Curriculum Vitae. Personal information. Federico Gulluni. Work experience. Education and training. First name / Surname
|
|
- Iris Fisher
- 6 years ago
- Views:
Transcription
1 Curriculum Vitae Personal information First name / Surname Telephone Fax federico.gulluni@unito.it (professional) Nationality Italian Date of birth 06/02/1988 Gender Male Work experience Dates January 2017 present Post Doctoral Fellow AIRC/FIRC Study of the role of PtdIns(3,4)P2 and PI3K-C2α in breast cancer. Dates January 2013 January 2017 PhD student in Molecular Medicine Characterization of a Phosphoinositide 3-kinase Class II alpha (PI3KC2α) function in cell proliferation and tumors. Education and training Dates December 2009 December 2012 Undergraduate student Characterization of a Phosphoinositide 3-kinase Class II alpha (PI3KC2α) knock-out mouse model. Dates April December 2009 Undergraduate student Generation of monoclonal antibodies that block the activity of Hepatocyte Growth Factor and of Met receptor in tumor cells. Institute for Cancer Research and Treatment, Division of Experimental Therapy, University of Torino, Italy Research Institution Dates Page 1 / 5 - Curriculum vitae of
2 Title of qualification awarded PhD student at Doctoral School of Molecular Medicine. University of Torino, Torino (Italy) Title of qualification awarded Principal subjects / occupational skills covered Dates Master degree in Molecular Biotechnology (Final Mark: 110/110 Lode, Menzione e Dignità di Stampa) Research on the thesis: "Characterization of a Phosphoinositide 3-kinase Class II alpha (PIK3C2α) knock-out mouse model" Faculty of Biotechnology, Dates Title of qualification awarded Bachelor degree in Molecular Biotechnology (Final Mark: 109/110) Principal subjects / occupational skills covered Thesis: "Phosphatidylinositol 3 phosphate (PI3P) is a key player in regulating vesicular trafficking during mitosis" Faculty of Biotechnology, University of Torino, Italy Personal skills and Mother tongue(s) Italian Other language(s) Self-assessment Understanding Speaking W r i t i n g European level (*) Listening Reading Spoken interaction Spoken production English C1 Proficient user C1 Proficient user C1 Proficient user C1 Proficient user B2 Proficient user (*) Common European Framework of Reference (CEF) level Social skills and Organizational skills, determination, self-motivated (well able to work in group but also independently) and punctual hard worker. Organisational skills and Sense of organization and capability of completing tasks within deadlines. I am able to find easy solutions to technical and experimental problems. Technical skills and DNA clonig Genotypic characterization of transgenic animals Protein analysis Cell biology Immunological techniques Page 2 / 5 - Curriculum vitae of Use of plasmid vectors, restriction and modification enzymes, bacteria. Genomic and plasmid DNA preparation, site-directed mutagenesis. Genomic DNA extraction from animal tissues and cultured cells, PCR. Protein manipulation (extraction, SDS-Page electrophoresis, Western-Blotting), in vitro translation, histological, histochemical and immunohistochemichal techniques. Cell culture (immortalized and primary cultures from animal organs and embyos including MEFs derived from 7.5 to 13.5 embryos and T-cells), cell transfection (including MEFs transfection), FACS analysis, protein, DNA and RNA extraction. ELISA immunoassay, immunoprecipitation and co-immunoprecipitation of proteins,
3 immunofluorescence and fluorescence microscopy (in live and fixed cells). Other Computer skills and Mice breeding and manipulation (including SPF mice manipulation), surgical treatments on mice. Apotome and confocal microscopy. Good knowledge of Imaris, Axio Vison and NIS software (elaboration of immnofluoresce acquisitions). Good knowledge of graphic design application (Corel Draw, Adobe Photoshop, Adobe illustrator) and of statistical analysis software (GraphPad Prism). Good knowledge of MacOS, of Microsoft products (Windows XP-Vista-7, Office) and related software, and internet. Page 3 / 5 - Curriculum vitae of
