Bovolenta (unpublished) Otx2 Rabbit 1:300 R&D Systems (BAF1979) Blimp1 Rat 1:300 Santa-Cruz (sc-47732) Rxrγ Rabbit 1:1500 Santa-Cruz (sc-555) Nr2e3 Rabbit 1:100 Kind gift from Dr S. Chen (Chen et al., 2005) bhlhb5 Goat 1:400 Santa-Cruz (sc-6045) Vc1.1 (HNK-1) Mouse 1:100 Sigma (C6680) Lhx2 Goat 1:1000 Santa-Cruz (sc-19344) Hes1 Rabbit 1:1000 Kind gift from Dr N. Brown (Lee et al., 2005) Chx10 Sheep 1:800 Exalpha (X1180P) Foxe3 Rabbit 1:1000 Kind gift from Dr Carlsson (Blixt et al., 2007) Prox1 Rabbit 1:2000 Chemicon (AB5475) BrdU Rat 1:100 Abcam (AB6326) perk1/2 Rabbit 1:3000 Cell Signaling (9101S) psmad1/5 Rabbit 1:2000 Invitrogen (700047) RNA probes Gene Source Neurod1 p57 Kip2 Rx Trβ2 Crx Atoh7 Kindly provided by Dr Brown (Brown et al., 1998) Math3 Kindly provided by Dr Brown (Farah et al., 2000) Mash1 Kindly provided by Dr Brown (Brown et al., 1998) Bmp4 Kindly provided by Dr Hogan (Jones et al., 1991) Bmp7 Kindly provided by Dr Hogan (Lyons et al., 1995) Ngn2 Kindly provided by Dr J. Rubenstein (Sommer et al., 1996) Sfrp1 Kindly provided by Dr S. Pleasure (Rattner et al., 1997) Sfrp2 Kindly provided by Dr S. Pleasure (Rattner et al., 1997) Dkk1 Kindly provided by Dr S. Krauss (Diep et al., 2004)
Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic
GENESDEV/2007/ Supplementary Figure 1 Elkabetz et al.,
GENESDEV/2007/089581 Supplementary Figure 1 Elkabetz et al., GENESDEV/2007/089581 Supplementary Figure 2 Elkabetz et al., GENESDEV/2007/089581 Supplementary Figure 3 Elkabetz et al., GENESDEV/2007/089581
Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice
Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice Belal A. Mohamed, Amal Z. Barakat, Torsten Held, Manar Elkenani, Christian Mühlfeld, Jörg Männer, and Ibrahim M. Adham
Supplementary Table 1. Primary antibodies used in this study.
Supplementary Table 1. Primary antibodies used in this study. Antibodies Mouse monoclonal Antibody(Ab) Working dilution Oct4 1:2 Pax6 1:1 Company Notes 1 Santa Cruz Biotechnology Use only Cy3 2nd antibody
Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics
Int. J. Mol. Sci. 2016, 17, 1259; doi: /ijms
S1 of S5 Supplementary Materials: Fibroblast-Derived Extracellular Matrix Induces Chondrogenic Differentiation in Human Adipose-Derived Mesenchymal Stromal/Stem Cells in Vitro Kevin Dzobo, Taegyn Turnley,
SUPPLEMENTAL INFORMATION
UTX/KDM6A demethylase activity is required for satellite cell-mediated muscle regeneration Hervé Faralli 1,2, Chaochen Wang 3, Kiran Nakka 1,2, Soji Sebastian 1,, Aissa Benyoucef 1,2, Lenan Zhuang 3, Alphonse
Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish
Developmental Cell Supplemental Information A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish Julien Ablain, Ellen M. Durand, Song Yang, Yi Zhou, and Leonard I. Zon % larvae
Confocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
Supplementary Figure 1
Supplementary Figure 1 Ex2 promotor region Cre IRES cherry pa Ex4 Ex5 Ex1 untranslated Ex3 Ex5 untranslated EYFP pa Rosa26 STOP loxp loxp Cre recombinase EYFP pa Rosa26 loxp 1 kb Interleukin-9 fate reporter
Supporting Information
Supporting Information Nowakowski et al. 10.1073/pnas.1219385110 SI Materials and Methods Primary Antibodies. Primary antibodies used in this study were raised against BrdU (rat, 1:50; Abcam), cleaved
Supplemental Material for
Supplemental Material for TXI TELNGIECTSI MUTTED (TM)-MEDITED DN DMGE RESPONSE IN OXIDTIVE STRESS-INDUCED VSCULR ENDOTHELIL CELL SENESCENCE Hong Zhan 1, Toru Suzuki 1,2, Kenichi izawa 1, Kiyoshi Miyagawa,
Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney
1 Supplementary text and data for: 2 3 4 5 Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney Authors: David A. D. Munro 1*, Peter Hohenstein 2, and Jamie A.
Isolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact
To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well
Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at
Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.
Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice
Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans
Supplemental Materials Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Madhusudhan Budatha, Shayzreen Roshanravan, Qian Zheng, Cecilia Weislander, Shelby L. Chapman,
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10163 Supplementary Table 1 Efficiency of vector construction. Process wells recovered efficiency (%) Recombineering* 480 461 96 Intermediate plasmids 461 381 83 Recombineering efficiency
The Use of Genetically-Modified Mouse Models to Study the Actin Cytoskeleton
The Use of Genetically-Modified Mouse Models to Study the Actin Cytoskeleton Anthony Kee (PhD) Cellular and Genetic Medicine Unit School of Medical Sciences (a.kee@unsw.edu.au) 2017 Structure of the Prac
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 PPAR-γ is dispensable for the development of tissue macrophages in the heart, kidneys, lamina propria and white adipose tissue. Plots show the expression of F4/80 and CD11b (a) or
Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons
Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental
Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms
Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination
Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation
Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Shu Liu 1, Zhongwen Xie 2, Qingwei Zhao 2, Huan Pang
Ramp1 EPD0843_4_B11. EUCOMM/KOMP-CSD Knockout-First Genotyping
EUCOMM/KOMP-CSD Knockout-First Genotyping Introduction The majority of animals produced from the EUCOMM/KOMP-CSD ES cell resource contain the Knockout-First-Reporter Tagged Insertion allele. As well as
Usp14 EPD0582_2_G09. EUCOMM/KOMP-CSD Knockout-First Genotyping
EUCOMM/KOMP-CSD Knockout-First Genotyping Introduction The majority of animals produced from the EUCOMM/KOMP-CSD ES cell resource contain the Knockout-First-Reporter Tagged Insertion allele. As well as
Tandem E2F Binding Sites in the Promoter of the p107 Cell Cycle Regulator Control p107 Expression and Its Cellular Functions
Tandem E2F Binding Sites in the Promoter of the p107 Cell Cycle Regulator Control p107 Expression and Its Cellular Functions Deborah L. Burkhart 1,2, Stacey E. Wirt 1,2, Anne-Flore Zmoos 1, Michael S.
Supplementary Information
Supplementary Information Supplementary Figure 1. ZBTB20 expression in the developing DRG. ZBTB20 expression in the developing DRG was detected by immunohistochemistry using anti-zbtb20 antibody 9A10 on
SUPPLEMENTARY INFORMATION. Integrin alpha 11 in regulation of myofibroblasts phenotype: Implication for fibrotic diseases
SUPPLEMENTARY INFORMATION Integrin alpha 11 in regulation of myofibroblasts phenotype: Implication for fibrotic diseases Ruchi Bansal 1, Shigeki Nakagawa 2, Saleh Yazdani 1, Joop van Baarlen 3, Anu Venkatesh
Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
TRANSGENIC TECHNOLOGIES: Gene-targeting
TRANSGENIC TECHNOLOGIES: Gene-targeting Reverse Genetics Wild-type Bmp7 -/- Forward Genetics Phenotype Gene or Mutations First Molecular Analysis Second Reverse Genetics Gene Phenotype or Molecular Analysis
Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.
Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid
Inventory of supplemental Information
Cell Stem Cell, volume 10 Supplemental Information Self-Formation of Optic Cups and Storable Stratified Neural Retina from Human ESCs Tokushige Nakano, Satoshi Ando, Nozomu Takata, Masako Kawada, Keiko
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and
SUPPLEMENTAL MATERIALS
SUPPLEMENL MERILS Eh-seq: RISPR epitope tagging hip-seq of DN-binding proteins Daniel Savic, E. hristopher Partridge, Kimberly M. Newberry, Sophia. Smith, Sarah K. Meadows, rian S. Roberts, Mark Mackiewicz,
Supplementary Figure 1. Isolation of GFPHigh cells.
Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts
Current Biology, Volume 24 Supplemental Information GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts Wei Zhou, Jin Chang, Xin Wang, Masha G. Savelieff, Yinyin Zhao, Shanshan
SOX2 is a dose-dependent regulator of retinal neural progenitor competence
SOX2 is a dose-dependent regulator of retinal neural progenitor competence Olena V. Taranova, 1,3 Scott T. Magness, 1,3 B. Matthew Fagan, 1 Yongqin Wu, 2 Natalie Surzenko, 1 Scott R. Hutton, 1 and Larysa
Ascl2 Acts as an R-spondin/Wnt-Responsive Switch to Control Stemness in Intestinal Crypts
Cell Stem Cell Supplemental Information Ascl2 Acts as an R-spondin/Wnt-Responsive Switch to Control Stemness in Intestinal Crypts Jurian Schuijers, Jan Philipp Junker, Michal Mokry, Pantelis Hatzis, Bon-Kyoung
Intravitreal and sub-retinal injections of plasmid DNA and electroporation in P0 pups
Intravitreal and sub-retinal injections of plasmid DNA and electroporation in P0 pups Protocol modified from: Retinal Gene Delivery by raav and DNA Electroporation, Aditya Venkatesh et all, Current Protocols
over time using live cell microscopy. The time post infection is indicated in the lower left corner.
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Movie 1 Description: Fusion of NBs. BSR cells were infected
by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL
Supplementary Materials and methods Neuronal cultures and transfection The hippocampus was dissected from E8 rat embryos, dissociated, and neurons plated onto glass coverslips coated with poly-ornithine
Alternative Cleavage and Polyadenylation of RNA
Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related
Use of Gene Editing Technologies in Rodents. Carlisle P. Landel, Ph.D.
Use of Gene Editing Technologies in Rodents Carlisle P. Landel, Ph.D. The Mouse as A Model Mammal Small, easy to maintain, fecund Well understood genetics Similarity to humans >90% Availability of inbred
Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on
Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin
Learning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance
Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination.
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Seeds of Col-0 were harvested from plants grown at 16 C, stored for 2 months, imbibed for indicated
Purification Kits. Fast and Convenient PROSEP -A and PROSEP-G Spin Column Kits for Antibody Purification DATA SHEET
 Montage Antibody Purification Kits Fast and Convenient PROSEP -A and PROSEP-G Spin Column Kits for Antibody Purification DATA SHEET Available with immobilized Protein A or Protein G Easy-to-use Antibody
ENCODE DCC Antibody Validation Document
ENCODE DCC Antibody Validation Document Date of Submission 06/15/2012 Name: Trupti Kawli Email: trupti@stanford.edu Lab Snyder Antibody Name: CDP (sc6327) Target: CDP Company/ Source: Santa Cruz Catalog
Figure S1. Purity of primary cultures of renal proximal tubular epithelial culture ascertained by cytokeratin staining.
Supplementary information Supplementary figures Figure S1. Purity of primary cultures of renal proximal tubular epithelial culture ascertained by cytokeratin staining. Figure S2. Induction of Nur77 in
Directed Differentiation of Human Induced Pluripotent Stem Cells. into Fallopian Tube Epithelium
Directed Differentiation of Human Induced Pluripotent Stem Cells into Fallopian Tube Epithelium Nur Yucer 1,2, Marie Holzapfel 2, Tilley Jenkins Vogel 2, Lindsay Lenaeus 1, Loren Ornelas 1, Anna Laury
Kostandin V. Pajcini, Stephane Y. Corbel, Julien Sage, Jason H. Pomerantz, and Helen M. Blau
Cell Stem Cell, Volume 7 Supplemental Information Transient Inactivation of Rb and ARF Yields Regenerative Cells from Postmitotic Mammalian Muscle Kostandin V. Pajcini, Stephane Y. Corbel, Julien Sage,
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
p27 kip1 independently promotes neuronal differentiation and migration in the cerebral cortex
p27 kip1 independently promotes neuronal differentiation and migration in the cerebral cortex Laurent Nguyen, 1 Arnaud Besson, 2 Julian Ik-Tsen Heng, 1 Carol Schuurmans, 3 Lydia Teboul, 1,5 Carlos Parras,
- NaCr. + NaCr. α H3K4me2 α H3K4me3 α H3K9me3 α H3K27me3 α H3K36me3 H3 H2A-2B H4 H3 H2A-2B H4 H3 H2A-2B H4. α Kcr. (rabbit) α Kac.
