Supplementary Figure S1. MKRN1 depletion induces apoptosis via the caspase-8 pathway. kda h 72h 96h 6.8 % 22.5 % 21.

Transcription

1 Supplementry Figure S1. depletion indues poptosis vi the spse-8 pthwy. Atin h 72h 96h zvad 96h 5. % 6.8 % 8.7 % 4.3% simk1#5 9.5 % 22.5 % 39.6 % 11.8 % simk1#6 8. % 21.7 % 33.5 % 11. % 48h 72h 96h zvad 96h 3.1% simk1# AAD simk1# Supplementry Figure S1. depletion indues poptosis vi the spse-8 pthwy. () HeL ells were trnsfeted with 2 nm of ontrol sirna () or two kinds of sirna (simk1#5 or simk1#6) for 48 h. Expression levels of were mesured y western lot nlysis. () HeL ells were trnsfeted with 2 nm of the indited sirnas. z-vad-fmk (zvad, 2 µm) ws dded t 24 h post-trnsfetion. At 48, 72, nd 96 h posttrnsfetion, ells were stined with propidium iodide (PI) nd nlyzed y flow ytometry. The dt re summrized in Fig. 1. () HeL ells, trnsfeted nd treted with zvad s desried ove, were hrvested, immeditely stined with Annexin V nd 7-AAD, nd then nlyzed y flow ytometry. The perentges of the Annexin V/7-AAD- frtions re shown in Fig. 1. 1

2 Supplementry Figure S2. depletion indues ell deth in oth p53-positive nd p53-negtive ells. U2OS (p53 positive) simk1#5 simk1#6 H1299 (p53 negtive) simk1#5 simk1#6 48h 6.1% 15.3% 11.7% 48 h 3.6% 8.5% 6.5% 96h 6.4% 47.6%.2% 96 h 4.5% 31.8% 28.3% HCT116 p53/ HCT116 p53-/- simk1#5 simk1#6 simk1#5 simk1#6 48 h 8.8% 18.6% 14.8% 48 h 9.8% 15.9% 13.8% 96 h 11.6% 51.4% 32.3% 96 h 14.1% 33.9% 28.7% 6 Su G1 (%) simk1#5 simk1# h 96 h 48 h 96 h 48 h 96 h 48 h 96 h U2OS H1299 HCT116 p53/ HCT116 p53-/- Supplementry Figure S2. depletion indues ell deth in oth p53-positive nd p53-negtive ells. (, ) p53-positive (U2OS nd HCT116 p53/) nd p53-negtive (H1299 nd HCT116 p53-/-) ells were trnsfeted with 2 nm of ontrol sirna () or two kinds of sirna (simk1#5 or simk1#6). Then, 48 h or 96 h fter trnsfetion, ells were hrvested using trypsin, fixed in ethnol, stined with propidium iodide nd nlyzed y flow ytometry. The perentges of ells in the sug1 phse re shown in Supplementry Fig. S2. 2

3 Supplementry Figure S3. knokdown inreses poptosis upon nti-fs nd TRAIL tretment. 1 1 Cell Viility (%) shgfp shmk1#2 Cell Viility (%) shgfp shmk1#2 shmk1# αfs (ng/ml) shmk1# TRAIL (ng/ml) Supplementry Figure S3. knokdown inreses poptosis upon nti-fs nd TRAIL tretment. HeL ells stly expressing shgfp nd sh (shmk1#2 or shmk1#5) were treted with nti-fs ntiody (αfs) plus 5 µg/ml of CHX () or TRAIL () for 6 h t the indited onentrtions. Cell viility ws determined y mesuring intrellulr levels of ATP using the Cell Titer Glo Luminesent Cell Viility Assy kit. Dt re mens ± s.d.; n=3, P<.5, P<.1, P<.1 ompred to shgfp. 3

