Breast cell lines with Combination Index (CI) and p53 mutation status

Supplementary Figure 1. Additional RNAi screen data

Supplementary Figure 1. Additional RNAi screen data A. Cisplatin induced ATR autophosphorylation. Western blot illustrating ATR and phospho-atr (T1989) in cells exposed to 1 µm cisplatin for 24 hours prior

Supplementary Information

Supplementary Information Supplementary Figures Supplementary Figure 1. MLK1-4 phosphorylate MEK in the presence of RAF inhibitors. (a) H157 cells were transiently transfected with Flag- or HA-tagged MLK1-4

Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4

SUPPLEMENTARY FIGURE LEGENDS Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4 directly up-regulates the expression of NIPP1 and CCNF that together inhibit protein phosphatase

Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and

Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary

Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy

Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy of various tumor type TRCs, including H22 (murine hepatocarcinoma) and CT26 (murine colon cancer). Bar, 50 µm. b, B16 cells

Primers used for PCR of conductin, SGK1 and GAPDH have been described in (Dehner et al,

Supplementary METHODS Flow Cytometry (FACS) For FACS analysis, trypsinized cells were fixed in ethanol, rehydrated in PBS and treated with 40μg/ml propidium iodide and 10μ/ml RNase for 30 min at room temperature.

Supplementary Figure 1. Expression pattern of Irs4 in MMTV-induced tumours, murine

1 Supplementary Figure 1. Expression pattern of Irs4 in MMTV-induced tumours, murine and human tissues and cell lines. (a) mrna-expression of Irs-gene family members in various tissues from wildtype BALB/c

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells

SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal

Inhibition of Twist1 mediated invasion by Chk2 promotes premature senescence in p53 defective cancer cells

Inhibition of Twist1 mediated invasion by Chk2 promotes premature senescence in p53 defective cancer cells Debasis Nayak, a,1 Anmol Kumar, b Souneek Chakraborty, a,1 Reyaz ur Rasool, a,1 Hina Amin, a Archana

Supporting Information

Supporting Information Chakrabarty et al. 10.1073/pnas.1018001108 SI Materials and Methods Cell Lines. All cell lines were purchased from the American Type Culture Collection. Media and FBS were purchased

Supplementary Material

Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA

Single cell resolution in vivo imaging of DNA damage following PARP inhibition. Supplementary Data

Single cell resolution in vivo imaging of DNA damage following PARP inhibition Katherine S. Yang, Rainer H. Kohler, Matthieu Landon, Randy Giedt, and Ralph Weissleder Supplementary Data Supplementary Figures

Figure S1. Mechanism of ON induced MM cell death.

Figure S1. Mechanism of ON123300 induced MM cell death. To elucidate whether ON123300 induced decrease of viability of MM cells was associated with induction of apoptosis, the number of apoptotic cells

SUPPLEMENTARY INFORMATION

doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice

B. C. Staurosporine BEZ235 DMSO. -actin. Suppl. Fig. 1 BEZ235 and BGT226 inhibit phosphorylation of Akt and downstream targets of PI3K and mtor.

DMSO Staurosporine BGT226 A. B. C. BGT226 P-Akt 0 1 2 4 8 hrs. P-Akt 0 5 10 25 50 100 nm PS6 P-4E-BP1 -actin C-Caspase3 -actin PS6 P-4E-BP1 -actin Suppl. Fig. 1 and BGT226 inhibit phosphorylation of Akt

Nature Medicine: doi: /nm.4464

Supplementary Fig. 1. Amino acid transporters and substrates used for selectivity screening. (A) Common transporters and amino acid substrates shown. Amino acids designated by one-letter codes. Transporters

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination

Supplemental Figure 1. HepG2 cells were transfected with GLI luciferase reporter construct

Supplemental Figure 1. HepG2 cells were transfected with GLI luciferase reporter construct (pgl38xgli), EWS-FLI1 luciferase reporter construct (NROB1-Luc) with or without GLI1, EWS- FLI1 and cdnas respectively.

SUPPLEMENTARY INFORMATION

Figure S1 The effect of T198A mutation on p27 stability. a, Hoechst 33342 staining for nuclei (see Fig 1d). Scale bar, 100 μm. b, Densitometric analysis of wild type and mutant p27 protein levels represented

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time

Supplementary Online Material

Material and Methods Supplementary Online Material Reagents and antibodies Wortmannin, JNK inhibitor II (Anthra[1,9-cd]pyrazol-6(2H)-one 1,9-pyrazoloanthrone), SB 2358, and PD 9859 were purchased from

