For knockdown of individual genes, the following TRC library clones were used: Gene Species Library TRC number Designation in manuscript

Size: px
Start display at page:

Download "For knockdown of individual genes, the following TRC library clones were used: Gene Species Library TRC number Designation in manuscript"

Transcription

1 Supplemental Methods shrna constructs for validation experiments For knockdown of MLL-AF9, a custom shrna with the following stem sequence directed against the fusion breakpoint (underlined) was designed using shrna Explorer ( and cloned into the plko.1 vector: 5 -AAGTCTGAACAACCCAGTCCT-3 For knockdown of individual genes, the following TRC library clones were used: Gene Species Library TRC number Designation in manuscript AF9 human TRC-Hs 1.0 (Human) TRCN shaf9_5 TRC-Hs 1.0 (Human) TRCN shaf9_3 CAMK1 human TRC-Hs 1.0 (Human) TRCN shcamk1-679 TRC-Hs 1.0 (Human) TRCN shcamk CDK4 human TRC-Hs 1.0 (Human) TRCN shcdk4_1 TRC-Hs 1.0 (Human) TRCN shcdk4_2 CDK6 human TRC-Hs 1.0 (Human) TRCN shcdk4_3 TRC-Hs 1.0 (Human) TRCN shcdk6_1 TRC-Hs 1.0 (Human) TRCN shcdk6_2 TRC-Hs 1.0 (Human) TRCN shcdk6_3 DGKH human TRC-Hs 1.0 (Human) TRCN shcdk6_4 TRC-Hs 1.0 (Human) TRCN shdgkh-1357 TRC-Hs 1.0 (Human) TRCN shdgkh-1360 MAP3K12 human TRC-Hs 1.0 (Human) TRCN shmap3k TRC-Hs 1.0 (Human) TRCN shmap3k SRPK2 human TRC-Hs 1.0 (Human) TRCN shsrpk TRC-Hs 1.0 (Human) TRCN shsrpk THOC4 human TRC-Hs 1.0 (Human) TRCN shthoc4-351 TRC-Hs 1.0 (Human) TRCN shthoc4-352 UNC13B human TRC-Hs 1.0 (Human) TRCN shunc13b-2356 TRC-Hs 1.0 (Human) TRCN shunc13b-2359 Cdk6 mouse TRC-Mm 1.0 (Mouse) TRCN shcdk6_m1 TRC-Mm 1.0 (Mouse) TRCN shcdk6_m2 1

2 RNA isolation, cdna synthesis, and qrt-pcr Total RNA was isolated using the RNeasy Mini or Micro Kit (Qiagen) and reversetranscribed (2 µg in a total volume of 20 µl) using the High Capacity cdna Reverse Transcription Kit (Applied Biosystems). Real-time PCR was used to quantify gene expression relative to endogenous PBGD or HPRT1. Primers were combined with LightCycler 480 SYBR Green I Master Mix (Roche) or TaqMan SYBR Green PCR Master Mix (Applied Biosystems) reagents, and cdna was used as template. Reactions were run on a LightCycler 480 (Roche) or an ABI PRISM 7900HT Sequence Detection System at default thermal cycling conditions. Results were analyzed using the standard curve method. Primer sequences for qrt-pcr Gene Species Forward primer Reverse primer CAMK1 human GGGCAAGGAAGGCAGCAT GGTAGAGGTGGCCCCCACT CDK4 human CTGGTGTTTGAGCATGTAGACC AAACTGGCGCATCAGATCCTT CDK6 human TGCACAGTGTCACGAACAGA ACCTCGGAGAAGCTGAAACA CEBPA human AACATCGCGGTGCGCAAGAG TTCGCGGCTCAGCTGTTCCA DGKH human AAACCTTCCTCCCAGAAAGC GGTTCACAGGGGTGAACTGT HOXA9 human CCGAGAGGCAGGTCAAGATC AAATAAGCCCAAATGGCATCA HPRT1 human TTGCTGACCTGCTGGATTAC TCTCCACCAATTACTTTTATGTCC IRF8 human CCGAGCCATACAAAGTTTACCG CAGAGCGACCGCACTCCA MAP3K12 human GAACTACCTGCACCTGCACA TCCTTGGAAGTGCCAAAATC MLL-AF9 8A a human GTCCAGAGCAGAGCAAACAGAAA TTGTTGCCTGGTCTGGGATG MLL-AF9 9A b human GCAGATGGAGTCCACAGGAT ACCTCAAAGGACCTTGTTGC MLL-AF9 plasmid human GCAGATGGAGTCCACAGGAT ATGCCTTGTCACATTCACCAT PBGD human GGAGCCATGTCTGGTAACGGCA GGTACCCACGCGAATCACTCTCA SPI1 human TGTTACAGGCGTGCAAAATGG TGCGTTTGGCGTTGGTATAGA SRPK2 human CTTTGCCAGACCCCACAC GTCTCCAATTTTCACTGGATGAT THOC4 human GGAAACTGCTGGTGTCCAAT CGACCAGAGCGATCATAGTG UNC13B human CTGAAGACTATTCGTCAGTCGGA TGAGGAGTTGGGTTTCTAGTTCC Cdk4 mouse AACTGATCGGGACATCAAGG CAGGCCGCTTAGAAACTGAC Cdk6 mouse AGAAGTCCTGCTCCAGTCCA CACGTCTGAACTTCCACGAA Hoxa9 mouse CCCTGACTGACTATGCTTGTG GCATCGCTTCTTCCGAGTG Hprt1 mouse CTTTGCTGACCTGCTGGATT TATGTCCCCCGTTGACTGAT a Fusion between MLL exon 8 and AF9 exon 6 (site A) b Fusion between MLL exon 9 and AF9 exon 6 (site A) 2

