Curriculum Vitae. Personal information. Federico Gulluni. Work experience. Education and training. First name / Surname

Size: px
Start display at page:

Download "Curriculum Vitae. Personal information. Federico Gulluni. Work experience. Education and training. First name / Surname"

Transcription

1 Curriculum Vitae Personal information First name / Surname Telephone Fax federico.gulluni@unito.it (professional) Nationality Italian Date of birth 06/02/1988 Gender Male Work experience Dates January 2017 present Post Doctoral Fellow AIRC/FIRC Study of the role of PtdIns(3,4)P2 and PI3K-C2α in breast cancer. Dates January 2013 January 2017 PhD student in Molecular Medicine Characterization of a Phosphoinositide 3-kinase Class II alpha (PI3KC2α) function in cell proliferation and tumors. Education and training Dates December 2009 December 2012 Undergraduate student Characterization of a Phosphoinositide 3-kinase Class II alpha (PI3KC2α) knock-out mouse model. Dates April December 2009 Undergraduate student Generation of monoclonal antibodies that block the activity of Hepatocyte Growth Factor and of Met receptor in tumor cells. Institute for Cancer Research and Treatment, Division of Experimental Therapy, University of Torino, Italy Research Institution Dates Page 1 / 5 - Curriculum vitae of

2 Title of qualification awarded PhD student at Doctoral School of Molecular Medicine. University of Torino, Torino (Italy) Title of qualification awarded Principal subjects / occupational skills covered Dates Master degree in Molecular Biotechnology (Final Mark: 110/110 Lode, Menzione e Dignità di Stampa) Research on the thesis: "Characterization of a Phosphoinositide 3-kinase Class II alpha (PIK3C2α) knock-out mouse model" Faculty of Biotechnology, Dates Title of qualification awarded Bachelor degree in Molecular Biotechnology (Final Mark: 109/110) Principal subjects / occupational skills covered Thesis: "Phosphatidylinositol 3 phosphate (PI3P) is a key player in regulating vesicular trafficking during mitosis" Faculty of Biotechnology, University of Torino, Italy Personal skills and Mother tongue(s) Italian Other language(s) Self-assessment Understanding Speaking W r i t i n g European level (*) Listening Reading Spoken interaction Spoken production English C1 Proficient user C1 Proficient user C1 Proficient user C1 Proficient user B2 Proficient user (*) Common European Framework of Reference (CEF) level Social skills and Organizational skills, determination, self-motivated (well able to work in group but also independently) and punctual hard worker. Organisational skills and Sense of organization and capability of completing tasks within deadlines. I am able to find easy solutions to technical and experimental problems. Technical skills and DNA clonig Genotypic characterization of transgenic animals Protein analysis Cell biology Immunological techniques Page 2 / 5 - Curriculum vitae of Use of plasmid vectors, restriction and modification enzymes, bacteria. Genomic and plasmid DNA preparation, site-directed mutagenesis. Genomic DNA extraction from animal tissues and cultured cells, PCR. Protein manipulation (extraction, SDS-Page electrophoresis, Western-Blotting), in vitro translation, histological, histochemical and immunohistochemichal techniques. Cell culture (immortalized and primary cultures from animal organs and embyos including MEFs derived from 7.5 to 13.5 embryos and T-cells), cell transfection (including MEFs transfection), FACS analysis, protein, DNA and RNA extraction. ELISA immunoassay, immunoprecipitation and co-immunoprecipitation of proteins,

3 immunofluorescence and fluorescence microscopy (in live and fixed cells). Other Computer skills and Mice breeding and manipulation (including SPF mice manipulation), surgical treatments on mice. Apotome and confocal microscopy. Good knowledge of Imaris, Axio Vison and NIS software (elaboration of immnofluoresce acquisitions). Good knowledge of graphic design application (Corel Draw, Adobe Photoshop, Adobe illustrator) and of statistical analysis software (GraphPad Prism). Good knowledge of MacOS, of Microsoft products (Windows XP-Vista-7, Office) and related software, and internet. Page 3 / 5 - Curriculum vitae of