4 Supplementry Figure S4. depletion filittes morphologil hnges upon nti-fs nd TRAIL tretment. Csp8 inhiitor (C8i) αfs αfs/chx TRAIL TRAIL/CHX αfs/chx TRAIL/CHX αfs/chx TRAIL/CHX zvad Cell Viility (%) αfs/chx αfs/chx Ne-1 TRAIL TRAIL Ne-1 simk1#6 simk1#5 αfs αfs/chx TRAIL TRAIL/CHX αfs/chx TRAIL/CHX αfs/chx TRAIL/CHX simk1#6 simk1#5 simk1#5 simk1#6 DMSO Csp8 inhiitor zvad Supplementry Figure S4. depletion filittes morphologil hnges upon nti-fs nd TRAIL tretment. () The morphology of HeL ells with lted fter αfs (5 ng/ml) nd TRAIL (5 ng/ml) tretment for 3 h. CHX (5 µg/ml) ws used to enhne poptosis. Cells were pretreted with 2 µm sp8 inhiitor or zvad for 24 h. () HeL ells with sirna were treted s desried ove. After 6 h, ell viility ws mesured using the Cell Titer Glo Luminesent Cell Viility Assy kit. Dt re mens ± s.d.; n=3, P<.5, P<.1, P<.1 ompred to. () HeL ells with knoked-down were treted with αfs (5 ng/ml) plus CHX (5 µg/ml) or TRAIL (5 ng/ml) in the sene or presene of Ne-1 (3 µm) for 3 h. Morphologil hnges in ells undergoing ell deth were deteted using mirosope. 4

5 Supplementry Figure S5. Altion of inreses poptosis upon nti-fs nd TRAIL tretment. αfs/chx TRAIL Csp8 inhiitor (C8i) αfs/chx TRAIL simk1# AAD simk1# WB: Csp8 simk1 34 αfs/chx - - C8i C9i zvad TRAIL - - C8i C9i zvad p/p53 p/p41 WB: Csp9 WB: p18 Pro-sp9 Cleved -sp9 Pro-sp3 Csp3 17 Cleved -sp3 WB: Atin Cell Viility (%) NS simk1 - - C8i C9i zvad - C8i C9i zvad - αfs/chx TRAIL Supplementry Figure S5. Altion of inreses poptosis upon nti-fs nd TRAIL tretment. () -depleted HeL ells were treted with αfs (5 ng/ml) plus CHX (5 µg/ml) or TRAIL (1 ng/ml) lone for 3 h in the sene nd presene of 2 µm sp8 inhiitor. Cells were sujeted to Annexin V/7-AAD stining. () HeL ells, trnsfeted with 2 nm of or simk1#5, were treted with αfs (5 ng/ml) plus CHX (5 µg/ml) or TRAIL (5 ng/ml) lone for 3 h in the presene of 2 µm of C8i (spse-8 inhiitor), C9i (spse-9 inhiitor), or zvad (pn-spse inhiitor). Cells were hrvested nd spse levge ws deteted using the indited ntiodies. () HeL ells, trnsfeted nd treted s desried ove. After 6 h of deth stimuli, viility ws mesured using the Cell Titer Glo Luminesent Cell Viility Assy kit. Dt re mens ± s.d.; n=3, P<.5, P<.1, NS;non-sepifi. 5

6 Supplementry Figure S6. Arogtion of filittes spse-8 levge y induing rpid formtion of the DISC omplex. IP: Fs Input zvad shgfp shmk1 αfs/chx (h) WB: Fs WB: Fs zvad simk1 IP: Csp8 Input αfs/chx (h) IgG WB: Csp8 WB: Csp8 zvad simk1 IP: Csp8 Input TRAIL (h) IgG WB: Csp8 WB: Csp8 Supplementry Figure S6. Arogtion of filittes spse-8 levge y induing rpid formtion of the DISC omplex. () HeL ells in 1-mm-dimeter dishes were trnsfeted with sirnas. At 24 h post-trnsfetion, 1 µm zvad ws dded to ells. Cells were then inuted for n dditionl 24 h nd treted with αfs (5 ng/ml) nd CHX (5 µg/ml) s indited. Cell lystes were immunopreipitted with nti-fas ntiody, followed y western lotting with nti-fadd ntiody. (, ) HeL ells, trnsfeted with sirnas, were pretreted with zvad for 24 h. Cells were treted with αfs, CHX, nd TRAIL s indited. Cell lystes were immunopreipitted with nti-spse-8 ntiody, followed y western lot nlysis using nti-fadd ntiodies. Control IgG ws used s negtive ontrol. 6