3 Immunoblotting Immunoblotting was performed using standard procedures with the following antibodies: anti-ß-actin (Sigma-Aldrich); anti-ß-tubulin, anti-cdk4, anti-cdk6 (Cell Signaling); anti- MLL1 (Bethyl). Whole-cell protein extracts were prepared using lysis buffer containing 20 mm Tris, 1% Triton X-100, 150 mm NaCl, 1 mm EDTA, and 10% glycerol supplemented with Halt Protease and Phosphatase Inhibitor Cocktail (Pierce), and µg of protein were subjected to SDS-PAGE and immunoblotting. Determination of viable cell numbers Viable cell numbers in suspension culture were determined using the CellTiter96AQ ueous One Solution Proliferation Assay (Promega). Cell cycle, apoptosis, and differentiation analysis For cell cycle analysis, cells were either stained for 15 minutes on ice with Nicoletti buffer (0.1% sodium citrate, 0.1% Triton-X 100, 50 µg/ml propidium iodide, ph 7.4) or pulsed with BrdU for 2 hours and processed according to the FITC BrdU Flow Kit staining protocol (BD Pharmingen). For apoptosis analysis, cells were stained with Annexin V-PE or Annexin V-FITC and 7-AAD in Annexin V Binding Buffer (BD Pharmingen). To determine the expression of surface antigens associated with myelomonocytic differentiation, cells were stained with human FITC-conjugated anti- CD14 and PE-conjugated anti-cd11b (BD Biosciences), mouse Pacific Blue-conjugated anti-f4/80 and APC-conjugated anti-cd115 (ebioscience), or isotype control. Flow cytometric analyses were performed on a BD LSR II flow cytometer (BD Biosciences) 6 days after lentiviral transduction of human cells, 5 days after PD treatment, and 4 days after retroviral transduction of murine cells, respectively. Colony formation assays Cell lines derived from mouse HSPC expressing MLL-AF9 or MOZ-TIF2 (1x10 4 to 3x10 4 cells) were transduced with shrna constructs and plated in methylcellulose medium (MethoCult GF M3434; StemCell Technologies), and colonies were counted after 5 days. Human AML cell lines (1x10 3 to 1x10 4 cells) were plated in methylcellulose medium (MethoCult H4236; StemCell Technologies) with or without PD , and colonies were counted after 10 days. For colony formation assays with mononuclear cells from AML patients, 1x10 6 to 2x10 6 cells were plated in methylcellulose medium 3

4 (MethoCult H4435 Enriched; StemCell Technologies) with or without PD After 5 to 8 days, colonies were counted and cell numbers determined. Images were taken on a Cell Observer system (Zeiss). Primary human hematopoietic cells BM or blood samples from AML patients were obtained at diagnosis prior to therapy. Mononuclear cells were isolated by Ficoll-Hypaque density gradient centrifugation. The diagnosis of AML was made according to the World Health Organization Classification of Tumours of Haematopoietic and Lymphoid Tissues or French-American-British Cooperative Group criteria. All specimens were karyotyped by chromosome banding. In selected cases, the presence of an MLL fusion gene was confirmed by RT-PCR or fluorescence in situ hybridization. Normal CD34 pos hematopoietic progenitor cells were isolated from cryopreserved leukapheresis products. Mononuclear cells were separated by Ficoll-Hypaque density gradient centrifugation. Enrichment of CD34 pos cells to a purity of greater than 95% was performed by positive selection using immunomagnetic microbeads (Miltenyi Biotec) according to the manufacturer's instructions. 4

5 Supplemental Table 1 Cell line Disease MLL fusion Additional mutations (selection) NOMO-1 AML MLL-AF9 KRAS G13D ML-2 AML MLL-AF6 KRAS A146T MOLM-14 AML MLL-AF9 FLT3 ITD Mono-Mac-6 AML MLL-AF9 FLT3 V592A MV4-11 AML MLL-AF4 FLT3 ITD THP-1 AML MLL-AF9 NRAS G12D HL-60 AML NRAS Q61L K562 CML-BC BCR-ABL1 NB4 APL PML-RARA, KRAS A18D OCI-AML3 AML NPM1 mut, NRAS Q61L U937 AML PTPN11 G60R CML-BC, chronic myeloid leukemia blast crisis; APL, acute promyelocytic leuekmia; ITD, internal tandem duplication. 5