4 Publications 1. Targeting PI3K in cancer: any good news? Martini M *, Ciraolo E *, Gulluni F *, Hirsch E. Frontieres in Oncology May 8;3:108. doi: Spatiotemporal Control of Endocytosis by Phosphatidylinositol 3,4-Bisphosphate. Posor Y, Eichhorn-Gruenig M*, Puchkov D*, Schöneberg J*, Ullrich A*, Lampe A, Müller R, Zarbakhsh S, Gulluni F, Hirsch E, Krauss M, Schultz C, Schmoranzer J, Noé F, Haucke V. Nature July , doi: /nature PI3K class II α controls spatially restricted endosomal PtdIns3P and Rab11 activation to promote primary cilium function. Franco I*, Gulluni F*, Campa CC*, Costa C*, Margaria JP, Ciraolo E, Martini M, Monteyne D, De Luca E, Germena G, Posor Y, Maffucci T, Marengo S, Haucke V, Falasca M, Perez-Morga D, Boletta A, Merlo GR, Hirsch E. Developmental Cell Mar 31;28(6): PI3K/AKT signaling pathway and cancer: an updated review. Martini M, De Santis MC, Braccini L, Gulluni F, Hirsch E. Annals of Medicine Jun 5: Methods to Measure the Enzymatic Activity of PI3Ks. Ciraolo E*, Gulluni F*, Hirsch E, Methdos in Enzymology. 2014;543: In Vivo Role of INPP4B in Tumor and Metastasis Suppression through Regulation of PI3K-AKT Signaling at Endosomes. Li Chew C, Lunardi A *, Gulluni F *, Ruan DT, Chen M, Salmena L, Nishino M, Papa A, Ng C, Fung J, Clohessy JG, Sasaki J, Sasaki T, Bronson RT, Hirsch E, Pandolfi PP Cancer Discovery Jul;5(7): Phosphoinositide 3-Kinase-C2α Regulates Polycystin-2 Ciliary Entry and Protects against Kidney Cyst Formation. Franco I, Margaria JP, De Santis MC, Ranghino A, Monteyne D, Chiaravalli M, Pema M, Campa CC, Ratto E, Gulluni F, Perez-Morga D, Somlo S, Merlo GR, Boletta A, Hirsch E. J Am Soc Nephrol Apr;27(4): Page 4 / 5 - Curriculum vitae of

5 8. Mitotic spindle assembly and genomic stability in breast cancer require PI3Kfunction. Gulluni F*, Martini M*, De Santis MC, Campa CC, Ghigo A, Margaria JP, Ciraolo E, Franco I, Ala U, Annaratone L, Disalvatore D, Bertalot G, Viale G, Noatynska A, Compagno M, Thelen M, Montemurro F, Meraldi P, Marchiò C, Pece S, Sapino A, Chiarle R, Di Fiore PP and Hirsch E. Nature Medicine, under revision Awards 2009: Mario Negri Foundation study grant. 2011: Mario Negri Foundation study grant. 2012: Mario Negri Foundation study grant. 2013: Mario Negri Foundation study grant. 2013: Optime award, Industrial Union Torino (UIT). 2014: University of Torino: Medal for 2012 Best Thesis Work. Page 5 / 5 - Curriculum vitae of

Europass Curriculum Vitae

Europass Curriculum Vitae Europass Curriculum Vitae Personal information Surname / First name Dal Collo Giada 7, Via Canova, 36010, Velo d Astico (VI), Address Italy Mobile +39 3481525172 E-mail giada.dalcollo@gmail.com Nationality

More information

Europass Curriculum Vitae

Europass Curriculum Vitae Europass Curriculum Vitae Personal information First name(s) / Surname(s) Grigor Dimitrov Sariiski Address(es) 34, Hristo Kovachev str. 1527, Sofia, Bulgaria Telephone(s) +359 2 877-81-64 Mobile: +359

More information

Europass Curriculum Vitae

Europass Curriculum Vitae Europass Curriculum Vitae Personal information Surname(s) / First name(s) Address(es) 1 SQUARE GASTON BERTANDEAU 75017 Parigi (Francia) Telephone(s) Mobile: +39 3294436114 +33 0787181174 E-mail marco.carlucciomc@gmail.com

More information

Europass Curriculum Vitae

Europass Curriculum Vitae Europass Curriculum Vitae Personal information First name(s) / Surname(s) Maria Teresa Amatulli Address(es) via Foresto 4, 10139, Torino, To, Italy (domicile) 24, via N.Stigliano, 75025, Policoro MT, Italy

More information

Curriculum Vitae of PATRIZIA PESSINA

Curriculum Vitae of PATRIZIA PESSINA Curriculum Vitae of PATRIZIA PESSINA PERSONAL DETAILS Birth date: 9/12/1980 Place: Milan, Italy Phone number: +34 645442229 E-Mail: patrizia.pessina@upf.edu EDUCATION November 2009: PhD in Translational

More information

Curriculum vitae Europass

Curriculum vitae Europass Curriculum vitae Europass PERSONAL INFORMATION First name(s) / Surname(s) BACIU Dan-Silviu Address(es) - Mobile 0244401360 Fax(es) 0244575995 E-mail(s) silviu.baciu@conpet.ro Nationality Romanian Date

More information

Vir B. Singh, PhD

Vir B. Singh, PhD , PhD Vir.Singh@roswellpark.org vir777@gmail.com Current Position Postdoctoral Research Associate at Department of Molecular and Cellular Biology, Roswell Park Cancer Institute, Buffalo, NY, USA since

More information

SureSilencing sirna Array Technology Overview

SureSilencing sirna Array Technology Overview SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference

More information

2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided.