4 Publications 1. Targeting PI3K in cancer: any good news? Martini M *, Ciraolo E *, Gulluni F *, Hirsch E. Frontieres in Oncology May 8;3:108. doi: Spatiotemporal Control of Endocytosis by Phosphatidylinositol 3,4-Bisphosphate. Posor Y, Eichhorn-Gruenig M*, Puchkov D*, Schöneberg J*, Ullrich A*, Lampe A, Müller R, Zarbakhsh S, Gulluni F, Hirsch E, Krauss M, Schultz C, Schmoranzer J, Noé F, Haucke V. Nature July , doi: /nature PI3K class II α controls spatially restricted endosomal PtdIns3P and Rab11 activation to promote primary cilium function. Franco I*, Gulluni F*, Campa CC*, Costa C*, Margaria JP, Ciraolo E, Martini M, Monteyne D, De Luca E, Germena G, Posor Y, Maffucci T, Marengo S, Haucke V, Falasca M, Perez-Morga D, Boletta A, Merlo GR, Hirsch E. Developmental Cell Mar 31;28(6): PI3K/AKT signaling pathway and cancer: an updated review. Martini M, De Santis MC, Braccini L, Gulluni F, Hirsch E. Annals of Medicine Jun 5: Methods to Measure the Enzymatic Activity of PI3Ks. Ciraolo E*, Gulluni F*, Hirsch E, Methdos in Enzymology. 2014;543: In Vivo Role of INPP4B in Tumor and Metastasis Suppression through Regulation of PI3K-AKT Signaling at Endosomes. Li Chew C, Lunardi A *, Gulluni F *, Ruan DT, Chen M, Salmena L, Nishino M, Papa A, Ng C, Fung J, Clohessy JG, Sasaki J, Sasaki T, Bronson RT, Hirsch E, Pandolfi PP Cancer Discovery Jul;5(7): Phosphoinositide 3-Kinase-C2α Regulates Polycystin-2 Ciliary Entry and Protects against Kidney Cyst Formation. Franco I, Margaria JP, De Santis MC, Ranghino A, Monteyne D, Chiaravalli M, Pema M, Campa CC, Ratto E, Gulluni F, Perez-Morga D, Somlo S, Merlo GR, Boletta A, Hirsch E. J Am Soc Nephrol Apr;27(4): Page 4 / 5 - Curriculum vitae of
5 8. Mitotic spindle assembly and genomic stability in breast cancer require PI3Kfunction. Gulluni F*, Martini M*, De Santis MC, Campa CC, Ghigo A, Margaria JP, Ciraolo E, Franco I, Ala U, Annaratone L, Disalvatore D, Bertalot G, Viale G, Noatynska A, Compagno M, Thelen M, Montemurro F, Meraldi P, Marchiò C, Pece S, Sapino A, Chiarle R, Di Fiore PP and Hirsch E. Nature Medicine, under revision Awards 2009: Mario Negri Foundation study grant. 2011: Mario Negri Foundation study grant. 2012: Mario Negri Foundation study grant. 2013: Mario Negri Foundation study grant. 2013: Optime award, Industrial Union Torino (UIT). 2014: University of Torino: Medal for 2012 Best Thesis Work. Page 5 / 5 - Curriculum vitae of
Europass Curriculum Vitae
Europass Curriculum Vitae Personal information Surname / First name Dal Collo Giada 7, Via Canova, 36010, Velo d Astico (VI), Address Italy Mobile +39 3481525172 E-mail giada.dalcollo@gmail.com Nationality
More informationEuropass Curriculum Vitae
Europass Curriculum Vitae Personal information First name(s) / Surname(s) Grigor Dimitrov Sariiski Address(es) 34, Hristo Kovachev str. 1527, Sofia, Bulgaria Telephone(s) +359 2 877-81-64 Mobile: +359
More informationEuropass Curriculum Vitae
Europass Curriculum Vitae Personal information Surname(s) / First name(s) Address(es) 1 SQUARE GASTON BERTANDEAU 75017 Parigi (Francia) Telephone(s) Mobile: +39 3294436114 +33 0787181174 E-mail marco.carlucciomc@gmail.com
More informationEuropass Curriculum Vitae
Europass Curriculum Vitae Personal information First name(s) / Surname(s) Maria Teresa Amatulli Address(es) via Foresto 4, 10139, Torino, To, Italy (domicile) 24, via N.Stigliano, 75025, Policoro MT, Italy
More informationCurriculum Vitae of PATRIZIA PESSINA
Curriculum Vitae of PATRIZIA PESSINA PERSONAL DETAILS Birth date: 9/12/1980 Place: Milan, Italy Phone number: +34 645442229 E-Mail: patrizia.pessina@upf.edu EDUCATION November 2009: PhD in Translational
More informationCurriculum vitae Europass
Curriculum vitae Europass PERSONAL INFORMATION First name(s) / Surname(s) BACIU Dan-Silviu Address(es) - Mobile 0244401360 Fax(es) 0244575995 E-mail(s) silviu.baciu@conpet.ro Nationality Romanian Date
More informationVir B. Singh, PhD
, PhD Vir.Singh@roswellpark.org vir777@gmail.com Current Position Postdoctoral Research Associate at Department of Molecular and Cellular Biology, Roswell Park Cancer Institute, Buffalo, NY, USA since
More informationSureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
More information2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided.