6 Supplemental Figure 1 Supplemental Figure 1. Requirement for CDK6 in MLL-rearranged AML cell lines. (A) CDK6 mrna and protein expression of AML cell lines transduced with a nontargeting control shrna or shrnas targeting CDK6. MM6, Mono-Mac-6. (B) CDK6 mrna and protein expression of MV4-11 and ML-2 cells transduced with a nontargeting control shrna or shrnas targeting CDK6. (C) Cdk6 protein expression of cells used in Figure 2E and F. 6

7 Supplemental Figure 2 7

8 Supplemental Figure 2 continued Supplemental Figure 2. Effects of CDK6 suppression in AML cells. (A) Flow cytometric analysis of cell cycle progression using propidium iodide. Numbers indicate percentages of cells in G0/G1. (B, C) Flow cytometric analysis of cell cycle progression using BrdU/7AAD. Shown are the mean ± SEM of 3 independent experiments (panel B) and representative plots (panel C). Numbers in panel C indicate percentages of cells. (D) Flow cytometric analysis of apoptosis. Numbers indicate percentages of cells. (E) CDK6, IRF8, CEBPA, and SPI1 mrna expression of MLL-AF9 pos THP-1 cells following suppression of CDK6 with 3 different shrnas. (F, G) Flow cytometric analysis of myeloid differentiation in THP-1 (panel F) and NOMO-1 (panel G) cells transduced with lentiviral vectors expressing GFP and the coding sequences of CDK6, catalytically deficient CDK6 (CDK6 K43M), and CDK4, respectively, or an empty control vector (EV). Cells were GFP-sorted, transduced with an shrna targeting the CDK6 3 UTR, and analyzed for CD11b expression after 6 days. Shown are the percentages of GFP pos /CD11b pos cells (left panels) and counts relative to CD11b fluorescence intensity (right panels). (H) AF9 mrna expression of various AML cell lines. 8

9 Supplemental Figure 3 9

10 Supplemental Figure 3 continued Supplemental Figure 3. Pharmacologic inhibition of CDK6 in human AML cells. (A) Colony formation in methylcellulose of MLL-AF9 pos (NOMO-1, THP-1) and MLL-AF9 neg (HL-60, K562) AML cell lines treated with varying concentrations of PD Original magnification, x4.7. (B) CDK4 mrna and protein expression of AML cell lines transduced with a non-targeting control shrna or shrnas targeting CDK4. (C) Characteristics of primary human MLL-rearranged leukemia samples. AUL, acute undifferentiated leukemia. (D) Absolute colony numbers of primary human MLLrearranged leukemia samples cultured in methylcellulose in the presence of varying concentrations of PD (E) IRF8, CEBPA, and SPI1 mrna expression of MLL- AF9 pos and MLL-AF9 neg AML cell lines treated with varying concentrations of PD NE, not expressed. 10

11 Supplemental Figure 4 Supplemental Figure 4. Gating strategy for GFP pos /mcherry pos leukemic cells used for in vitro and in vivo experiments shown in Figure 6. Flow cytometric analysis of GFP (marker for MLL-AF9) and mcherry (marker for shrna) expression of leukemic cells from mice with secondary MLL-AF9-induced AML transduced with a LeGO-C2 lentiviral gene ontology vector encoding either an shrna against Cdk6 or a non-targeting control sequence. Gates for sorting of cells with strong mcherry expression are indicated. 11

Supplemental Information Inventory

Supplemental Information Inventory Cell Stem Cell, Volume 6 Supplemental Information Distinct Hematopoietic Stem Cell Subtypes Are Differentially Regulated by TGF-β1 Grant A. Challen, Nathan C. Boles, Stuart M. Chambers, and Margaret A.

More information

In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang *

In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang * In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang * Division of Hematology-Oncology, Department of Medicine, Medical University of South Carolina, Charleston,

More information

Confocal immunofluorescence microscopy

Confocal immunofluorescence microscopy Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,

More information

Mayumi Egawa, Kaori Mukai, Soichiro Yoshikawa, Misako Iki, Naofumi Mukaida, Yohei Kawano, Yoshiyuki Minegishi, and Hajime Karasuyama

Mayumi Egawa, Kaori Mukai, Soichiro Yoshikawa, Misako Iki, Naofumi Mukaida, Yohei Kawano, Yoshiyuki Minegishi, and Hajime Karasuyama Immunity, Volume 38 Supplemental Information Inflammatory Monocytes Recruited to Allergic Skin Acquire an Anti-inflammatory M2 Phenotype via Basophil-Derived Interleukin-4 Mayumi Egawa, Kaori Mukai, Soichiro

