SUPPLEMENTARY INFORMATION

Transcription

1 doi: /nture Glc Gln Supplementry Figure 1., Reltive prolifertion of PDAC cell lines (8988T, Tu8902, Pnc1, Mipc2, PL45 nd MPnc96) nd low pssge primry humn PDAC cell lines (#1 nd #2) under conditions indicted. Cells were plted in complete culture medi (10mM glucose nd 2mM Gln) which ws replced the following dy with glucose- or Gln-free medium supplemented with 10% dilyzed FBS nd ssyed for prolifertion. At the indicted time points, cells were fixed in 10% formlin nd stined with 0.1% crystl violet. Dye ws extrcted with 10% cetic cid nd the reltive prolifertion ws determined y OD t 595 nm., Representtive wells of the clonogenic growth experiment depicted in Fig.1. Error rs represent s.d. of triplicte wells from representtive experiment. P <

2 RESEARCH SUPPLEMENTARY INFORMATION c d Glc Gln αkg NEAA shgls1 e Supplementry Figure 2., Reltive prolifertion of 8988T cells expressing control shrna () or shrnas to GLS (#1 nd #2)., Representtive wells of the clonogenic growth experiment depicted in Fig.1. c, Reltive clonogenic growth of 8988T under conditions indicted. Glu (4mM) ws dded to medi fter Gln-withdrwl nd clonogenic growth ws ssessed. d, Representtive wells of the clonogenic growth experiment depicted in Fig.1d. e, Reltive prolifertion of PDAC cell lines (8988T, Tu8902, Pnc1, Mipc2, PL45 nd MPnc96). NEAA mixture (0.1 mm glycine, lnine, sprtte, sprgine, proline nd serine), dimethyl αkg (4mM), or the comintion ws dded to medi fter Gln-withdrwl nd cellulr prolifertion ws ssyed. Error rs represent s.d. of triplicte wells from representtive experiment. P <

3 RESEARCH Supplementry Figure 3. nd, PDAC cell lines (8988T, Tu8902, Pnc1, Mipc2, PL45 nd MPnc96) were treted with either AOA (minooxycette) or EGCG (epiglloctechin gllte) nd ssyed for cellulr prolifertion. Error rs represent s.d. of triplicte wells from representtive experiment. P <

4 RESEARCH SUPPLEMENTARY INFORMATION shpsat1 shgpt2 shglud1 Supplementry Figure 4., Reltive prolifertion of 8988T cells expressing control shrna (), shrnas to GLUD1 (#1 nd #2), (#1 nd #2), GPT2 (#1 nd #2) or PSAT1 (#1 nd #2). Quntittive RT-PCR confirmed the knockdown efficiency of the shrnas., Representtive wells of the clonogenic growth experiment depicted in Fig.2. Error rs represent s.d. of triplicte wells from representtive experiment. P <

5 RESEARCH Reltive Colony Numer Tu8902 Mipc2 Pnc1 shrna Tu8902 Mipc2 Pnc1 Supplementry Figure 5., Reltive prolifertion of PDAC cell lines (Tu8902, Pnc1, Mipc2, PL45 nd MPnc96) nd low pssge primry humn PDAC cell lines (#1 nd #2) expressing control shrna () or shrnas to (#1 nd #2)., Reltive clonogenic growth of Tu8902, Mipc2 nd Pnc1 cells expressing control shrna () or shrnas to (#1 nd #2). Error rs represent s.d. of triplicte wells from representtive experiment. P <