2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided. AP Biology Reading Packet 6- Molecular Genetics Part 2 Name Chapter 19: Eukaryotic Genomes 1. Define the following terms: a. Euchromatin b. Heterochromatin c. Nucleosome 2. Outline the levels of DNA packing

More information

Abderahim Gaceb. Translational Neurology Group, Department of Clinical Sciences, Division of Neurology, Wallenberg Neurocentrum SE Lund Sweden

Abderahim Gaceb. Translational Neurology Group, Department of Clinical Sciences, Division of Neurology, Wallenberg Neurocentrum SE Lund Sweden Abderahim Gaceb Translational Neurology Group, Department of Clinical Sciences, Division of Neurology, Wallenberg Neurocentrum SE-221 84 Lund Sweden Place/date of birth: August 03, 1987 Gender: Male Nationality:

More information

240EQ222 - Genetic Engineering

240EQ222 - Genetic Engineering Coordinating unit: Teaching unit: Academic year: Degree: ECTS credits: 2017 295 - EEBE - Barcelona East School of Engineering 713 - EQ - Department of Chemical Engineering MASTER'S DEGREE IN CHEMICAL ENGINEERING

More information

Curriculum Vitae. Mahina Tabassum Mitul. Contact Number:

Curriculum Vitae. Mahina Tabassum Mitul. Contact Number: Curriculum Vitae Mahina Tabassum Mitul Contact Number: 01779010515 E-mail: mahina18@gmail.com Academic Qualification: Degree University/ Board Major/Concentration Passing Year MS University of Dhaka Biochemistry

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

Home address: No.255, Bina dead-end lane, Motahari street, Esfahan, Iran. Postal Code: Telephone No.:

Home address: No.255, Bina dead-end lane, Motahari street, Esfahan, Iran. Postal Code: Telephone No.: Curriculum vitae: Name: Yahya Khazaie Nationality: Iranian Birth date: 04/30/1975 Birth place: Tehran, Iran Sex: Male Marital status: Married with one kid Name of Spouse: Afagh Nili Name of Daughter: Samin

More information

General Education Learning Outcomes

General Education Learning Outcomes BOROUGH OF MANHATTAN COMMUNITY COLLEGE City University of New York Department of Science Title of Course: Cell Biology Class hours 3 BIO Section: 260 Lab hours 3 Semester Spring 2018 Credits 4 Schedule:

More information

Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.

Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. by Altogen Labs, 11200 Manchaca Road, Suite 203 Austin TX 78748 USA Tel. (512) 433-6177

More information

Molecular and Cell Biology (MCB)

Molecular and Cell Biology (MCB) Molecular and Cell Biology (MCB) Head of Department: Professor Michael Lynes Department Office: Room 104, Biology/Physics Building For major requirements, see the College of Liberal Arts and Sciences section

More information

HOW TO CREATE AN ENTRY-LEVEL CERTIFICATE FROM CORE BIOSCIENCE SKILL STANDARDS NATIONAL CAREER PATHWAYS NETWORK ANNUAL CONFERENCE

HOW TO CREATE AN ENTRY-LEVEL CERTIFICATE FROM CORE BIOSCIENCE SKILL STANDARDS NATIONAL CAREER PATHWAYS NETWORK ANNUAL CONFERENCE HOW TO CREATE AN ENTRY-LEVEL CERTIFICATE FROM CORE BIOSCIENCE SKILL STANDARDS NATIONAL CAREER PATHWAYS NETWORK ANNUAL CONFERENCE Linnea Fletcher, AC2 Regional Bio-Link Center Jeanette Mowery, Bio-Link,

More information

a Award Number: W81XWH TITLE:

a Award Number: W81XWH TITLE: AD Award Number: W81XWH-04-1-0138 TITLE: Imaging Metastatic Prostate Cancer After Genetic Manipulation of Transcriptional Memory Regulators EZH2 and EED PRINCIPAL INVESTIGATOR: Lily Wu, M.D., Ph.D. CONTRACTING

More information

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

Jennifer Guerrero 414 Club Drive, Apt. 3. San Antonio, TX. (210) cell. Organization and Location Degree Year

Jennifer Guerrero 414 Club Drive, Apt. 3. San Antonio, TX. (210) cell. Organization and Location Degree Year Jennifer Guerrero 414 Club Drive, Apt. 3 78201 (210) 313-0213 cell jenguerrero08@gmail.com EDUCATIONAL BACKGROUND Organization and Location Degree Year The University of Texas at San Antonio M. S. 2011

More information

The Institute of Microbiology of the Czech Academy of Sciences is looking for. four POSTDOCTORAL FELLOW positions in the fields of:

The Institute of Microbiology of the Czech Academy of Sciences is looking for. four POSTDOCTORAL FELLOW positions in the fields of: 4 Postdoctoral Fellow positions in microbiology, molecular biology and ecology The Institute of Microbiology of the Czech Academy of Sciences, Prague, Czech Republic The Institute of Microbiology of the

More information

Functional characterisation

Functional characterisation Me Me Ac Ac Functional characterisation How can we know if measured changes in DNA methylation and function (phenotype) and linked, and in what way? DNMT Dianne Ford Professor of Molecular Nutritional