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

Supplemental Information

Supplemental Information Supplemental Information Genetic and Functional Studies Implicate HIF1α as a 14q Kidney Cancer Suppressor Gene Chuan Shen, Rameen Beroukhim, Steven E. Schumacher, Jing Zhou, Michelle Chang, Sabina Signoretti,

More information

Supporting Information

Supporting Information Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS

More information

Reagents and cell culture Mcl-1 gene expression: real-time quantitative RT-PCR In vitro PP2A phosphatase assay Detection of Mcl-1 in vivo

Reagents and cell culture Mcl-1 gene expression: real-time quantitative RT-PCR In vitro PP2A phosphatase assay Detection of Mcl-1 in vivo Reagents and cell culture Antibodies specific for caspase 3, PARP and GAPDH were purchased from Cell Signaling Technology Inc. (Beverly, MA). Caspase inhibitor z-vad-fmk and ROS scavenger N-acetyl-Lcysteine

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1: Vector maps of TRMPV and TRMPVIR variants. Many derivatives of TRMPV have been generated and tested. Unless otherwise noted, experiments in this paper use

More information

MagniSort Mouse Hematopoietic Lineage Depletion Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures.

MagniSort Mouse Hematopoietic Lineage Depletion Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures. Page 1 of 2 MagniSort Mouse Hematopoietic Lineage Depletion Kit RUO: For Research Use Only. Not for use in diagnostic procedures. Mouse bone marrow cells were unsorted (top row) or sorted with the MagniSort

More information

Online Supplementary Information

Online Supplementary Information Online Supplementary Information NLRP4 negatively regulates type I interferon signaling by targeting TBK1 for degradation via E3 ubiquitin ligase DTX4 Jun Cui 1,4,6,7, Yinyin Li 1,5,6,7, Liang Zhu 1, Dan

More information

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Instruction manual RNA-direct SYBR Green Realtime PCR Master Mix 0810 F0930K RNA-direct SYBR Green Realtime PCR Master Mix Contents QRT-201T QRT-201 0.5mLx2 0.5mLx5 Store at -20 C, protected from light

More information

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6

More information

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative

More information

mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230

mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230 mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR

More information

SUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement

SUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement SUPPLEMENTAL MATERIAL Supplemental Methods Reagents Cumate solution was from System Biosciences. Human complement Cq and complement C-esterase inhibitor (C-INH) were from Calbiochem. C-INH (Berinert) for

More information

Isolation, culture, and transfection of primary mammary epithelial organoids

Isolation, culture, and transfection of primary mammary epithelial organoids Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)

More information

mmu-mir-34a Real-time RT-PCR Detection Kit User Manual

mmu-mir-34a Real-time RT-PCR Detection Kit User Manual mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not

More information

Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin

Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Carla Tripisciano 1, René Weiss 1, Tanja Eichhorn 1,

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 Validation of the monoclonal antibody to mouse ACKR1 and expression of ACKR1 by BM hematopoietic cells. (a to d) Comparison of immunostaining of BM cells by anti-mouse ACKR1 antibodies:

More information

Flow Cytometry Support Reagents

Flow Cytometry Support Reagents Excite and inspire Flow Cytometry Support Reagents Introduction Miltenyi Biotec is a leading supplier of flow cytometry products, offering one of the broadest ranges of antibodies, kits, assays, and support

More information

Roche Molecular Biochemicals Technical Note No. LC 10/2000

Roche Molecular Biochemicals Technical Note No. LC 10/2000 Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

Supplemental Materials and Methods

Supplemental Materials and Methods Supplemental Materials and Methods 125 I-CXCL12 binding assay KG1 cells (2 10 6 ) were preincubated on ice with cold CXCL12 (1.6µg/mL corresponding to 200nM), CXCL11 (1.66µg/mL corresponding to 200nM),

More information

Technical Bulletin. Multiple Methods for Detecting Apoptosis on the BD Accuri C6 Flow Cytometer. Introduction

Technical Bulletin. Multiple Methods for Detecting Apoptosis on the BD Accuri C6 Flow Cytometer. Introduction March 212 Multiple Methods for Detecting Apoptosis on the BD Accuri C6 Flow Cytometer Contents 1 Introduction 2 Annexin V 4 JC-1 5 Caspase-3 6 APO-BrdU and APO-Direct Introduction Apoptosis (programmed

More information

B Vehicle 1V270 (35 μg) 1V270 (100 μg) Days post tumor implantation. Vehicle 100μg 1V270 biweekly 100μg 1V270 daily

B Vehicle 1V270 (35 μg) 1V270 (100 μg) Days post tumor implantation. Vehicle 100μg 1V270 biweekly 100μg 1V270 daily Supplemental Figure 1 A 1 1V7 (8 μg) 1 1V7 (16 μg) 8 6 4 B 1 1 8 6 4 1V7 (35 μg) 1V7 (1 μg) 5 1 15 5 1 15 C Biweekly 8 11 14 17 Days Implant SCC7 cells Daily 8 9 1 11 1 Implant SCC7 cells 1V7 i.t. treatment

More information

Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using

Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using Supplementary Methods Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using the Qiagen RNeasy Mini Kit, according to the manufacturer s protocol with on-column DNase digestion

More information

PrimeScript RT Master Mix (Perfect Real Time)

PrimeScript RT Master Mix (Perfect Real Time) Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.