7 Supplementry Figure S7. knokdown inreses TNF-α indued poptosis y filitting omplex II formtion. TNF TNF/CHX TNF Csp8 inhiitor TNF simk1#5 simk1# AAD simk1#6 simk1# Cell viility (%) shgfp shmk1#2 shmk1#5 TNF/CHX d TNF (h) WB: Csp8 WB: Csp3 WB: RIP1 simk e IP: Csp8 Input TNF (h) WB: RIP1 WB: Csp8 WB: RIP1 WB: Csp8 simk WB: Atin Supplementry Figure S7. knokdown inreses TNF-α indued poptosis y filitting omplex II formtion. () Morphologil hnges in HeL ells upon TNF-α tretment. HeL ells were trnsfeted with 2 nm sirnas for 48 h nd treted with 1 ng/ml of humn TNF-α (TNF) in the sene or presene of CHX (5 µg/ml). Cells were visulized y mirosopy. () Detetion of poptosis y Annexin V/7-AAD stining. HeL ells, trnsfeted nd treted with 1 ng/ml of TNF-α in the sene or presene of 2 µm spse-8 inhiitor, were hrvested using trypsin, wshed with PBS, stined with Annexin V nd 7-AAD, nd nlyzed y flow ytometry. () Viility of HeL ells with depletion upon TNF-α stimultion in the presene of CHX. Cells were trnsfeted nd treted s desried ove. Cell viility ws determined using the Cell Titer Glo Luminesent Cell Viility Assy kit. Dt re mens ± s.d.; n=3. (d) Western lot nlysis of HeL ells treted with TNF-α. HeL ells were trnsfeted with the indited sirnas nd stimulted with TNF-α. Cspse tivtion nd RIP1 levge were determined y western lotting using the indited ntiodies. (e) HeL ells were trnsfeted with sirnas. Twenty-four hours posttrnsfetion, 2 µm of z-vad-fmk ws dded to the ells for n dditionl 24 h. Cells were treted with 1 ng/ml of TNF-α s indited. Cell lystes were immunopreipitted with nti-spse-8 got ntiody, followed y western lot nlysis using nti-rip1 mouse ntiody. 7

8 Supplementry Figure S8. Degrdtion of FADD is not prevented y lysosoml inhiitor, while depletion inreses FADD stility. f. A1 CHX (h) FADD Atin simk1 CHX (h) FADD Atin Supplementry Figure S8. Degrdtion of FADD is not prevented y lysosoml inhiitor, while depletion inreses FADD stility. () HeL ells were treted with 4 µg/ml of CHX in the sene or presene of.2 µm filomyin A1 (f. A1). FADD protein stility ws determined y western lotting. () HeL ells, trnsiently trnsfeted with sirnas, were treted with 4 µg/ml of CHX. FADD protein stility ws determined y western lot nlysis. 8