AP Biology Reading Packet 6- Molecular Genetics Part 2 Name Chapter 19: Eukaryotic Genomes 1. Define the following terms: a. Euchromatin b. Heterochromatin c. Nucleosome 2. Outline the levels of DNA packing
More informationAbderahim Gaceb. Translational Neurology Group, Department of Clinical Sciences, Division of Neurology, Wallenberg Neurocentrum SE Lund Sweden
Abderahim Gaceb Translational Neurology Group, Department of Clinical Sciences, Division of Neurology, Wallenberg Neurocentrum SE-221 84 Lund Sweden Place/date of birth: August 03, 1987 Gender: Male Nationality:
More information240EQ222 - Genetic Engineering
Coordinating unit: Teaching unit: Academic year: Degree: ECTS credits: 2017 295 - EEBE - Barcelona East School of Engineering 713 - EQ - Department of Chemical Engineering MASTER'S DEGREE IN CHEMICAL ENGINEERING
More informationCurriculum Vitae. Mahina Tabassum Mitul. Contact Number:
Curriculum Vitae Mahina Tabassum Mitul Contact Number: 01779010515 E-mail: mahina18@gmail.com Academic Qualification: Degree University/ Board Major/Concentration Passing Year MS University of Dhaka Biochemistry
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationHome address: No.255, Bina dead-end lane, Motahari street, Esfahan, Iran. Postal Code: Telephone No.:
Curriculum vitae: Name: Yahya Khazaie Nationality: Iranian Birth date: 04/30/1975 Birth place: Tehran, Iran Sex: Male Marital status: Married with one kid Name of Spouse: Afagh Nili Name of Daughter: Samin
More informationGeneral Education Learning Outcomes
BOROUGH OF MANHATTAN COMMUNITY COLLEGE City University of New York Department of Science Title of Course: Cell Biology Class hours 3 BIO Section: 260 Lab hours 3 Semester Spring 2018 Credits 4 Schedule:
More informationComparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.
Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. by Altogen Labs, 11200 Manchaca Road, Suite 203 Austin TX 78748 USA Tel. (512) 433-6177
More informationMolecular and Cell Biology (MCB)
Molecular and Cell Biology (MCB) Head of Department: Professor Michael Lynes Department Office: Room 104, Biology/Physics Building For major requirements, see the College of Liberal Arts and Sciences section
More informationHOW TO CREATE AN ENTRY-LEVEL CERTIFICATE FROM CORE BIOSCIENCE SKILL STANDARDS NATIONAL CAREER PATHWAYS NETWORK ANNUAL CONFERENCE
HOW TO CREATE AN ENTRY-LEVEL CERTIFICATE FROM CORE BIOSCIENCE SKILL STANDARDS NATIONAL CAREER PATHWAYS NETWORK ANNUAL CONFERENCE Linnea Fletcher, AC2 Regional Bio-Link Center Jeanette Mowery, Bio-Link,
More informationa Award Number: W81XWH TITLE:
AD Award Number: W81XWH-04-1-0138 TITLE: Imaging Metastatic Prostate Cancer After Genetic Manipulation of Transcriptional Memory Regulators EZH2 and EED PRINCIPAL INVESTIGATOR: Lily Wu, M.D., Ph.D. CONTRACTING
More informationM Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour
Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationJennifer Guerrero 414 Club Drive, Apt. 3. San Antonio, TX. (210) cell. Organization and Location Degree Year
Jennifer Guerrero 414 Club Drive, Apt. 3 78201 (210) 313-0213 cell jenguerrero08@gmail.com EDUCATIONAL BACKGROUND Organization and Location Degree Year The University of Texas at San Antonio M. S. 2011
More informationThe Institute of Microbiology of the Czech Academy of Sciences is looking for. four POSTDOCTORAL FELLOW positions in the fields of:
4 Postdoctoral Fellow positions in microbiology, molecular biology and ecology The Institute of Microbiology of the Czech Academy of Sciences, Prague, Czech Republic The Institute of Microbiology of the
More informationFunctional characterisation
Me Me Ac Ac Functional characterisation How can we know if measured changes in DNA methylation and function (phenotype) and linked, and in what way? DNMT Dianne Ford Professor of Molecular Nutritional
More informationSupplementary Material. TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the. ERK1/2 signaling pathway
Supplementary Material TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the ERK1/2 signaling pathway Cui Zhang 1, Fan-Fan Hong 1, Cui-Cui Wang 1, Liang Li 1, Jian-Ling Chen
More informationEuropass Curriculum Vitae
Europass Curriculum Vitae Personal information First name / Surname Address Telephone Andrea Enria via Giuseppe Gioachino Belli, 00193 Rome, Italy +39 06 47924839 (work) +39 06 43417316 (home) Fax +39
More informationBiotech Applications Nucleic acid therapeutics, Antibiotics, Transgenics. BIT 220 End of Chapter 22 (Snustad/Simmons)
Biotech Applications Nucleic acid therapeutics, Antibiotics, Transgenics BIT 220 End of Chapter 22 (Snustad/Simmons) Nucleic Acids as Therapeutic Agents Many diseases (cancer, inflammatory diseases) from
More information2) Cancer Research UK postdoctoral research fellowship 3) Wellcome Trust Sanger Institute postdoctoral reaeasrch fellowship
Curriculum Vitae: Name THEODOROS G. PETRAKIS Place of birth ATHENS, GREECE Date of birth 14 th October 1974 Nationality Greek Home address Porto Rafth (Perioxh Agias Paraskevis), taxudromikh thurida 1489,
More informationBiology 252 Nucleic Acid Methods
Fall 2015 Biology 252 Nucleic Acid Methods COURSE OUTLINE Prerequisites: One semester of college biology (BIO 101 or BIO 173) and one semester of college English (ENG 111); completion of CHM 111is recommended.
More informationExam MOL3007 Functional Genomics
Faculty of Medicine Department of Cancer Research and Molecular Medicine Exam MOL3007 Functional Genomics Tuesday May 29 th 9.00-13.00 ECTS credits: 7.5 Number of pages (included front-page): 5 Supporting
More informationProteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer.