More information

SYBR Green Realtime PCR Master Mix

SYBR Green Realtime PCR Master Mix Instruction manual SYBR Green Realtime PCR Master Mix 0810 F0924K SYBR Green Realtime PCR Master Mix QPK-201T 1 ml x 1 QPK-201 1 ml x 5 Contents [1] Introduction [2] Components [3] Primer design [4] Detection

More information

TF-1a lymphoblastic leukemia cell line: marking with GFP, phenotyping and sorting

TF-1a lymphoblastic leukemia cell line: marking with GFP, phenotyping and sorting Supplemental Material Supplemental Methods TF-1a lymphoblastic leukemia cell line: marking with GFP, phenotyping and sorting In order to determine if the multi-parameter FACS approach would be successful

More information

SuperPrep Cell Lysis & RT Kit for qpcr

SuperPrep Cell Lysis & RT Kit for qpcr SuperPrep Cell Lysis & RT Kit for qpcr 1402 F1267K SuperPrep Cell Lysis & RT Kit for qpcr SCQ-101 100 reactions Store at -20 C SuperPrep Cell Lysis Kit for qpcr SCQ-201 100 preparations Store at -20 C

More information

PROTEOMICS AND FUNCTIONAL GENOMICS PRESENTATION KIMBERLY DONG

PROTEOMICS AND FUNCTIONAL GENOMICS PRESENTATION KIMBERLY DONG PROTEOMICS AND FUNCTIONAL GENOMICS PRESENTATION KIMBERLY DONG A Lentiviral RNAi Library for Human and Mouse Genes Applied to an Arrayed Viral High-Content Screen Jason Moffat,1,2,4,10 Dorre A. Grueneberg,1,10

More information

Human TNF qpcr primer pair

Human TNF qpcr primer pair Shipping and Storage information Catalog No. Amount Reaction number of 25-μl volume Shipping and Storage Package tube 2 nmol 200 lyophilized powder 1 Information of the target gene and primers Species

More information

SideStep Lysis and Stabilization Buffer

SideStep Lysis and Stabilization Buffer SideStep Lysis and Stabilization Buffer INSTRUCTION MANUAL Catalog #400900 Revision B.0 For Research Use Only. Not for use in diagnostic procedures. 400900-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

Supporting Information

Supporting Information Supporting Information Ohtsubo et al. 10.1073/pnas.0800672105 SI Materials and Methods Cell Cycle and Apoptosis Analyses. Cells were pulse-labeled with BrdU at 10 g/ml for 45 min and stained with the APC-BrdU

More information

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin

More information

BD Mouse Hematopoietic Stem and Progenitor Cell Isolation Kit

BD Mouse Hematopoietic Stem and Progenitor Cell Isolation Kit BD Mouse Hematopoietic Stem and Progenitor Cell Isolation Kit Instruction Manual Catalog No. 560492 2010, Becton, Dickinson and Company. All rights reserved. No part of this publication may be reproduced,

More information

Roche Molecular Biochemicals Technical Note No. LC 9/2000

Roche Molecular Biochemicals Technical Note No. LC 9/2000 Roche Molecular Biochemicals Technical Note No. LC 9/2000 LightCycler Optimization Strategy Introduction Purpose of this Note Table of Contents The LightCycler system provides different detection formats

More information

Percent survival. Supplementary fig. S3 A.

Percent survival. Supplementary fig. S3 A. Supplementary fig. S3 A. B. 100 Percent survival 80 60 40 20 Ml 0 0 100 C. Fig. S3 Comparison of leukaemia incidence rate in the triple targeted chimaeric mice and germline-transmission translocator mice

More information

Premix Ex Taq (Probe qpcr)

Premix Ex Taq (Probe qpcr) For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.

More information

Regulatory B Cell Isolation Kit mouse

Regulatory B Cell Isolation Kit mouse For further information refer to our website www.miltenyibiotec.com For technical questions, please contact your local subsidiary or distributor. Technical Support Team, Germany: E-mail: macstec@miltenyibiotec.de

More information

EPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE

EPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE EpiQuik Chromatin Immunoprecipitation Kit Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Chromatin Immunoprecipitation Kit is suitable for combining the specificity of

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template Catalog # Description 172-5085 SingleShot SYBR Green Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot SYBR Green Kit prepares genomic DNA (gdna) free RNA directly from

More information

Figure S1. Purity of primary cultures of renal proximal tubular epithelial culture ascertained by cytokeratin staining.