9 Supplementry Figure S9. interts with FADD. IP : HA WCE IP : FLAG WCE HA-FADD FLAG- WB : FLAG FLAG- HA-FADD WB : HA WB : HA 37.8 WB : FLAG 61.5 IP: HA HA-FADDs FLAG- WB: HA DED Deth Domin 28 Binding - - WCE inding domin d IP:HA Input HA-FADD FLAG- H37E FLAG- WT WB: FLAG 61.5 WB: HA 37.8 Supplementry Figure S9. interts with FADD. (, ) Reiprol intertion etween FLAG- nd HA-FADD. HeL ells were trnsfeted with plsmids expressing FLAG- nd HA-FADD s indited. Cell lystes were immunopreipitted with nti-ha mouse ntiody () or nti-flag mouse ntiody (), followed y western lot nlysis using nti-ha rit nd nti-flag rit ntiodies. () Mpping of FADD domins responsile for the intertion. HeL ells were trnsfeted with the indited plsmids. Cell lystes were immunopreipitted with α-ha ntiody nd nlyzed using n α-flg ntiody. Shemti digrms of the FADD deletion mutnts re provided in the lower pnel. (d) Intertion etween the H37E mutnt nd FADD. 9

10 Supplementry Figure S1. Reintrodution of shr- into knokdown ells delys spse levge. αfs/chx TRAIL shr-h37e shr-wt shmk shgfp WB: Csp8 p/p53 p/p41 p18 WB: Csp3 Pro-sp3 Clevedsp3 Supplementry Figure S1. Reintrodution of shr- into knokdown ells delys spse levge. HeL/sh ells reonstituted with shr-wt or shr-h37e were treted with nti-fs (5 ng/ml) CHX (5 µg/ml) or TRAIL (1 ng/ml) for 3 h. Cspse-8 nd psse-3 levge ws nlyzed y western lotting. 1

11 Supplementry Figure S11. depletion filittes neroptosis under spse inhiition y enhning nerosome formtion in L929 ells. L929 ells mt mt/n mt/z mt/z/n 4.2% FADD RIP1 RIP3 Atin simmk1#1 simmk1# SSC Annexin V positive ells (%) simmk1#1 simmk1#2 Un mt mt/n mt/z mt/z/n d Cell Loss (%) simmk1#1 simmk1#2 Un mt mt/n mt/z mt/z/n Supplementry Figure S11. depletion filittes neroptosis under spse inhiition y enhning nerosome formtion in L929 ells. () L929 ells were trnsfeted with 5 nm of ontrol sirna () nd two kinds of mouse sirna (simmk1#1 or simmk1#2) for 72 h. Expression levels of, FADD, RIP1, nd RIP3 were mesured y western lotting. (, ) L929 ells were trnsfeted with 5 nm of the indited sirnas for 48 h. Cells were treted with the omintion of 5 ng/ml mtnf-α (mt), 1 µm z-vad-fmk (Z), nd 3 µm Ne-1 (N) s indited for 3 h. Cells undergoing neroptosis were deteted y Annexin V stining nd onfirmed y Ne-1 tretment. The men perentges of Annexin V-positive ells from three independent experiments performed in triplite re shown in (). Representtive dot plot dt re presented in (). Dt re mens ± s.d.; n=3, P<.5, P<.1, P<.1 ompred to. (d) L929 ells, trnsfeted with the indited sirnas nd treted s desried ove. Cell deth ws ssessed y mesuring intrellulr ATP levels using the Cell Titer Glo Luminesent Cell Viility Assy kit. Dt re mens ± s.d.; n=3, P<.1, P<.1 ompred to. 11