Proteomics And Cancer Biomarker Discovery Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar Overview Proteomics Cancer Aims Tools Data Base search Challenges Summary 1 Overview
More informationGrade: UCL Grade 7 Salary Range: 34,635-41,864 (including London Allowance)
London Centre for Nanotechnology 17-19 Gordon Street London WC1H 0AH www.london-nano.com Job title: Research associate Job reference number: 1702944 Grade: UCL Grade 7 Salary Range: 34,635-41,864 (including
More informationBIOTECHNOLOGY SYSTEMS CAREER PATHWAY
Plant Systems Te Power, r Structural and T chnical Systems Natural Resource Car Systems eer Pathway A F N R A F N R Agribusiness Systems C A R E E R C O N T E N T C L U S T E R Career Ready Practices Content
More informationCytomics in Action: Cytokine Network Cytometry
Cytomics in Action: Cytokine Network Cytometry Jonni S. Moore, Ph.D. Director, Clinical and Research Flow Cytometry and PathBioResource Associate Professor of Pathology & Laboratory Medicine University
More informationATP APPLICATION. (all materials due July 19, 2010) Name of Student: Pitt Student ID: US Citizen* YES Permanent Registered Alien** YES
ATP APPLICATION (all materials due July 19, 2010) Name of Student: Pitt Student ID: US Citizen* YES Permanent Registered Alien** YES Current PhD Program Current or Proposed Faculty Mentor Student e-mail
More informationCourse Descriptions. BIOL: Biology. MICB: Microbiology. [1]
Course Descriptions BIOL: Biology http://www.calendar.ubc.ca/vancouver/courses.cfm?code=biol [1] BIOL 112 (3) Biology of the Cell The principles of cellular and molecular biology using bacterial and eukaryotic
More informationFatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
More informationCentral University of Rajasthan School of Life Sciences Syllabus for the pre-phd course work for the next academic session
Central University of Rajasthan School of Life Sciences Syllabus for the pre-phd course work for the next academic session PSLS-101 (credit-4) Research methodology with quantitative methods and computer
More informationTHE CELL BIOLOGY BEHIND THE ONCOGENIC PIP3 LIPIDS
WORKSHOPS CURRENT TRENDS IN BIOMEDICINE 2018 SEDE ANTONIO MACHADO BAEZA, SPAIN THE CELL BIOLOGY BEHIND THE ONCOGENIC PIP3 LIPIDS Baeza, Spain 15 th -17 th October 2018 Organized by: Richard A. Anderson
More informationBlue Marble University Biology Course Handbook
Blue Marble University Biology Course Handbook A Summary of Course Descriptions Courses and Content Subject to Change Without Notice BlueMarbleUniversity.com Info@bluemarbleuniversity.com Stem Cell Biology
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationStem Cell Services. Driving Innovation for Stem Cell Researchers
Driving Innovation for Stem Cell Researchers Stem Cell Services Partner with us and have access to the most advanced and comprehensive stem cell services available today. 675 W. Kendall St. Cambridge,
More informationSuggest a technique that could be used to provide molecular evidence that all English Elm trees form a clone. ... [1]
1 Molecular evidence E Ulmus procera, form a genetically isolated clone. English Elms developed from a variety of elm brought to Britain from Rome in the first century A.D. Although English Elm trees make
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationCOMMITTEE FOR VETERINARY MEDICINAL PRODUCTS NOTE FOR GUIDANCE 1 : DNA VACCINES NON-AMPLIFIABLE IN EUKARYOTIC CELLS FOR VETERINARY USE
The European Agency for the Evaluation of Medicinal Products Evaluation of Medicines for Veterinary Use CVMP/IWP/07/98-FINAL COMMITTEE FOR VETERINARY MEDICINAL PRODUCTS NOTE FOR GUIDANCE 1 : DNA VACCINES
More informationPROTEOMICS AND FUNCTIONAL GENOMICS PRESENTATION KIMBERLY DONG
PROTEOMICS AND FUNCTIONAL GENOMICS PRESENTATION KIMBERLY DONG A Lentiviral RNAi Library for Human and Mouse Genes Applied to an Arrayed Viral High-Content Screen Jason Moffat,1,2,4,10 Dorre A. Grueneberg,1,10
More informationCurriculum Vitae. P.O 2455, Riyadh 11451, SAUDI ARABIA
Curriculum Vitae Personal Information: Name: Yahya Bashir Ahmed Elbadawi Mobil: 00249912295947 --- 00966542101049 E-mail: Alzeeem95@yahoo.com Current Address: - King Saud University P.O 2455, Riyadh 11451,
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationHIGH SCHOOL STUDENT SCIENCE WEEK. St. Paul s Hospital Vancouver, BC