SUPPLEMENTAL FIGURES AND TABLES

SUPPLEMENTAL FIGURES AND TABLES A B Flag-ALDH1A1 IP: α-ac HEK293T WT 91R 128R 252Q 367R 41/ 419R 435R 495R 412R C Flag-ALDH1A1 NAM IP: HEK293T + + - + D NAM - + + E Relative ALDH1A1 activity 1..8.6.4.2

Supplementary Figure S1 Evi/Wls and Wnt3 are overexpressed in epithelial cells in colon cancers. (a) Validation of the specificity of the Wnt3

Supplementary Figure S1 Evi/Wls and Wnt3 are overexpressed in epithelial cells in colon cancers. (a) Validation of the specificity of the Wnt3 antibody. HCT116 cells were reverse transfected with sicontrol

Hypoxia-induced carbonic anhydrase IX facilitates lactate flux in human breast cancer cells by non-catalytic function

Hypoxia-induced carbonic anhydrase IX facilitates lactate flux in human breast cancer cells by non-catalytic function Somayeh Jamali 1, Michael Klier 1,2, Samantha Ames 1,2, L. Felipe Barros 3, Robert

Appendix Figures Page 2 Appendix Figure Legends Page 9 Appendix Tables Page 13 Appendix Supplementary Methods Page 15 Appendix References Page 17

APPENDIX Appendix Figures Page 2 Appendix Figure Legends Page 9 Appendix Tables Page 13 Appendix Supplementary Methods Page 15 Appendix References Page 17 Appendix Figure Legends Appendix Figure

Supplemental Information. for. epithelial cells to induce tumor formation

Supplemental Information for Single copies of mutant KRAS and mutant PIK3CA cooperate in immortalized human epithelial cells to induce tumor formation Grace M. Wang 1*, Hong-Yuen Wong 1*, Hiroyuki Konishi

Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide,

Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, conjugated with either TAT or Myristic acid and biotin for

DOI: 10.1038/ncb3259 A Ismail et al. Supplementary Figure 1 B 60000 45000 SSC 30000 15000 Live cells 0 0 15000 30000 45000 60000 FSC- PARR 60000 45000 PARR Width 30000 FSC- 15000 Single cells 0 0 15000

Supporting Information: Core-Shell Nanoparticle-Based Peptide Therapeutics and Combined. Hyperthermia for Enhanced Cancer Cell Apoptosis

Supporting Information: Core-Shell Nanoparticle-Based Peptide Therapeutics and Combined Hyperthermia for Enhanced Cancer Cell Apoptosis Birju P. Shah a, Nicholas Pasquale a, Gejing De b, Tao Tan b, Jianjie

ERK1/2 Signaling Plays an Important Role in Topoisomerase II Poison-Induced G2/M Checkpoint Activation

ERK1/2 Signaling Plays an Important Role in Topoisomerase II Poison-Induced G2/M Checkpoint Activation Ryan H. Kolb, Patrick M. Greer, Phu T. Cao, Kenneth H. Cowan, Ying Yan* Eppley Institute for Research

To determine MRK-003 IC50 values, cell lines were plated in triplicate in 96-well plates at 3 x

Supplementary methods: Cellular growth assay and cell cycle analysis To determine MRK-003 IC50 values, cell lines were plated in triplicate in 96-well plates at 3 x 10 3 cells/well (except for TALL1 and

Transcription Factor Runx3 Is Induced by Influenza A Virus and Double-Strand RNA and

Transcription Factor Is Induced by Influenza A Virus and Double-Strand RNA and Mediates Airway Epithelial Cell Apoptosis Huachen Gan 1, Qin Hao 1, Steven Idell 1,2 & Hua Tang 1 1 Department of Cellular

Supplementary Figure 1. Related to Figure 1. Characterization of centrosome fragmentation in mitotically delayed RPE1 cells. (a) Cells transiently

Supplementary Figure 1. Related to Figure 1. Characterization of centrosome fragmentation in mitotically delayed RPE1 cells. (a) Cells transiently transfected with EGFP centrin-2 (Green), synchronized

Supplementary Figure 1: MYCER protein expressed from the transgene can enhance

Relative luciferase activity Relative luciferase activity MYC is a critical target FBXW7 MYC Supplementary is a critical Figures target 1-7. FBXW7 Supplementary Material A E-box sequences 1 2 3 4 5 6 HSV-TK

Supplementary Figure 1: Overexpression of EBV-encoded proteins Western blot analysis of the expression levels of EBV-encoded latency III proteins in

Supplementary Figure 1: Overexpression of EBV-encoded proteins Western blot analysis of the expression levels of EBV-encoded latency III proteins in BL2 cells. The Ponceau S staining of the membranes or

SUPPLEMENTARY INFORMATION. Heterozygous mutations in PALB2 cause DNA replication and damage response defects