12 Supplementry Figure S12. depletion filittes neroptosis under spse inhiition y enhning nerosome formtion. shmk1 shgfp 72 simk1 #5 simk1 #6 FADD hrip1 hrip3 Atin shgfp shmk1 HT-29 ells Z lone T lone T/C T/C/Z T/C/Z/N T/C T/C/N T/C/Z T/C/Z/N d SSC Annexin V positive ells (%) 8 shgfp 6 shmk1 4 2 SSC e Cell loss (%) shgfp shmk1 f Input IP: Csp8 zvad T/C WB: hrip3 WB: hrip1 WB: Csp8 WB: hrip3 WB: hrip1 IgG shgfp shmk Supplementry Figure S12. depletion filittes neroptosis under spse inhiition y enhning nerosome formtion. () HT-29 ells were trnsfeted with 3 nm of ontrol sirna () nd two kinds of sirna (simk1#5 or simk1#6) for 48 h. Expression levels of, FADD, RIP1 nd RIP3 were mesured y western lot nlysis. () HT-29 ells stly expressing shgfp or sh were treted for 12 h s indited. Cells undergoing neroptosis were deteted y Annexin V stining nd onfirmed y Ne-1 tretment. Arevitions re s follows: T, TNFα (3 ng/ml); C, CHX (5 µg/ml); Z, z-vad-fmk (3 µm); N, Nerosttin-1 (3 µm). (, d) HT-29 ells stly expressing shgfp or sh were treted with omintion of TNFα (T), CHX (C), z-vad-fmk (Z), nd Ne-1 (N) s indited for 16 h. Neroptoti ell deth ws mesured y Annexin V stining. The men perentges of Annexin V-positive ells from three independent experiments performed in triplite re shown in () (Error rs indites s.d. P<.1, ompred to shgfp). Representtive dot plot dt re presented in (d). (e) Cell deth in HT-29 stle ell lines treted s desried ove ws ssessed using the Cell Titer Glo Luminesent Cell Viility Assy kit. Error rs indites s.d. n=3, P<.1, P<.1, ompred to shgfp. (f) HT-29 ells were treted with TNFα nd CHX (T/C) in the sene or presene of z-vad-fmk (Z) for 4 h. Cell lystes were immunopreipitted with ntispse-8 ntiodies, followed y western lot nlysis using nti-rip1 nd nti-hrip3 ntiodies. The sterisk () indites phosphorylted RIP3 s previously reported

13 Supplementry Figure S13. Knokdown of promotes neroptosis in FADD-independent mnner, ut FADD stiliztion upon knokdown inhiits neroptosis in HT-29 ells. T/C/Z T/C/Z/N Annexin V positive ells (%) shgfp shgfp shmk1 shfadd shfadd shmk1 shmk1 T/C/Z T/C/Z/N shfadd shmk1 6.1% shfadd SSC IP: hrip3 Input shgfp shfadd T/C/Z 4h WB: hrip1 WB: hrip3 WB: hrip1 WB: hrip3 IgG shmk1 shfadd shmk d simk1 12.2% sifadd sifadd simk1 SSC T/C/Z Supplementry Figure S13. Knokdown of promotes neroptosis in FADD-independent mnner, ut FADD stiliztion upon knokdown inhiits neroptosis in HT-29 ells. (, ) HT-29 ells stly expressing the indited shrnas were treted with 3 ng/ml humn TNF-α, 5 µg/ml CHX nd 3 µm z-vad-fmk (T/C/Z) in the sene nd presene of 3 µm Ne-1 (T/C/Z/N). Neroptoti ell deth ws mesured y Annexin V stining. The men perentges of Annexin V-positive ells from three independent experiments performed in triplite re shown in () (Error rs indites s.d. P<.1, ompred to shgfp). Representtive dot plot dt re presented in (). () HT-29 stle ell lines were treted with TNFα, CHX nd zvad (T/C/Z) for 4h s desried in Supplementry Fig. S12f. Cell lystes were immunopreipitted with nti-hrip3 ntiody, followed y western lot nlysis using nti- RIP1, nti-fadd, nd nti-hrip3 ntiodies. (d) HT-29 ells, trnsfeted with the indited sirnas (3 nm, eh) for 48 h, were treted with TNFα, CHX nd zvad (T/C/Z) for 12 h. Cells undergoing neroptosis were deteted y Annexin V stining. 13