+ NaCr NaCr + NaCr NaCr Peptides 10ng 50ng 250ng K α Pan (mouse) Pan (mouse) 10ng 50ng 250ng α Pan (rabbit) C 10ng 50ng 250ng α Pan (mouse) 0 1.25 2.5 5 10 20 40 (mm) NaCr 24h α Pan (rabbit) α K4me2 α
Jill M. Lahti, Haimin Li, and Vincent J. Kidd
THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 272, No. 16, Issue of April 18, pp. 10859 10869, 1997 1997 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Elimination of
This Document Contains:
This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular
Regulation of cellular differentiation by tissue specific transcription factor
Regulation of cellular differentiation by tissue specific transcription factor T. Endoh, M. Mie, Y. Yanagida, M. Aizawa, E. Kobatake Department of Biological Information, Graduate School of Bioscience
Multiplex Fluorescence Assays for Adherence Cells without Trypsinization
Multiplex Fluorescence Assays for Adherence Cells without Trypsinization The combination of a bright field and three fluorescent channels allows the Celigo to perform many multiplexed assays. A gating
Differential distribution of vesicle associated membrane protein isoforms in the mouse retina
Received 21 August 2003 Accepted 24 November 2003 Published 11 December 2003 Differential distribution of vesicle associated membrane protein isoforms in the mouse retina David M. Sherry, Meng M. Wang,
Sox2 in the Dermal Papilla Niche Controls Hair Growth by Fine-Tuning BMP Signaling in Differentiating Hair Shaft Progenitors
Article Sox2 in the Dermal Papilla Niche Controls Hair Growth by Fine-Tuning BMP Signaling in Differentiating Hair Shaft Progenitors Carlos Clavel, 1,2 Laura Grisanti, 1,2 Roland Zemla, 1,2 Amelie Rezza,
Tsai et al., Supplemental Tables. Table 1. Female reproductive defects in Hurp -/- mice
Tsai et al., Supplemental Tables Table 1. Female reproductive defects in Hurp -/- mice Parents ( X ) Litter no. Litter size. Offspring no. at weaning +/+ +/- -/- +/- x +/- 23 6.8 ±.93 5 (32%) 73 (46.8%)
Dnmt1-dependent DNA methylation is essential for photoreceptor terminal differentiation and retinal neuron survival
Citation: (2012) 3, e427; doi:10.1038/cddis.2012.165 & 2012 Macmillan Publishers Limited All rights reserved 2041-4889/12 www.nature.com/cddis Dnmt1-dependent DNA methylation is essential for photoreceptor
Supplementary Information. Title BRD3 and BRD4 BET Bromodomain Proteins Differentially Regulate Skeletal Myogenesis
Supplementary Information Title BRD3 and BRD4 BET Bromodomain Proteins Differentially Regulate Skeletal Myogenesis Authors Thomas C. Roberts 1,2, Usue Etxaniz 1, Alessandra Dall Agnese 1, Shwu-Yuan Wu
The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit
Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline
Differential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression September 28, 2006 Chromatin Structure ~140 bp ~60 bp Transcriptional Regulation: 1. Packing prevents access CH 3 2. Acetylation ( C O )
supplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
Supplemental Information Inventory
Cell Stem Cell, Volume 6 Supplemental Information Distinct Hematopoietic Stem Cell Subtypes Are Differentially Regulated by TGF-β1 Grant A. Challen, Nathan C. Boles, Stuart M. Chambers, and Margaret A.