More information

Supplementary Material. TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the. ERK1/2 signaling pathway

Supplementary Material. TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the. ERK1/2 signaling pathway Supplementary Material TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the ERK1/2 signaling pathway Cui Zhang 1, Fan-Fan Hong 1, Cui-Cui Wang 1, Liang Li 1, Jian-Ling Chen

More information

Europass Curriculum Vitae

Europass Curriculum Vitae Europass Curriculum Vitae Personal information First name / Surname Address Telephone Andrea Enria via Giuseppe Gioachino Belli, 00193 Rome, Italy +39 06 47924839 (work) +39 06 43417316 (home) Fax +39

More information

Biotech Applications Nucleic acid therapeutics, Antibiotics, Transgenics. BIT 220 End of Chapter 22 (Snustad/Simmons)

Biotech Applications Nucleic acid therapeutics, Antibiotics, Transgenics. BIT 220 End of Chapter 22 (Snustad/Simmons) Biotech Applications Nucleic acid therapeutics, Antibiotics, Transgenics BIT 220 End of Chapter 22 (Snustad/Simmons) Nucleic Acids as Therapeutic Agents Many diseases (cancer, inflammatory diseases) from

More information

2) Cancer Research UK postdoctoral research fellowship 3) Wellcome Trust Sanger Institute postdoctoral reaeasrch fellowship

2) Cancer Research UK postdoctoral research fellowship 3) Wellcome Trust Sanger Institute postdoctoral reaeasrch fellowship Curriculum Vitae: Name THEODOROS G. PETRAKIS Place of birth ATHENS, GREECE Date of birth 14 th October 1974 Nationality Greek Home address Porto Rafth (Perioxh Agias Paraskevis), taxudromikh thurida 1489,

More information

Biology 252 Nucleic Acid Methods

Biology 252 Nucleic Acid Methods Fall 2015 Biology 252 Nucleic Acid Methods COURSE OUTLINE Prerequisites: One semester of college biology (BIO 101 or BIO 173) and one semester of college English (ENG 111); completion of CHM 111is recommended.

More information

Exam MOL3007 Functional Genomics

Exam MOL3007 Functional Genomics Faculty of Medicine Department of Cancer Research and Molecular Medicine Exam MOL3007 Functional Genomics Tuesday May 29 th 9.00-13.00 ECTS credits: 7.5 Number of pages (included front-page): 5 Supporting

More information

Proteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer.

Proteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer. Proteomics And Cancer Biomarker Discovery Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar Overview Proteomics Cancer Aims Tools Data Base search Challenges Summary 1 Overview

More information

Grade: UCL Grade 7 Salary Range: 34,635-41,864 (including London Allowance)

Grade: UCL Grade 7 Salary Range: 34,635-41,864 (including London Allowance) London Centre for Nanotechnology 17-19 Gordon Street London WC1H 0AH www.london-nano.com Job title: Research associate Job reference number: 1702944 Grade: UCL Grade 7 Salary Range: 34,635-41,864 (including

More information

BIOTECHNOLOGY SYSTEMS CAREER PATHWAY

BIOTECHNOLOGY SYSTEMS CAREER PATHWAY Plant Systems Te Power, r Structural and T chnical Systems Natural Resource Car Systems eer Pathway A F N R A F N R Agribusiness Systems C A R E E R C O N T E N T C L U S T E R Career Ready Practices Content

More information

Cytomics in Action: Cytokine Network Cytometry

Cytomics in Action: Cytokine Network Cytometry Cytomics in Action: Cytokine Network Cytometry Jonni S. Moore, Ph.D. Director, Clinical and Research Flow Cytometry and PathBioResource Associate Professor of Pathology & Laboratory Medicine University

More information

ATP APPLICATION. (all materials due July 19, 2010) Name of Student: Pitt Student ID: US Citizen* YES Permanent Registered Alien** YES

ATP APPLICATION. (all materials due July 19, 2010) Name of Student: Pitt Student ID: US Citizen* YES Permanent Registered Alien** YES ATP APPLICATION (all materials due July 19, 2010) Name of Student: Pitt Student ID: US Citizen* YES Permanent Registered Alien** YES Current PhD Program Current or Proposed Faculty Mentor Student e-mail

More information

Course Descriptions. BIOL: Biology. MICB: Microbiology. [1]

Course Descriptions. BIOL: Biology. MICB: Microbiology.  [1] Course Descriptions BIOL: Biology http://www.calendar.ubc.ca/vancouver/courses.cfm?code=biol [1] BIOL 112 (3) Biology of the Cell The principles of cellular and molecular biology using bacterial and eukaryotic

More information

Fatchiyah

Fatchiyah Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing

More information

Central University of Rajasthan School of Life Sciences Syllabus for the pre-phd course work for the next academic session

Central University of Rajasthan School of Life Sciences Syllabus for the pre-phd course work for the next academic session Central University of Rajasthan School of Life Sciences Syllabus for the pre-phd course work for the next academic session PSLS-101 (credit-4) Research methodology with quantitative methods and computer