14 Supplementry Figure S14. FADD stiliztion upon knokdown prevents neroptosis in L929 ells. simmk1 simfadd simfadd simmk1 5.9% mt/z/n mt/z SSC mt/z Mok HA-FADD 4.2% SSC mt/z/n Supplementry Figure S14. FADD stiliztion upon knokdown prevents neroptosis in L929 ells. () L929 ells were trnsfeted with the omintion of 3 nm mouse sirna #1 (simmk1) nd 3 nm mouse FADD sirna pool (simfadd) s indited. Control sirna ws used to keep the sirna onentrtion to 6 nm. Cells were treted with 5 ng/ml of mtnfα nd 1 µm of z-vad-fmk with or without 3 µm of Ne-1 (mt/z or mt/z/n) for 3 h. Cells undergoing neroptosis were deteted y Annexin V stining nd onfirmed y Ne-1 tretment. () L929 ells were trnsfeted with plsmid expressing HA-FADD. Cells were treted with mtnfα, z-vad-fmk, nd Ne-1 s indited for 4 h. Cells undergoing neroptosis were deteted y Annexin V stining nd onfirmed y Ne-1 tretment. 14

15 Supplementry Figure S15. is overexpressed in rest ner ell lines. d Reltive mount WB: Atin FADD MCF1A MCF7 T47D MDA-MB-468 BT2 ZR-75-1 SK-BR-3 JIMT Hs578T MBA-MB-231 e Reltive FADD protein ZR-75-1 T47D MCF7 MB-231 JIMT BT-2 Hs578T MB-468 SK-BR Reltive protein Cell Viility (%) MCF7 T47D MDA-MB-468 BT-2 Cell Viility (%) ZR-75-1 SK-BR-3 JIMT Hs578T MDA-MB-231 f g Cell Viility (%) TRAIL (ng/ml) TRAIL (ng/ml) IMR9 A549 H1299 H46 h i Cell Viility (%) TRAIL (ng/ml) TRAIL (ng/ml) RKO SW48 HCT116 WB: Atin WB: Atin 15

16 Supplementry Figure S15. is overexpressed in rest ner ell lines. () Expression of nd FADD in the norml rest ell line MCF1A nd the rest ner ell lines MCF7, T47D, SK-BR-3, MDA-MB-231, MDA-MB-468, Hs578T, BT-2, JIMT nd ZR-75-1 s determined y western lot nlysis. () Reltive expression levels of nd FADD in rest ner ell lines were quntified y densitometry, normlized to tin, nd indited in the grph. () An inverse orreltion etween nd FADD expression in rest ner ell lines, exluding MCF1A, is shown in the grph. (d, e) Brest ner ell lines were treted with inresing onentrtions of TRAIL for 24 h. Cell viility ws determined y mesuring intrellulr levels of ATP using the Cell Titer Glo Luminesent Cell Viility Assy kit. The results from three independent experiments re summrized in the grph. Dt re mens ± s.d. n=3. (f) Lung firolst (IMR9) nd ner ell lines (H46, H1299, nd A549) were treted with inresing onentrtion of TRAIL for 24 h. Cell viility ws determined s desried ove. The results from three independent experiments re summrized in the grph. Dt re mens ± s.d. n=3. (g) Expression of nd FADD in lung ell lines were determined y western lot nlysis. (h) The TRAIL-sensitivity of olon ner ell lines inluding RKO, SW48, nd HCT116 ws evluted s desried ove. The results from three independent experiments re summrized in the grph. Dt re mens ± s.d. n=3. (i) Expression of nd FADD in olon ner ell lines were evluted y western lot nlysis. 16

17 Supplementry Figure S16. Depletion of FADD rogtes TRAIL-medited poptosis in -knokdown ells. sicontrol simk1 sifadd sifadd simk1 TRAIL TRAIL sifadd pool simk WB: Csp8 34 p/p53 p/p41 17 p18 WB: Csp Pro-sp3 Clevedsp3 WB: Atin Supplementry Figure S16. Depletion of FADD rogtes TRAIL-medited poptosis in -knokdown ells. () MDA-MB-231 ells were trnsfeted with the omintion of 2 nm of sirna #5 (simk1) nd 2 nm FADD sirna pool (sifadd pool) s indited. Control sirna ws used to keep the sirna onentrtion to 4 nm. Forty-eight hours post-trnsfetion, ells were treted with 1 ng/ml TRAIL for 3 h. The morphologil hnges upon TRAIL tretment were visulized y mirosopy. () MDA-MB-231 ells were trnsfeted with sirnas nd treted with TRAIL s desried ove. Clevge of spse-8 nd -3 ws nlyzed y western lotting. 17