6 RESEARCH SUPPLEMENTARY INFORMATION Reltive Metolite C-Leled Unleled GSH/GSSG Vehicle BSO Gln KG Glu Asp Mlte Fum Suc Cit Iso Lc c Reltive DCFDA Signl Vehicle shg6pd shidh1 [ ] Glucose d Reltive Metolite C-Leled Unleled Gln KG Glu Asp Mlte Fum Suc Cit Iso Lc Supplementry Figure 6., Reltive metolite undnce in 8988T cells grown in [U- 13 C 5 ]-Gln upon knockdown, s compred to control (). Totl metolite pools re represented y the height of the rs; the frction of the metolite pool leled nd unleled re shown in lck nd red, respectively. Gln, KG, Glu, Asp, Mlte, Fum, Suc nd Lc re [U- 13 C]-leled; Cit nd Iso re [ 13 C 4 ]-leled. The color of the sterisks correspond to the color of the metolite rs., Knockdown of in 8988T cells reduces the rtio of reduced to oxidized glutthione (GSH/GSSG). BSO (uthionine sulfoximine) ws included s positive control for GSH depletion. c, Reltive ROS levels of 8988T cells expressing control shrna (), shrnas to G6PD (#1 nd #2) or IDH1 (#1 nd #2). To deprive glucose, cells were plted in complete culture medi (10mM glucose nd 2mM Gln), which ws replced the following dy with glucose-free medium supplemented with 10% dilyzed FBS. DCFDA ssy ws ssessed 24hr fter glucose-withdrwl. Ech r represents the men of three independent experiments with error rs representing the s.d. d, Reltive metolite undnce in 8988T cells grown in [U- 13 C 5 ]-Gln upon ME1 knockdown, s compred to control (). Totl metolite pools re represented y the height of the rs; the frction of the metolite pool leled nd unleled re shown in lck nd red, respectively. Gln, KG, Glu, Asp, Mlte, Fum, Suc nd Lc re [U- 13 C]-leled; Cit nd Iso re [ 13 C 4 ]-leled. The color of the sterisks correspond to the color of the metolite rs. Fum, fumrte; Suc, succinte; Cit, citrte; Iso, isocitrte; Lc, lctte. Error rs represent the s.d. of three independently prepred smples. P < 0.05; P <

7 RESEARCH Supplementry Figure 7. Flux of the Gln cron skeleton into downstrem metolites s function of time. Reds for the percentge of the metolite pool tht is 13 C-leled is plotted for cells expressing the control or. Error rs represent the s.d. of three independently prepred smples. P < 0.05; P <

8 RESEARCH SUPPLEMENTARY INFORMATION Reltive Colony Numer shgot2 c shgot2 Supplementry Figure 8., Asp isotopomer nlysis following GLUD1, or GOT2 knockdown, s compred to control shrna (). Asp dt re presented s the frction of the totl metolite pool tht re unleled (12C), 13C-leled on 2 crons (2C- 13 C), 3 crons (3C- 13 C) or uniformly leled (4C- 13 C)., Reltive clonogenic growth of 8988T expressing control shrna () or shrnas to GOT2 (#1 nd #2). Error rs represent s.d. of triplicte wells from representtive experiment. c, Flux of the Gln cron skeleton into downstrem metolites s function of time. Reds for ion current for 13 C-leled metolites re plotted for cells expressing control shrna () or shrna to GOT2. Error rs represent the s.d. of three independently prepred smples. P < 0.05; P <

9 RESEARCH shmdh1 Supplementry Figure 9. Representtive wells of the clonogenic growth experiment depicted in Fig.3., Representtive wells of the clonogenic growth experiment depicted in Fig.3. Supplementry Figure 10. Reltive metolite undnces in Gln deprived cells supplemented with dimethyl-αkg or dimethyl-mlte, s compred to cells grown in complete medi. Error rs represent the s.d. of three independently prepred smples. P <

10 RESEARCH SUPPLEMENTARY INFORMATION Reltive Colony Numer Gln + NEAA + + Asp + + αkg + + OAA + c OAA Gln d Reltive Colony Numer Tu8902 Mipc2 Pnc1 Gln OAA GSH Tu8902 Mipc2 Pnc1 Gln OAA + + GSH + + Supplementry Figure 11., 8988T cells were plted in complete culture medi (10mM glucose nd 2mM Gln) which ws replced the following dy with Gln-free medium supplemented with NEAA mixture (0.1 mm), Asp (2mM), αkg (4mM) or OAA (4mM) nd clonogenic growth ws ssessed., Representtive wells of the clonogenic growth experiment depicted in Fig.3c. c, PDAC cell lines nd low pssge primry humn PDAC cell lines (#1 nd #2) were plted in complete culture medi (10mM glucose nd 2mM Gln) which ws replced the following dy with Gln-free medium supplemented with OAA (4mM) or GSH (4mM) nd ssyed for cellulr prolifertion. d, Reltive clonogenic growth of Tu8902, Mipc2 nd Pnc1 cells. OAA (4mM) or GSH (4mM) were dded to medi fter Gln-withdrwl. Error rs represent s.d. of triplicte wells from representtive experiment. P <

11 RESEARCH Reltive Colony Numer shgls1 OAA shgls1 f vehicle OAA GLS1 sh#1 GLS1 sh#2 Supplementry Figure T cells expressing control shrna () or shrnas trgeting GLS1 (#1 nd #2) were plted in complete culture medi (10mM glucose nd 2mM Gln) supplemented with or without OAA (4mM) nd clonogenic growth ws ssessed. Error rs represent s.d. of triplicte wells from representtive experiment. P <