Figure S1. Purity of primary cultures of renal proximal tubular epithelial culture ascertained by cytokeratin staining. Supplementary information Supplementary figures Figure S1. Purity of primary cultures of renal proximal tubular epithelial culture ascertained by cytokeratin staining. Figure S2. Induction of Nur77 in

More information

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time) Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.

More information

HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid

HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid SUPPLEMENTAL MATERIALS AND METHODS Cell culture, transfection and treatments. HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid encoding vmia (HeLa vmia) 1 were cultured

More information

SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes

SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes WHITE PAPER SuperScript IV Reverse Transcriptase SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes Abstract Reverse transcriptases (RTs) from avian myeloblastosis virus

More information

PrimeScript RT reagent Kit (Perfect Real Time)

PrimeScript RT reagent Kit (Perfect Real Time) Cat. # RR037A For Research Use PrimeScript RT reagent Kit (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Features... 4 V. Precautions...

More information

Modeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis

Modeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis icell Cardiomyocytes Application Protocol Modeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis Introduction Cardiac hypertrophy is characterized by several different cellular changes,

More information

Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death

Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death SUPPLEMENTAL DATA Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death Huajun Jin 1, Arthi Kanthasamy 1, Vellareddy Anantharam

More information

BioBank cdna kit. Instructions for the use of BioBank control cdna in real-time PCR

BioBank cdna kit. Instructions for the use of BioBank control cdna in real-time PCR BioBank cdna kit Instructions for the use of BioBank control cdna in real-time PCR Contents Introduction 3 Kit contents 4 Reagents and equipment to be supplied by user 4 Kit storage and stability 4 Primerdesign

More information

TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by

TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by Supplemental Information Cell Culture TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by transducing BBM1 or 361 cells with a lentivirus encoding shrna for TrkB. Transduction was

More information

Supplemental Information

Supplemental Information Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure

More information

Human T-lymphotropic Virus 1

Human T-lymphotropic Virus 1 PCRmax Ltd TM qpcr test Human T-lymphotropic Virus 1 Polymerase gene (POL) 150 tests For general laboratory and research use only 1 Introduction to Human T-lymphotropic Virus 1 Human T-lymphotropic Virus

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

Modulation of the anti-tumor immune response by complement. Maciej M. Markiewski, Robert A. DeAngelis, Fabian Benencia, Salome K.

Modulation of the anti-tumor immune response by complement. Maciej M. Markiewski, Robert A. DeAngelis, Fabian Benencia, Salome K. Modulation of the anti-tumor immune response by complement Maciej M. Markiewski, Robert A. DeAngelis, Fabian Benencia, Salome K. Ricklin- Lichtsteiner, Anna Koutoulaki, Craig Gerard, George Coukos & John

More information

Multiplex Fluorescence Assays for Adherence Cells without Trypsinization

Multiplex Fluorescence Assays for Adherence Cells without Trypsinization Multiplex Fluorescence Assays for Adherence Cells without Trypsinization The combination of a bright field and three fluorescent channels allows the Celigo to perform many multiplexed assays. A gating

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/323/5910/124/dc1 Supporting Online Material for Regulation of Neuronal Survival Factor MEF2D by Chaperone-Mediated Autophagy Qian Yang, Hua She, Marla Gearing, Emanuela

More information

Bacteriophage MS2. genesig Standard Kit. Phage MS2 genome. 150 tests. Primerdesign Ltd. For general laboratory and research use only

Bacteriophage MS2. genesig Standard Kit. Phage MS2 genome. 150 tests. Primerdesign Ltd. For general laboratory and research use only TM Primerdesign Ltd Bacteriophage MS2 Phage MS2 genome genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Bacteriophage MS2 Bacteriophage MS2 is a non-enveloped,

More information

Acinetobacter baumannii

Acinetobacter baumannii PCRmax Ltd TM qpcr test Acinetobacter baumannii hypothetical protein sequence gene 150 tests For general laboratory and research use only 1 Introduction to Acinetobacter baumannii Acinetobacter baumannii

More information

Viral Hemorrhagic Septicemia Virus

Viral Hemorrhagic Septicemia Virus Techne qpcr test Viral Hemorrhagic Septicemia Virus Non-coding region 150 tests For general laboratory and research use only 1 Introduction to Viral Hemorrhagic Septicemia Virus Viral Hemorrhagic Septicaemia

More information

SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency

SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Molecular Cell, Volume 52 Supplemental Information SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Kengo Homma, Takao Fujisawa, Naomi Tsuburaya, Namiko

More information

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin

More information

CASE-STUDY- VALIDATION of PCR based methodology. Beata Surmacz-Cordle Senior Analytical Development Scientist

CASE-STUDY- VALIDATION of PCR based methodology. Beata Surmacz-Cordle Senior Analytical Development Scientist CASE-STUDY- VALIDATION of PCR based methodology Beata Surmacz-Cordle Senior Analytical Development Scientist UK RMP Pluripotent Stem Cell Platform Validation Workshop 2 nd June 2016 RT-qPCR assay for detection