18 Supplementry Methods sirna-medited ltion of nd FADD Two kinds of flexitue sirnas (Hs 5; GGCGAAGCTGAGTCAAGAA nd Hs 6; (CG)GGATCCTCTCCAACTGCAA) otined from Qigen were resynthesized. FADD sirna (Hs_FADD_9, SI364916, (CA)GCGGGATCTCGTATCTTTA) ws purhsed nd resynthesized from Qigen nd used in the experiments presented in Fig. 3f. Mouse sirnas (sim#1; CAGGCGAAGCTGAGTCAAG nd sim#2; CAGAGGTCACAGCACATAA from Qigen (SI7337)) were synthesized y Qigen. Control sirna ws lso purhsed from Qigen-Xergon. ON-TARGET plus SMARTpool for humn FADD sirna (L- 38-) nd mouse FADD sirna (L-4488-) were purhsed from Dhrmon. HeL, MDA-MB-231, L929, nd HT-29 ells were trnsfeted with sirnas using Lipofetmine RNAiMx (Invitrogen) using the reversetrnsfetion method ording to the mnufturer s protool. Genertion of stle ell lines. Mission lentivirl shrna expression vetors for humn, humn FADD, nd ontrol GFP were purhsed from Sigm-Aldrih. sh#2 (TRCN4125, CCGGCCAGAGGTCACAGCACATAAAC TCGAGTTTATGTGCTGTGACCTCTGGTTTTTG), sh#5 (TRCN324883, CGGGTGTTGGATC ACTTGCTGAAACTCGAGTTTCAGCAAGTGATCCAACACTTTTTG), shfadd#1 (CCGGGTGCAGCATT TAACGTCATATCTCGAGATATGACGTTAAATGCTGCACTTTTTG), nd shfadd#2 (CCGGCATGGAAC TCAGACGCATCTACTCGAGTAGATGCGTCTGAGTTCCATGTTTTTG) were le to suppress endogenous expression nd were thus used in this study. 293FT ells were trnsfeted with plko.1 shrna-expressing vetor nd pkging vetors for 48 h, nd then superntnts were hrvested, filtrted, nd trnsferred to HeL nd MDA-MB-231 ells. shrna-expressing ells were seleted y puromyin tretment for 7 dys. For reonstitution, DNA ws suloned into the pbe-puro vetor, nd two ytosines of trgeted y shrna#2 were mutted into denine without hnging the mino id sequene. 293FT ells were trnsfeted with pbe-puro-shr- WT nd H37E or vetor lone in the presene of retrovirl pkging vetors for 48 h, nd then superntnts were hrvested, filtrted, nd trnsferred to HeL/sh#2 ells. Reverse trnsription (RT)-PCR nlysis Totl RNA ws extrted using Trizol regent (Invitrogen) ording to the mnufturer s instrution. DNA ws synthesized from 1 µg of totl RNA using Reverse Trnsriptse M-MLV (Tkr), mplified, nd then nlyzed using the QuntiTet SYBR Green PCR Kit nd rel-time PCR (Qigen) with the following primers: humn FADD, 5 -CAC 18

19 AGA CCA CCT GCT TCT GA-3 (forwrd) nd 5 -CTG GAC ACG GTT CCA ACT TT -3 (reverse); humn, 5 -GAG AAG GAC ATG GAG CTC TCA-5 (forwrd) nd 5 -CGC CTT GTT GCT CAT TGC CTC-3 (reverse). The primers used for glyerldehyde-3-phosphte dehydrogense were desried previously. 19