HIGH SCHOOL STUDENT SCIENCE WEEK St. Paul s Hospital Vancouver, BC Sponsors 2 AGENDA Location: UBC James Hogg Research Centre (JHRC), St. Paul s Hospital, Room 166 Burrard Building, 1081 Burrard Street,
More informationThe Use of Genetically-Modified Mouse Models to Study the Actin Cytoskeleton
The Use of Genetically-Modified Mouse Models to Study the Actin Cytoskeleton Anthony Kee (PhD) Cellular and Genetic Medicine Unit School of Medical Sciences (a.kee@unsw.edu.au) 2017 Structure of the Prac
More informationCURRICULUM VITAE. Lecturer (Pharmaceutical Chemistry Department, Faculty of Pharmacy, Al- Azhar University, Cairo, Egypt)
CURRICULUM VITAE Farag F. S. Selim, PhD CONTACT DETAILS Name: Farag Farouk Sherbiny Selim Nationality: Egyptian Position: Lecturer (Pharmaceutical Chemistry Department, Faculty of Pharmacy, Al- Azhar University,
More informationCharles Shuler, Ph.D. University of Southern California Los Angeles, California Approved for Public Release; Distribution Unlimited
AD Award Number: DAMD17-01-1-0100 TITLE: Smad-Mediated Signaling During Prostate Growth and Development PRINCIPAL INVESTIGATOR: Charles Shuler, Ph.D. CONTRACTING ORGANIZATION: University of Southern California
More informationATIP Avenir Program 2018 Young group leader
ATIP Avenir Program 2018 Young group leader Important dates - October 17th (4 pm) 2017 : opening of the registrations online - November 23 th 2017: deadline for the online submission, the mailing of the
More informationTheraLin. Universal Tissue Fixative Enabling Molecular Pathology
TheraLin Universal Tissue Fixative Enabling Molecular Pathology TheraLin Universal Tissue Fixative Enabling Molecular Pathology Contents Page # TheraLin Universal Tissue Fixative 3 Introduction 5 Easy
More informationIntestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by. Regulating Occludin
Intestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by Regulating Occludin Chaithanya Chelakkot 1,ǂ, Jaewang Ghim 2,3,ǂ, Nirmal Rajasekaran 4, Jong-Sun Choi 5, Jung-Hwan
More informationLearning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance
Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression
More informationAmoyDx TM PIK3CA Five Mutations Detection Kit
AmoyDx TM PIK3CA Five Mutations Detection Kit Detection of five mutations in PIK3CA gene Instructions For Use Instructions Version: B1.3 Date of Revision: April 2012 Store at -20±2 1/5 Background Phosphatidylinositol
More information24, Bulevar kneza Miloša Novi Sad. February 16, To Whom It May Concern:
24, Bulevar kneza Miloša 21000 Novi Sad February 16, 2007 To Whom It May Concern: I am writing to you regarding the available position of the Translator at your company. I strongly believe that my knowledge,
More informationUNIT 3: GENETICS Chapter 9: Frontiers of Biotechnology
CORNELL NOTES Directions: You must create a minimum of 5 questions in this column per page (average). Use these to study your notes and prepare for tests and quizzes. Notes will be stamped after each assigned
More informationleading the way in research & development
leading the way in research & development people. passion. possibilities. ABBVIE 2 immunology AbbVie Immunology has a demonstrated record of success in identifying and developing both small molecule and
More informationLectures 28 and 29 applications of recombinant technology I. Manipulate gene of interest
Lectures 28 and 29 applications of recombinant technology I. Manipulate gene of interest C A. site-directed mutagenesis A C A T A DNA B. in vitro mutagenesis by PCR T A 1. anneal primer 1 C A 1. fill in
More informationBridging the Gap Between Basic and Clinical Research. Julio E. Celis Danish Cancer Society
Bridging the Gap Between Basic and Clinical Research Julio E. Celis Danish Cancer Society Barriers and Oportunities in Translational Research Promise of the new technologies What is Europe doing? Challenges
More informationMICROBIO, IMMUN, PATHOLOGY-MIP (MIP)
Microbio, Immun, Pathology-MIP (MIP) 1 MICROBIO, IMMUN, PATHOLOGY-MIP (MIP) Courses MIP 101 Introduction to Human Disease (GT-SC2) Credits: 3 (3-0-0) Survey of human systems and diseases. Additional Information:
More informationREQUEST FOR EXPRESSIONS OF INTEREST Individual Consultant. African Development Bank Headquarters-Abidjan (Cote d Ivoire)
REQUEST FOR EXPRESSIONS OF INTEREST Individual Consultant African Development Bank Headquarters-Abidjan (Cote d Ivoire) Avenue Joseph Anoma 01 BP. 1387, Abidjan 01 Cote d Ivoire Email: f.avwontom@afdb.org