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Supplementary Figure. S1

Supplementary Figure. S1 Supplementary Figure. S1 Supplementary Figure S1. Correlation of phagocytic ability measured with YG and YO beads. Fresh human monocytes (2 10 6 /ml) were labelled with APC conjugated anti CD14 mab alone

More information

An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues

An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues Yoshikazu Nishiguchi 1*, Koichi Kitamura 1, Naoko Watanabe 2, Anna Kozaki 3, Hayato Otani

More information

Acinetobacter baumannii

Acinetobacter baumannii TM Primerdesign Ltd Acinetobacter baumannii hypothetical protein sequence gene genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to Acinetobacter baumannii Acinetobacter

More information

modifications: the RNA was precipitated by isopropanol at -20 C for more than 2 hours then

modifications: the RNA was precipitated by isopropanol at -20 C for more than 2 hours then Supplemental Information Materials and Methods RNA extraction and mirna assay Total RNA was extracted from cells using standard Trizol (Invitrogen) method with small modifications: the RNA was precipitated

More information

1. Cross-linking and cell harvesting

1. Cross-linking and cell harvesting ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine

More information

a Beckman Coulter Life Sciences: White Paper

a Beckman Coulter Life Sciences: White Paper a Beckman Coulter Life Sciences: White Paper Flow Cytometric Analysis of Endothelial Progenitor Cells Authors: Affiliation: Dorota Sadowicz, Vasilis Toxavidis, John Tigges Beth Israel Deaconess Medical

More information

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at

More information

Protocol for induction of expression and cell lysate production

Protocol for induction of expression and cell lysate production Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected

More information

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective

More information

Table of Contents 1.0 Introduction Thawing Cells, Plating and Colony Enumeration...2

Table of Contents 1.0 Introduction Thawing Cells, Plating and Colony Enumeration...2 i Table of Contents 1.0 Introduction...1 2.0 Thawing Cells, Plating and Colony Enumeration...2 2.1 Supplies and Reagents Included in the QC Kit...2 2.2 Additional Reagents and Equipment Necessary to Perform

More information

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of

More information

Instructions for Use. RealStar Lassa Virus RT-PCR Kit /2017 EN

Instructions for Use. RealStar Lassa Virus RT-PCR Kit /2017 EN Instructions for Use RealStar Lassa Virus RT-PCR Kit 1.0 04/2017 EN RealStar Lassa Virus RT-PCR Kit 1.0 For research use only! (RUO) 641003 INS-641000-EN-S01 96 04 2017 altona Diagnostics GmbH Mörkenstr.

More information

Human T-lymphotropic Virus 1

Human T-lymphotropic Virus 1 TM Primerdesign Ltd Human T-lymphotropic Virus 1 Polymerase gene (POL) genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to Human T-lymphotropic Virus 1 Human T-lymphotropic

More information

M. tuberculosis_mpb64/is611. genesig Advanced Kit. 150 tests. Primerdesign Ltd. For general laboratory and research use only

M. tuberculosis_mpb64/is611. genesig Advanced Kit. 150 tests. Primerdesign Ltd. For general laboratory and research use only TM Primerdesign Ltd M. tuberculosis_mpb64/is611 0 genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to M.tuberculosis_MPB64/IS6110 2 Specificity MAX MIN The Primerdesign

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Svegliati Baroni S, Santillo M, Bevilacqua F, et al. Stimulatory

More information

DNA Microarray Technology

DNA Microarray Technology CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic

More information

Dengue Virus subtypes 1,2 3 and 4

Dengue Virus subtypes 1,2 3 and 4 TM Primerdesign Ltd Dengue Virus subtypes 1,2 3 and 4 3 Untranslated Region (3 UTR) genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Dengue Virus subtypes 1,2

More information

Gene Expression Profiling Applicable for Cells Cultivated in Channel-Slides

Gene Expression Profiling Applicable for Cells Cultivated in Channel-Slides Gene Expression Profiling Applicable for Cells Cultivated in Channel-Slides Gene expression profiling provides information about the transcriptome of a living cell. The DNA is transcribed into mrna, when

More information

Cell were phenotyped using FITC-conjugated anti-human CD3 (Pharmingen, UK)

Cell were phenotyped using FITC-conjugated anti-human CD3 (Pharmingen, UK) SUPPLEMENTAL MATERIAL Supplemental Methods Flow cytometry Cell were phenotyped using FITC-conjugated anti-human CD3 (Pharmingen, UK) and anti-human CD68 (Dako, Denmark), anti-human smooth muscle cell α-actin

More information

Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh

Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon

More information

Supplementary Information: ITGAV and ITGA5 diversely regulate proliferation and adipogenic differentiation of human adipose derived stem cells

Supplementary Information: ITGAV and ITGA5 diversely regulate proliferation and adipogenic differentiation of human adipose derived stem cells Supplementary Information: ITGAV and ITGA5 diversely regulate proliferation and adipogenic differentiation of human adipose derived stem cells E. M. Morandi, R. Verstappen, M. E. Zwierzina, S. Geley, G.