More information

THE CELL BIOLOGY BEHIND THE ONCOGENIC PIP3 LIPIDS

THE CELL BIOLOGY BEHIND THE ONCOGENIC PIP3 LIPIDS WORKSHOPS CURRENT TRENDS IN BIOMEDICINE 2018 SEDE ANTONIO MACHADO BAEZA, SPAIN THE CELL BIOLOGY BEHIND THE ONCOGENIC PIP3 LIPIDS Baeza, Spain 15 th -17 th October 2018 Organized by: Richard A. Anderson

More information

Blue Marble University Biology Course Handbook

Blue Marble University Biology Course Handbook Blue Marble University Biology Course Handbook A Summary of Course Descriptions Courses and Content Subject to Change Without Notice BlueMarbleUniversity.com Info@bluemarbleuniversity.com Stem Cell Biology

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

Stem Cell Services. Driving Innovation for Stem Cell Researchers

Stem Cell Services. Driving Innovation for Stem Cell Researchers Driving Innovation for Stem Cell Researchers Stem Cell Services Partner with us and have access to the most advanced and comprehensive stem cell services available today. 675 W. Kendall St. Cambridge,

More information

Suggest a technique that could be used to provide molecular evidence that all English Elm trees form a clone. ... [1]

Suggest a technique that could be used to provide molecular evidence that all English Elm trees form a clone. ... [1] 1 Molecular evidence E Ulmus procera, form a genetically isolated clone. English Elms developed from a variety of elm brought to Britain from Rome in the first century A.D. Although English Elm trees make

More information

Genetics Lecture 21 Recombinant DNA

Genetics Lecture 21 Recombinant DNA Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of

More information

COMMITTEE FOR VETERINARY MEDICINAL PRODUCTS NOTE FOR GUIDANCE 1 : DNA VACCINES NON-AMPLIFIABLE IN EUKARYOTIC CELLS FOR VETERINARY USE

COMMITTEE FOR VETERINARY MEDICINAL PRODUCTS NOTE FOR GUIDANCE 1 : DNA VACCINES NON-AMPLIFIABLE IN EUKARYOTIC CELLS FOR VETERINARY USE The European Agency for the Evaluation of Medicinal Products Evaluation of Medicines for Veterinary Use CVMP/IWP/07/98-FINAL COMMITTEE FOR VETERINARY MEDICINAL PRODUCTS NOTE FOR GUIDANCE 1 : DNA VACCINES

More information

PROTEOMICS AND FUNCTIONAL GENOMICS PRESENTATION KIMBERLY DONG

PROTEOMICS AND FUNCTIONAL GENOMICS PRESENTATION KIMBERLY DONG PROTEOMICS AND FUNCTIONAL GENOMICS PRESENTATION KIMBERLY DONG A Lentiviral RNAi Library for Human and Mouse Genes Applied to an Arrayed Viral High-Content Screen Jason Moffat,1,2,4,10 Dorre A. Grueneberg,1,10

More information

Curriculum Vitae. P.O 2455, Riyadh 11451, SAUDI ARABIA

Curriculum Vitae. P.O 2455, Riyadh 11451, SAUDI ARABIA Curriculum Vitae Personal Information: Name: Yahya Bashir Ahmed Elbadawi Mobil: 00249912295947 --- 00966542101049 E-mail: Alzeeem95@yahoo.com Current Address: - King Saud University P.O 2455, Riyadh 11451,

More information

AP Biology Gene Expression/Biotechnology REVIEW

AP Biology Gene Expression/Biotechnology REVIEW AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.

More information

HIGH SCHOOL STUDENT SCIENCE WEEK. St. Paul s Hospital Vancouver, BC

HIGH SCHOOL STUDENT SCIENCE WEEK. St. Paul s Hospital Vancouver, BC HIGH SCHOOL STUDENT SCIENCE WEEK St. Paul s Hospital Vancouver, BC Sponsors 2 AGENDA Location: UBC James Hogg Research Centre (JHRC), St. Paul s Hospital, Room 166 Burrard Building, 1081 Burrard Street,

More information

The Use of Genetically-Modified Mouse Models to Study the Actin Cytoskeleton

The Use of Genetically-Modified Mouse Models to Study the Actin Cytoskeleton The Use of Genetically-Modified Mouse Models to Study the Actin Cytoskeleton Anthony Kee (PhD) Cellular and Genetic Medicine Unit School of Medical Sciences (a.kee@unsw.edu.au) 2017 Structure of the Prac

More information

CURRICULUM VITAE. Lecturer (Pharmaceutical Chemistry Department, Faculty of Pharmacy, Al- Azhar University, Cairo, Egypt)