More informationGENE CLONING: overview
TMMO504: Laboratory Molecular Tropical Medicine and Genetics GENE CLONING: overview Instructor: Asst.Prof.Dr. Santi Maneewatchararangsri Department of Molecular Tropical Medicine and Genetics, Mahidol
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationLecture 25 (11/15/17)
Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1
More informationImmunological Techniques in Research and Clinical Medicine. Philip L. Cohen, M.D. Chief of Rheumatology, LKSOM 10 March 2016
Immunological Techniques in Research and Clinical Medicine Philip L. Cohen, M.D. Chief of Rheumatology, LKSOM 10 March 2016 Antibodies Remarkable Tools for Research and Diagnosis You can make an antibody
More informationMedical Biotechnology MSc 2011
A. CORE MATERIAL A.1. Foundation modul (25-40) Basic science courses (20-30) Biochemistry 4 2 2 4 Introduction to molecular and cell biology 4 1 3 4 Human Physiology 4 2 2 4 Genetics 4 2 2 4 Biophysics
More informationMathematical modelling in drug discovery
Mathematical modelling in drug discovery Garrit Jentsch Computational Biology, Discovery Sciences, AstraZeneca October 17th, 2012 Who are we? http://www.astrazeneca.co.uk/astrazeneca-in-uk/our-uk-sites/alderley-park
More informationGenetic Basis of Development & Biotechnologies
Genetic Basis of Development & Biotechnologies 1. Steps of embryonic development: cell division, morphogenesis, differentiation Totipotency and pluripotency 2. Plant cloning 3. Animal cloning Reproductive
More informationSample Question Paper Session Class XII Biotechnology (045) Marking Scheme
Sample Question Paper Session 2015-16 Class XII Biotechnology (045) Marking Scheme SECTION-A 1. Methylation Student will add a methyl group to one or two bases within the sequence recognized by enzyme.
More information0. Courses Other Information 1. The Molecules of Life 2. The Origin of Life 3. The Cell an Introduction
0. Courses Other Information 1. The Molecules of Life 2. The Origin of Life 3. The Cell an Introduction Department of Medical Biology Our courses Compulsory course: Cell Biology and Molecular Genetics
More informationFlow CAST : Testing Potency and Efficacy of Inhibitors of PI3K δ, PI3Kγ, BTK and SYK Activity
Flow CAST : Testing Potency and Efficacy of Inhibitors of PI3K δ, PI3Kγ, BTK and SYK Activity Michele Romano, PhD Product Manager Flow CAST is for Research Use Only. Not for use in diagnostic procedures.
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationTitle: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer
Author's response to reviews Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer Authors: Hannah Jörißen (hannah.joerissen@molbiotech.rwth-aachen.de)
More informationCourse Year University/Board Percentage
Vipin Kumar Verma PhD Scholar Department of Zoology Sri Venkateswara College University of Delhi 110021 Vipinkumarverma1@yahoo.com +91-9999976710 +91-9350809400 Personal Male, single, date of birth- 5th
More informationBSc BIOMEDICAL SCIENCE
Overview College of Science Biomedical Science Core March 2017 (1) BSc BIOMEDICAL SCIENCE Biomedical Science Degree 2015 1 College of Science, NUI Galway Fullscreen Next page Overview [60 credits] [60
More informationSmall Interfering RNA s Molecular biology and use in therapy
Small Interfering RNA s Molecular biology and use in therapy Dr Stuart Hamilton - NHMRC Early Career Fellow Serology and Virology Division, SEALS Microbiology, Prince of Wales Hospital; School of Women
More informationincluding, but not limited to:
*This Section is part of the original Request for Proposal # P08 080. The Contractor should provide the following eligible Scientific Biomedical Research Equipment, Reagents & Supplies including, but not
More informationBacterial DNA replication
Bacterial DNA replication Summary: What problems do these proteins solve? Tyr OH attacks PO4 and forms a covalent intermediate Structural changes in the protein open the gap by 20 Å! 1 Summary: What problems
More informationBIOTECHNOLOGY. Course Syllabus. Section A: Engineering Mathematics. Subject Code: BT. Course Structure. Engineering Mathematics. General Biotechnology
BIOTECHNOLOGY Subject Code: BT Course Structure Sections/Units Section A Section B Unit 1 Unit 2 Unit 3 Unit 4 Unit 5 Unit 6 Unit 7 Section C Section D Section E Topics Engineering Mathematics General
More informationBlot: a spot or stain, especially of ink on paper.