12 RESEARCH SUPPLEMENTARY INFORMATION sh#1 sh#2 Vehicle OAA GSH c d Supplementry Figure 13., PDAC cell lines (8988T, Tu8902, Pnc1, Mipc2, PL45 nd MPnc96) nd low pssge primry humn PDAC cell lines (#1 nd #2) expressing control shrna () or shrnas trgeting (#1 nd #2) were plted in the complete culture medi (10mM glucose nd 2mM Gln) supplemented with or without OAA (4mM) or GSH (4mM) nd ssyed for prolifertion., Representtive wells of the clonogenic growth experiment depicted in Fig.3d. c, 8988T cells were plted in complete culture medi, which ws replced the following dy with Gln-free medium contining dimethyl-mlte (4mM) or OAA (4mM) nd ssyed for prolifertion. d, 8988T cells expressing control shrna () or shrnas trgeting were plted in the complete culture medi with or without dimethyl-mlte (4mM) or OAA (4mM) nd ssyed for prolifertion. Error rs represent s.d. of triplicte wells from representtive experiment. P <

13 RESEARCH Reltive Colony Numer shmdh1 GSH shmdh1 c + Gln + + GSH + Gln + + NAC sh#1 sh#2 shmdh1 Vehicle NAC vehicle GSH vehicle GSH sh#1 sh#2 Supplementry Figure 14., 8988T cells expressing control shrna (), shrnas to (#1 nd #2), MDH1 (#1 nd #2) or ME1 (#1 nd #2) were plted in the complete culture medi with or without GSH (4mM) nd clonogenic growth ws ssessed. nd c, Representtive wells of the clonogenic growth experiment depicted in Fig. 3e nd Fig.3f, respectively. Error rs represent s.d. of triplicte wells from representtive experiment., p<

14 RESEARCH SUPPLEMENTARY INFORMATION % GLUD1 Expression Supplementry Figure 15. Xenogrft growth of 8988T cells expressing control shrna () or shrnas trgeting GLUD1 (#1 nd #2) in mice (n=10). The numers to right of grph represent the knockdown efficiency of shrnas mesured efore injecting the cells into mice. Error rs represent s.e.m. (n=10). 14

15 RESEARCH c d βactin βactin e Supplementry Figure 16. nd, HPDE (non-trnsformed humn pncretic ductl epithelil cells), IMR90 (humn diploid firolsts) nd 8988T were treted with AOA or EGCG nd ssyed for prolifertion. c, Reltive prolifertion of HPDE nd IMR90 expressing control shrna () or shrnas trgeting (#1 nd #2). Western lot demonstrting knockdown; full lots in Supplementry Fig. 21. d, Mouse norml ductl epithelil cells (mpde) nd two mouse PDAC (#1 nd #2) lines were treted with AOA nd ssyed for prolifertion. e, Reltive prolifertion of mpde nd two mouse PDAC lines expressing control shrna () or shrna trgeting. Error rs represent s.d. of triplicte wells from representtive experiment. P <

16 RESEARCH SUPPLEMENTARY INFORMATION +Dox +Dox c PDAC cells efore injection idox idox shgot1 d + + Dox Got1 Vinculin PDAC tumors Supplementry Figure 17. nd, LSL-Krs G12D ; p53 L/+ cell line expressing doxycyclineinducile mouse in the presence or sence of doxycycline in mice (n=5). Doxycycline tretment ws not initited until () fter the cells were implnted sucutneously or () when the verge tumor size of the cohort reched ~ mm 3. c, Western lot demonstrting the knockdown efficiency of doxycycline-inducile mouse in the presence of doxycycline prior to injection of the cells into mice. d, Xenogrft tumors generted from mouse PDAC infected with doxycycline-inducile shrna ginst were collected nd tissue lystes were lotted for ; full lots cn e found in Supplementry Fig. 21. D1 represents tumors from pnel () nd D8 represents tumors from pnel () t the termintion of the experiment. Error rs represent s.e.m. (n=5). P < 0.05, P <