CURRICULUM VITAE. Lecturer (Pharmaceutical Chemistry Department, Faculty of Pharmacy, Al- Azhar University, Cairo, Egypt) CURRICULUM VITAE Farag F. S. Selim, PhD CONTACT DETAILS Name: Farag Farouk Sherbiny Selim Nationality: Egyptian Position: Lecturer (Pharmaceutical Chemistry Department, Faculty of Pharmacy, Al- Azhar University,

More information

Charles Shuler, Ph.D. University of Southern California Los Angeles, California Approved for Public Release; Distribution Unlimited

Charles Shuler, Ph.D. University of Southern California Los Angeles, California Approved for Public Release; Distribution Unlimited AD Award Number: DAMD17-01-1-0100 TITLE: Smad-Mediated Signaling During Prostate Growth and Development PRINCIPAL INVESTIGATOR: Charles Shuler, Ph.D. CONTRACTING ORGANIZATION: University of Southern California

More information

ATIP Avenir Program 2018 Young group leader

ATIP Avenir Program 2018 Young group leader ATIP Avenir Program 2018 Young group leader Important dates - October 17th (4 pm) 2017 : opening of the registrations online - November 23 th 2017: deadline for the online submission, the mailing of the

More information

TheraLin. Universal Tissue Fixative Enabling Molecular Pathology

TheraLin. Universal Tissue Fixative Enabling Molecular Pathology TheraLin Universal Tissue Fixative Enabling Molecular Pathology TheraLin Universal Tissue Fixative Enabling Molecular Pathology Contents Page # TheraLin Universal Tissue Fixative 3 Introduction 5 Easy

More information

Intestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by. Regulating Occludin

Intestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by. Regulating Occludin Intestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by Regulating Occludin Chaithanya Chelakkot 1,ǂ, Jaewang Ghim 2,3,ǂ, Nirmal Rajasekaran 4, Jong-Sun Choi 5, Jung-Hwan

More information

Learning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance

Learning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression

More information

AmoyDx TM PIK3CA Five Mutations Detection Kit

AmoyDx TM PIK3CA Five Mutations Detection Kit AmoyDx TM PIK3CA Five Mutations Detection Kit Detection of five mutations in PIK3CA gene Instructions For Use Instructions Version: B1.3 Date of Revision: April 2012 Store at -20±2 1/5 Background Phosphatidylinositol

More information

24, Bulevar kneza Miloša Novi Sad. February 16, To Whom It May Concern:

24, Bulevar kneza Miloša Novi Sad. February 16, To Whom It May Concern: 24, Bulevar kneza Miloša 21000 Novi Sad February 16, 2007 To Whom It May Concern: I am writing to you regarding the available position of the Translator at your company. I strongly believe that my knowledge,

More information

UNIT 3: GENETICS Chapter 9: Frontiers of Biotechnology

UNIT 3: GENETICS Chapter 9: Frontiers of Biotechnology CORNELL NOTES Directions: You must create a minimum of 5 questions in this column per page (average). Use these to study your notes and prepare for tests and quizzes. Notes will be stamped after each assigned

More information

leading the way in research & development

leading the way in research & development leading the way in research & development people. passion. possibilities. ABBVIE 2 immunology AbbVie Immunology has a demonstrated record of success in identifying and developing both small molecule and

More information

Lectures 28 and 29 applications of recombinant technology I. Manipulate gene of interest

Lectures 28 and 29 applications of recombinant technology I. Manipulate gene of interest Lectures 28 and 29 applications of recombinant technology I. Manipulate gene of interest C A. site-directed mutagenesis A C A T A DNA B. in vitro mutagenesis by PCR T A 1. anneal primer 1 C A 1. fill in

More information

Bridging the Gap Between Basic and Clinical Research. Julio E. Celis Danish Cancer Society

Bridging the Gap Between Basic and Clinical Research. Julio E. Celis Danish Cancer Society Bridging the Gap Between Basic and Clinical Research Julio E. Celis Danish Cancer Society Barriers and Oportunities in Translational Research Promise of the new technologies What is Europe doing? Challenges

More information

MICROBIO, IMMUN, PATHOLOGY-MIP (MIP)

MICROBIO, IMMUN, PATHOLOGY-MIP (MIP) Microbio, Immun, Pathology-MIP (MIP) 1 MICROBIO, IMMUN, PATHOLOGY-MIP (MIP) Courses MIP 101 Introduction to Human Disease (GT-SC2) Credits: 3 (3-0-0) Survey of human systems and diseases. Additional Information:

More information

REQUEST FOR EXPRESSIONS OF INTEREST Individual Consultant. African Development Bank Headquarters-Abidjan (Cote d Ivoire)

REQUEST FOR EXPRESSIONS OF INTEREST Individual Consultant. African Development Bank Headquarters-Abidjan (Cote d Ivoire) REQUEST FOR EXPRESSIONS OF INTEREST Individual Consultant African Development Bank Headquarters-Abidjan (Cote d Ivoire) Avenue Joseph Anoma 01 BP. 1387, Abidjan 01 Cote d Ivoire Email: f.avwontom@afdb.org