Sox2 Cooperates with Lkb1 Loss in a Mouse Model of Squamous Cell Lung Cancer
Cell Reports, Volume 7 Supplemental Information Sox2 Cooperates with Lkb1 Loss in a Mouse Model of Squamous Cell Lung Cancer Anandaroop Mukhopadhyay, Kristofer C. Berrett, Ushma Kc, Phillip M. Clair, Stelian
SUPPLEMENTARY INFORMATION. Transcriptional output transiently spikes upon mitotic exit
SUPPLEMENTARY INFORMATION Transcriptional output transiently spikes upon mitotic exit Viola Vaňková Hausnerová 1, 2, Christian Lanctôt 1* 1 BIOCEV and Department of Cell Biology, Faculty of Science, Charles
Sox2, Tlx, Gli3, and Her9 converge on Rx2 to define retinal stem cells in vivo
rticle Sox2, Tlx, Gli3, and Her9 converge on Rx2 to define retinal stem cells in vivo Robert Reinhardt 1,,, Lázaro Centanin 1,*,, Tinatini Tavhelidse 1, Daigo Inoue 1, Beate Wittbrodt 1, Jean-Paul Concordet
A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Journal of Plant Research A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana Linna Leng 1 Qianqian Liang
Exam 1 ID#: June 29, 2009
Biology 4361 Name: KEY Exam 1 ID#: June 29, 2009 Multiple choice (one point each; indicate the best answer) 1. According to von Baer s laws, developing embryos a. pass through the adult stages of lower
Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor
Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor Nicholas Love 11/28/01 A. What is p21? Introduction - p21 is a gene found on chromosome 6 at 6p21.2 - this gene
5 ZFHD sites in variable distances to transcription start site (Fig. S2) pmrlucf luciferase reniformis for Gal4 yeast pmrlucfpa 12Galn
protein origin reference region (aa) construct comment Gal4 yeast -47 pmcgal4-47 pmcrluc-gal4-65 fusion of Rluc, Gal4(-47) and AD of artificial (0) pmczf s fused C-terminally to with 3x myc linker (EQKLISEEDLNG)
Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer
Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling
Trasposable elements: Uses of P elements Problem set B at the end
Trasposable elements: Uses of P elements Problem set B at the end P-elements have revolutionized the way Drosophila geneticists conduct their research. Here, we will discuss just a few of the approaches
7.06 Cell Biology EXAM #2 March 20, 2003
7.06 Cell Biology EXAM #2 March 20, 2003 This is an open book exam, and you are allowed access to books, a calculator, and notes but not computers or any other types of electronic devices. Please write
Differential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression June 19, 2008 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:
Genome research in eukaryotes
Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics
The Effects of Scaffold Rigidity on Retinal Pigment Epithelial Cells. Corina White Symposium on Biomaterials Science 24 October 2016
The Effects of Scaffold Rigidity on Retinal Pigment Epithelial Cells Corina White Symposium on Biomaterials Science 24 October 2016 Background Physiology The retina is the light-responsive tissue layer
Heme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive
Supplemental Data Heme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive gene-2 Caiyong Chen 1, Tamika K. Samuel 1, Michael Krause 2, Harry A. Dailey 3, and Iqbal
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/157/ra4/dc1 Supplementary Materials for Genome-Wide RNAi Screen Reveals Disease-Associated Genes That Are Common to Hedgehog and Wnt Signaling Leni S. Jacob,
Construction of plant complementation vector and generation of transgenic plants
MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological
7.22 Example Problems for Exam 1 The exam will be of this format. It will consist of 2-3 sets scenarios.
Massachusetts Institute of Technology Department of Biology 7.22, Fall 2005 - Developmental Biology Instructors: Professor Hazel Sive, Professor Martha Constantine-Paton 1 of 10 7.22 Fall 2005 sample exam
Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis
CORRECTION Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis Tokameh Mahmoudi, Sylvia F. Boj, Pantelis Hatzis, Vivian S. W. Li,
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC
Solution Key Problem Set
Solution Key- 7.013 Problem Set 5-2013 Question 1 During a summer hike you suddenly spot a huge grizzly bear. This emergency situation triggers a fight or flight response through a signaling pathway as
Nature Methods: doi: /nmeth Supplementary Figure 1. Retention of RNA with LabelX.
Supplementary Figure 1 Retention of RNA with LabelX. (a) Epi-fluorescence image of single molecule FISH (smfish) against GAPDH on HeLa cells expanded without LabelX treatment. (b) Epi-fluorescence image
7 Gene Isolation and Analysis of Multiple
Genetic Techniques for Biological Research Corinne A. Michels Copyright q 2002 John Wiley & Sons, Ltd ISBNs: 0-471-89921-6 (Hardback); 0-470-84662-3 (Electronic) 7 Gene Isolation and Analysis of Multiple
Phospho-Specific Antibodies for Stem Cell Signaling...
Phospho-Specific Antibodies for Stem Cell Signaling. from Cell Signaling Technology Monitor the major signaling pathways in pluripotent and adult stem cells using phospho-specific antibodies from Cell
NAME TA SEC Problem Set 4 FRIDAY October 15, Answers to this problem set must be inserted into the box outside
MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel NAME TA SEC 7.012 Problem Set 4 FRIDAY October 15,