17 RESEARCH Tu8902 Pnc1 Mipc2 GLUD1 PL45 MPnc96 Primry PDAC #1 Primry PDAC #2 shkras #1 shkras #2 shkras #1 shkras #2 shkras #1 shkras #2 shkras #1 shkras #2 shkras #1 shkras #2 shkras #1 shkras #2 shkras #1 shkras #2 Reltive Expression Plus Krs G12D Expression in ikrs Tumors ikrs#1 ikrs#2 ikrs#6 ikrs#7 ikrs#11 GLUD1 c shkras Vehicle AOA EGCG 0.1 mm 0.25 mm 0.5 mm 25 µm µm 100 µm Supplementry Figure 18., Expression of GLUD1 nd s determined y quntittive RT- PCR in PDAC cell lines (8988T, Tu8902, Pnc1, Mipc2, PL45 nd MPnc96) nd low pssge primry humn PDAC cell lines (#1 nd #2) expressing control shrna () or two independent shrnas to KRAS (#1 nd #2)., Expression of GLUD1 nd ws determined y quntittive RT-PCR in five independent orthotopic tumors derived from inducile Krs mice (Ying et l., Cell, , ). c, Representtive wells of the clonogenic growth experiment depicted in Fig.4c. Error rs represent s.d. of triplicte smples from representtive experiments. P <

18 RESEARCH SUPPLEMENTARY INFORMATION 1.5 idox-shkras 13 C-Leled Unleled Reltive Metolite Dox Gln KG Glu Asp Mlte Fum Suc Iso Lc Supplementry Figure 19. Reltive metolite undnce in 8988T cells expressing doxycycline-inducile shkras grown in [U- 13 C 5 ]-Gln following doxycycline dministrtion (48h), s compred to non-treted cells. Totl metolite pools re represented y the height of the rs; the frction of the metolite pool leled nd unleled re shown in lck nd red, respectively. Gln, KG, Glu, Asp, Mlte, Fum, Suc nd Lc re [U- 13 C]-leled; Iso is [ 13 C 4 ]-leled. The color of the sterisks correspond to the color of the metolite rs. Fum, fumrte; Suc, succinte; Iso, isocitrte; Lc, lctte. Error rs represent the s.d. of three independently prepred smples. P <

19 RESEARCH Reltive Cell Viility BPTES no Gln Vehicle 10 μm 25 μm μm μm 2 μm 8 μm 32 μm no Gln Vehicle 10 μm 25 μm μm μm 2 μm 8 μm 32 μm c Reltive Cell Viility T Pnc BPTES [H 2 O 2 ] (µm) Supplementry Figure 20., Reltive cell viility of 8988T or Pnc1 cells treted with the indicted concentrtions of GLS inhiitors 968 (ctive), 365 (inctive nlog), or BPTES (Wng J- B, Cerione R, et l., Cncer Cell , ; DeLBrre B, Hurov J, et l. Biochemistry 2011., )., Reltive cell viility of mpde or two mouse PDAC (#1 nd #2) cells treted with the indicted concentrtions of the GLS inhiitor 968. c, Reltive cell viility of Pnc1 cells treted with GLS inhiitors 968 (ctive; 10 μm), 365 (inctive nlog; μm), or BPTES (100nM) with incresing concentrtions of H 2 O 2. Error rs represent s.d. of triplicte wells from representtive experiment. P <

20 RESEARCH SUPPLEMENTARY INFORMATION Full lots for Figure 4 Full lots for Supplementry Figure 16c, HPDE ACTIN 20 KRAS ACTIN Full lots for Figure 4 Full lots for Supplementry Figure 16c, IMR90 40 ACTIN ACTIN Full lots for Supplementry Figure 17c VINCULIN 60 GLUD idox idox shgot KRAS 37 Dox +Dox (D1) +Dox (D8) idox ACTIN 37 Dox +Dox (D1) +Dox (D8) idox shgot1 ACTIN Dox +Dox (D1) +Dox (D8) idox Supplementry Figure 21. Full imges of the western lots presented in the mnuscript nd supplementry informtion. Dox +Dox (D1) +Dox (D8) idox 20

21 RESEARCH Primer Sequences for qrt-pcr humn KRAS forwrd ACAGAGAGTGGAGGATGCTTT humn KRAS reverse TTTCACACAGCCAGGAGTCTT humn forwrd CAACTGGGATTGACCCAACT humn reverse GGAACAGAAACCGGTGCTT humn GLUD1 forwrd GGGATTCTAACTACCACTTGCTCA humn GLUD1 reverse AACTCTGCCGTGGGTACAAT humn GPT2 forwrd CATGGACATTGTCGTGAACC humn GPT2 reverse TTACCCAGGACCGACTCCTT humn PSAT1 forwrd CGGTCCTGGAATACAAGGTG humn PSAT1 reverse AACCAAGCCCATGACGTAGA mouse Glud1 forwrd CCTGCAACCATGTGTTGAGC mouse Glud1 reverse CGGTAGCCTTCGATGACCTC mouse Got1 forwrd GCGCCTCCATCAGTCTTTG mouse Got1 reverse ATTCATCTGTGCGGTACGCTC 21