More information

GENE CLONING: overview

GENE CLONING: overview TMMO504: Laboratory Molecular Tropical Medicine and Genetics GENE CLONING: overview Instructor: Asst.Prof.Dr. Santi Maneewatchararangsri Department of Molecular Tropical Medicine and Genetics, Mahidol

More information

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information

Lecture 25 (11/15/17)

Lecture 25 (11/15/17) Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1

More information

Immunological Techniques in Research and Clinical Medicine. Philip L. Cohen, M.D. Chief of Rheumatology, LKSOM 10 March 2016

Immunological Techniques in Research and Clinical Medicine. Philip L. Cohen, M.D. Chief of Rheumatology, LKSOM 10 March 2016 Immunological Techniques in Research and Clinical Medicine Philip L. Cohen, M.D. Chief of Rheumatology, LKSOM 10 March 2016 Antibodies Remarkable Tools for Research and Diagnosis You can make an antibody

More information

Medical Biotechnology MSc 2011

Medical Biotechnology MSc 2011 A. CORE MATERIAL A.1. Foundation modul (25-40) Basic science courses (20-30) Biochemistry 4 2 2 4 Introduction to molecular and cell biology 4 1 3 4 Human Physiology 4 2 2 4 Genetics 4 2 2 4 Biophysics

More information

Mathematical modelling in drug discovery

Mathematical modelling in drug discovery Mathematical modelling in drug discovery Garrit Jentsch Computational Biology, Discovery Sciences, AstraZeneca October 17th, 2012 Who are we? http://www.astrazeneca.co.uk/astrazeneca-in-uk/our-uk-sites/alderley-park

More information

Genetic Basis of Development & Biotechnologies

Genetic Basis of Development & Biotechnologies Genetic Basis of Development & Biotechnologies 1. Steps of embryonic development: cell division, morphogenesis, differentiation Totipotency and pluripotency 2. Plant cloning 3. Animal cloning Reproductive

More information

Sample Question Paper Session Class XII Biotechnology (045) Marking Scheme

Sample Question Paper Session Class XII Biotechnology (045) Marking Scheme Sample Question Paper Session 2015-16 Class XII Biotechnology (045) Marking Scheme SECTION-A 1. Methylation Student will add a methyl group to one or two bases within the sequence recognized by enzyme.

More information

0. Courses Other Information 1. The Molecules of Life 2. The Origin of Life 3. The Cell an Introduction

0. Courses Other Information 1. The Molecules of Life 2. The Origin of Life 3. The Cell an Introduction 0. Courses Other Information 1. The Molecules of Life 2. The Origin of Life 3. The Cell an Introduction Department of Medical Biology Our courses Compulsory course: Cell Biology and Molecular Genetics

More information

Flow CAST : Testing Potency and Efficacy of Inhibitors of PI3K δ, PI3Kγ, BTK and SYK Activity

Flow CAST : Testing Potency and Efficacy of Inhibitors of PI3K δ, PI3Kγ, BTK and SYK Activity Flow CAST : Testing Potency and Efficacy of Inhibitors of PI3K δ, PI3Kγ, BTK and SYK Activity Michele Romano, PhD Product Manager Flow CAST is for Research Use Only. Not for use in diagnostic procedures.

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer

Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer Author's response to reviews Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer Authors: Hannah Jörißen (hannah.joerissen@molbiotech.rwth-aachen.de)

More information

Course Year University/Board Percentage

Course Year University/Board Percentage Vipin Kumar Verma PhD Scholar Department of Zoology Sri Venkateswara College University of Delhi 110021 Vipinkumarverma1@yahoo.com +91-9999976710 +91-9350809400 Personal Male, single, date of birth- 5th

More information

BSc BIOMEDICAL SCIENCE

BSc BIOMEDICAL SCIENCE Overview College of Science Biomedical Science Core March 2017 (1) BSc BIOMEDICAL SCIENCE Biomedical Science Degree 2015 1 College of Science, NUI Galway Fullscreen Next page Overview [60 credits] [60

More information

Small Interfering RNA s Molecular biology and use in therapy

Small Interfering RNA s Molecular biology and use in therapy Small Interfering RNA s Molecular biology and use in therapy Dr Stuart Hamilton - NHMRC Early Career Fellow Serology and Virology Division, SEALS Microbiology, Prince of Wales Hospital; School of Women

More information

including, but not limited to:

including, but not limited to: *This Section is part of the original Request for Proposal # P08 080. The Contractor should provide the following eligible Scientific Biomedical Research Equipment, Reagents & Supplies including, but not

More information

Bacterial DNA replication

Bacterial DNA replication Bacterial DNA replication Summary: What problems do these proteins solve? Tyr OH attacks PO4 and forms a covalent intermediate Structural changes in the protein open the gap by 20 Å! 1 Summary: What problems

More information

BIOTECHNOLOGY. Course Syllabus. Section A: Engineering Mathematics. Subject Code: BT. Course Structure. Engineering Mathematics. General Biotechnology

BIOTECHNOLOGY. Course Syllabus. Section A: Engineering Mathematics. Subject Code: BT. Course Structure. Engineering Mathematics. General Biotechnology BIOTECHNOLOGY Subject Code: BT Course Structure Sections/Units Section A Section B Unit 1 Unit 2 Unit 3 Unit 4 Unit 5 Unit 6 Unit 7 Section C Section D Section E Topics Engineering Mathematics General

More information

Blot: a spot or stain, especially of ink on paper.