Blotting technique Blot: a spot or stain, especially of ink on paper. 2/27 In molecular biology and genetics, a blot is a method of transferring proteins, DNA or RNA, onto a carrier (for example, a nitrocellulose,pvdf
More informationConcepts and Methods in Developmental Biology
Biology 4361 Developmental Biology Concepts and Methods in Developmental Biology June 16, 2009 Conceptual and Methodological Tools Concepts Genomic equivalence Differential gene expression Differentiation/de-differentiation
More informationSPEED UP YOUR TIME TO MARKET
SPEED UP YOUR TIME TO MARKET #Pre-clinical #Biologics #Small molecules Welcome to Accelera. As a Contract Research Organization (CRO) serving since more than 30 years pharmaceutical and biotechnology companies
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationREQUEST FOR EXPRESSIONS OF INTEREST (INDIVIDUAL CONSULTANT) AFRICAN DEVELOPMENT BANK. Industrial and Trade Department (PITD) CCIA Abidjan Plateau
REQUEST FOR EXPRESSIONS OF INTEREST (INDIVIDUAL CONSULTANT) AFRICAN DEVELOPMENT BANK Industrial and Trade Department (PITD) CCIA Abidjan Plateau Title of the assignment: Industrial policy consultant Brief
More informationPCR Arrays. An Advanced Real-time PCR Technology to Empower Your Pathway Analysis
PCR Arrays An Advanced Real-time PCR Technology to Empower Your Pathway Analysis 1 Table of Contents 1. Introduction to the PCR Arrays 2. How PCR Arrays Work 3. Performance Data from PCR Arrays 4. Research
More information1. Introduction. 1 Page 1
1. INTRODUCTION Osteoblast differentiation is the key component of the bone formation, growth and remodeling. During this incompletely understood process a subpopulation of multipotential mesenchymal stem
More informationMolecular Biotechnology Master Degree Program
> APPLIED LIFE SCIENCES MASTER DEGREE PROGRAM: > FULL TIME Molecular Biotechnology Master Degree Program www.fh-campuswien.ac.at MY OCCUPATIONAL FUTURE. Your Career Opportunities BIOTECHNOLOGY IS ONE OF
More informationChapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
More informationNational Unit Specification: general information Biotechnology (Higher) NUMBER DF5J 12 COURSE Biotechnology (Higher)
National Unit Specification: general information NUMBER DF5J 12 COURSE SUMMARY This unit seeks to develop knowledge and understanding, problem solving and practical abilities in the context of biotechnological
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationTranscriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death
SUPPLEMENTAL DATA Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death Huajun Jin 1, Arthi Kanthasamy 1, Vellareddy Anantharam
More informationUpdates to the NIH Guidelines for Research Involving Recombinant DNA Molecules (NIH Guidelines)
Updates to the NIH Guidelines for Research Involving Recombinant DNA Molecules (NIH Guidelines) Jacqueline Corrigan-Curay, J.D. M.D. Acting Director Office of Biotechnology Activities National Institute
More informationSupplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
More informationOverview of Biologics Testing and Evaluation: Regulatory Requirements and Expectations. Audrey Chang, PhD, Senior Director Development Services
Overview of Biologics Testing and Evaluation: Regulatory Requirements and Expectations Audrey Chang, PhD, Senior Director Development Services Definition of Biologics: PHS Act, section 351 Virus, therapeutic
More information2 Gene Technologies in Our Lives
CHAPTER 15 2 Gene Technologies in Our Lives SECTION Gene Technologies and Human Applications KEY IDEAS As you read this section, keep these questions in mind: For what purposes are genes and proteins manipulated?
More information