More information

Table of content. One Step SYBR R PrimeScript TM RT-PCR Kit II (Perfect Real Time) I. Description...2. II. Principle III. Kit Contents...

Table of content. One Step SYBR R PrimeScript TM RT-PCR Kit II (Perfect Real Time) I. Description...2. II. Principle III. Kit Contents... Table of content I. Description...2 II. Principle... 2 III. Kit Contents...4 IV. Storage...5 V. Features...5 VI. Note...5 VII. Protocol...6 VIII. Experiment Example...11 IX. Appendix...12 X. Guideline

More information

EdU Flow Cytometry Kit. User Manual

EdU Flow Cytometry Kit. User Manual User Manual Ordering information: (for detailed kit content see Table 2) EdU Flow Cytometry Kits for 50 assays: Product number EdU Used fluorescent dye BCK-FC488-50 10 mg 6-FAM Azide BCK-FC555-50 10 mg

More information

Quantitative Real Time PCR USING SYBR GREEN

Quantitative Real Time PCR USING SYBR GREEN Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to

More information

Quant Reverse Transcriptase

Quant Reverse Transcriptase 1. Quant Reverse Transcriptase For first-strand cdna synthesis and two-step RT-PCR www.tiangen.com RT080530 Kit Contents Quant Reverse Transcriptase Contents Cat. no. ER103 ER103-02 25 rxns ER103-03 50

More information

COMPONENT NAME COMPONENT # QUANTITY STORAGE SHELF LIFE FORMAT. Do not freeze. Store at 2-8 C. Do not freeze. Store at 2-8 C.

COMPONENT NAME COMPONENT # QUANTITY STORAGE SHELF LIFE FORMAT. Do not freeze. Store at 2-8 C. Do not freeze. Store at 2-8 C. This document is available at www.stemcell.com/pis Positive Selection Catalog #7896 EasySep Human Cord Blood CD3 Positive For processing 000 ml of cord blood Description Isolate highly purified CD3+ cells

More information

Applications and Uses. (adapted from Roche RealTime PCR Application Manual)

Applications and Uses. (adapted from Roche RealTime PCR Application Manual) What Can You Do With qpcr? Applications and Uses (adapted from Roche RealTime PCR Application Manual) What is qpcr? Real time PCR also known as quantitative PCR (qpcr) measures PCR amplification as it

More information

Khaled_Fig. S MITF TYROSINASE R²= MITF PDE4D R²= Variance from mean mrna expression

Khaled_Fig. S MITF TYROSINASE R²= MITF PDE4D R²= Variance from mean mrna expression Khaled_Fig. S Variance from mean mrna expression.8 2 MITF.6 TYROSINASE.4 R²=.73.2.8.6.4.2.8.6.4.2.8.6.4.2 MALME3M SKMEL28 UACC257 MITF PDE4D R²=.63 4.5 5 MITF 3.5 4 PDE4B 2.5 3 R²=.2.5 2.5.8.6.4.2.8.6.4.2

More information

Reverse Transcriptase Reverse Transcriptase 100 µl 5X RT Buffer 0.1 M DTT 500 µl Storage -20 C for 24 months

Reverse Transcriptase Reverse Transcriptase 100 µl 5X RT Buffer 0.1 M DTT 500 µl Storage -20 C for 24 months www.smobio.com Product Information Reverse Transcriptase ExcelRT series RP1000 20,000 units Reverse Transcriptase 100 µl 5X RT Buffer 1 ml 0.1 M DTT 500 µl Storage -20 C for 24 months Description The ExcelRT

More information

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα

More information

Immunophenotyping of Peripheral Blood and Bone Marrow Cells by Flow Cytometry *Akanni EO and # Palini A.

Immunophenotyping of Peripheral Blood and Bone Marrow Cells by Flow Cytometry *Akanni EO and # Palini A. Immunophenotyping of Peripheral Blood and Bone Marrow Cells by Flow Cytometry *Akanni EO and # Palini A. * Department of Haematology & Blood Transfusion,College of Health Science, Ladoke Akintola University

More information

Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2

Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2 Molecular Cell, Volume 65 Supplemental Information The TRAIL-Induced Cancer Secretome Promotes a Tumor-Supportive Immune Microenvironment via CCR2 Torsten Hartwig, Antonella Montinaro, Silvia von Karstedt,

More information

Mitochondria/Cytosol Fractionation Kit

Mitochondria/Cytosol Fractionation Kit Mitochondria/Cytosol Fractionation Kit Sufficient for analysis of 50 samples Cat. No. MIT1000 FOR RESEARCH USE ONLY Not for use in diagnostic procedures. USA & Canada Phone: +1(800) 437-7500 Fax: +1 (951)

More information

TOOLS sirna and mirna. User guide

TOOLS sirna and mirna. User guide TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)

More information