Blot: a spot or stain, especially of ink on paper. Blotting technique Blot: a spot or stain, especially of ink on paper. 2/27 In molecular biology and genetics, a blot is a method of transferring proteins, DNA or RNA, onto a carrier (for example, a nitrocellulose,pvdf

More information

Concepts and Methods in Developmental Biology

Concepts and Methods in Developmental Biology Biology 4361 Developmental Biology Concepts and Methods in Developmental Biology June 16, 2009 Conceptual and Methodological Tools Concepts Genomic equivalence Differential gene expression Differentiation/de-differentiation

More information

SPEED UP YOUR TIME TO MARKET

SPEED UP YOUR TIME TO MARKET SPEED UP YOUR TIME TO MARKET #Pre-clinical #Biologics #Small molecules Welcome to Accelera. As a Contract Research Organization (CRO) serving since more than 30 years pharmaceutical and biotechnology companies

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

REQUEST FOR EXPRESSIONS OF INTEREST (INDIVIDUAL CONSULTANT) AFRICAN DEVELOPMENT BANK. Industrial and Trade Department (PITD) CCIA Abidjan Plateau

REQUEST FOR EXPRESSIONS OF INTEREST (INDIVIDUAL CONSULTANT) AFRICAN DEVELOPMENT BANK. Industrial and Trade Department (PITD) CCIA Abidjan Plateau REQUEST FOR EXPRESSIONS OF INTEREST (INDIVIDUAL CONSULTANT) AFRICAN DEVELOPMENT BANK Industrial and Trade Department (PITD) CCIA Abidjan Plateau Title of the assignment: Industrial policy consultant Brief

More information

PCR Arrays. An Advanced Real-time PCR Technology to Empower Your Pathway Analysis

PCR Arrays. An Advanced Real-time PCR Technology to Empower Your Pathway Analysis PCR Arrays An Advanced Real-time PCR Technology to Empower Your Pathway Analysis 1 Table of Contents 1. Introduction to the PCR Arrays 2. How PCR Arrays Work 3. Performance Data from PCR Arrays 4. Research

More information

1. Introduction. 1 Page 1

1. Introduction. 1 Page 1 1. INTRODUCTION Osteoblast differentiation is the key component of the bone formation, growth and remodeling. During this incompletely understood process a subpopulation of multipotential mesenchymal stem

More information

Molecular Biotechnology Master Degree Program

Molecular Biotechnology Master Degree Program > APPLIED LIFE SCIENCES MASTER DEGREE PROGRAM: > FULL TIME Molecular Biotechnology Master Degree Program www.fh-campuswien.ac.at MY OCCUPATIONAL FUTURE. Your Career Opportunities BIOTECHNOLOGY IS ONE OF

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

National Unit Specification: general information Biotechnology (Higher) NUMBER DF5J 12 COURSE Biotechnology (Higher)

National Unit Specification: general information Biotechnology (Higher) NUMBER DF5J 12 COURSE Biotechnology (Higher) National Unit Specification: general information NUMBER DF5J 12 COURSE SUMMARY This unit seeks to develop knowledge and understanding, problem solving and practical abilities in the context of biotechnological

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death

Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death SUPPLEMENTAL DATA Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death Huajun Jin 1, Arthi Kanthasamy 1, Vellareddy Anantharam

More information

Updates to the NIH Guidelines for Research Involving Recombinant DNA Molecules (NIH Guidelines)

Updates to the NIH Guidelines for Research Involving Recombinant DNA Molecules (NIH Guidelines) Updates to the NIH Guidelines for Research Involving Recombinant DNA Molecules (NIH Guidelines) Jacqueline Corrigan-Curay, J.D. M.D. Acting Director Office of Biotechnology Activities National Institute

More information

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated

More information

Overview of Biologics Testing and Evaluation: Regulatory Requirements and Expectations. Audrey Chang, PhD, Senior Director Development Services

Overview of Biologics Testing and Evaluation: Regulatory Requirements and Expectations. Audrey Chang, PhD, Senior Director Development Services Overview of Biologics Testing and Evaluation: Regulatory Requirements and Expectations Audrey Chang, PhD, Senior Director Development Services Definition of Biologics: PHS Act, section 351 Virus, therapeutic

More information

2 Gene Technologies in Our Lives

2 Gene Technologies in Our Lives CHAPTER 15 2 Gene Technologies in Our Lives SECTION Gene Technologies and Human Applications KEY IDEAS As you read this section, keep these questions in mind: For what purposes are genes and proteins manipulated?

More information