SUPPLEMENTARY INFORMATION Heterozygous mutations in PALB2 cause DNA replication and damage response defects Jenni Nikkilä # 1,, Ann Christin Parplys # 2, Katri Pylkäs # 1, Muthiah Bose 1,Yanying Huo 3,

A novel therapeutic strategy to rescue the immune effector function of proteolyticallyinactivated

A novel therapeutic strategy to rescue the immune effector function of proteolyticallyinactivated cancer therapeutic antibodies Supplemental Data File in this Data Supplement: Supplementary Figure 1-4

i-stop codon positions in the mcherry gene

Supplementary Figure 1 i-stop codon positions in the mcherry gene The grnas (green) that can potentially generate stop codons from Trp (63 th and 98 th aa, upper panel) and Gln (47 th and 114 th aa, bottom

Supplementary Information for: CRISPR/Cas9-based target validation. for p53-reactivating model compounds

for: CRISPR/Cas9-based target validation for p53-reactivating model compounds Michael Wanzel 1,5, Jonas B. Vischedyk 1, Miriam P. Gittler 1, Niklas Gremke 1, Julia R. Seiz 1, Mirjam Hefter 1, Magdalena

Nature Structural & Molecular Biology: doi: /nsmb.1583

Acetylation by GCN5 regulates CDC6 phosphorylation in the S-phase of the cell cycle Roberta Paolinelli 1,2, Ramiro Mendoza-Maldonado 2, Anna Cereseto 1 and Mauro Giacca 2 1 Molecular Biology Laboratory,

Cell lines and cell culture. GM08505 is an SV40-transformed skin fibroblast cell line

Materials and Methods Cell lines and cell culture. GM08505 is an SV40-transformed skin fibroblast cell line derived from a BS patient and contains the BLM Ash founder mutation identified in patients of

Regulation of axonal and dendritic growth by the extracellular calcium-sensing

Regulation of axonal and dendritic growth by the extracellular calcium-sensing receptor (CaSR). Thomas N. Vizard, Gerard W. O Keeffe, Humberto Gutierrez, Claudine H. Kos, Daniela Riccardi, Alun M. Davies

7.06 Problem Set Four, 2006

7.06 Problem Set Four, 2006 1. Explain the molecular mechanism behind each of the following events that occur during the cell cycle, making sure to discuss specific proteins that are involved in making

Glutamine activates STAT3 to control cancer cell proliferation. independently of glutamine metabolism

Glutamine activates STAT3 to control cancer cell proliferation S1 independently of glutamine metabolism Andrea Cacace, Martina Sboarina, Thibaut Vazeille, and Pierre Sonveaux Supplementary tables: Table

Supplementary Information (Aoki, K. et al., "Chromosomal instability by β-catenin/tcf transcription in APC or β-catenin mutant cells")

Supplementary Information (Aoki, K. et al., "Chromosomal instability by β-catenin/tcf transcription in APC or β-catenin mutant cells") Supplementary materials and methods ES cells and Mice The floxed β-catenin

Supplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates

Supplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates vascular calcification (VC). (a) Von Kossa staining shows that TSA potentiated the Pi-induced VC. Scale bar, 100

Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information

Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information 1. Supplementary Figure S1-S10: Pages 2-11 2. Supplementary References:

(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower

Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that

SUPPLEMENTAL FIGURE LEGENDS. Figure S1: Homology alignment of DDR2 amino acid sequence. Shown are

SUPPLEMENTAL FIGURE LEGENDS Figure S1: Homology alignment of DDR2 amino acid sequence. Shown are the amino acid sequences of human DDR2, mouse DDR2 and the closest homologs in zebrafish and C. Elegans.

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/6/282/ra53/dc1 Supplementary Materials for Estrogen Alters the Splicing of Type 1 Corticotropin-Releasing Hormone Receptor in Breast Cancer Cells Suchita Lal,

SUPPLEMENTARY INFORMATION

doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8

Coleman et al., Supplementary Figure 1

Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential

Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the

Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the prey clones identified in the yeast two hybrid screen.

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα

Supplementary Figure Legends. Figure-S1 Molecular basis of ASS1 deficiency in myxofibrosarcoma: (A)

Supplementary Figure Legends Figure-S1 Molecular basis of ASS1 deficiency in myxofibrosarcoma: (A) High-resolution oligonucleotide-based array comparative genomic hybridization shows normal DNA copy number

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).

1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well

MLN8237 induces proliferation arrest, expression of differentiation markers and

Supplementary Figure Legends Supplementary Figure 1 827 induces proliferation arrest, expression of differentiation markers and polyploidization of a human erythroleukemia cell line with the activating

HCT116 SW48 Nutlin: p53

Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates

Supplementary Materials. Enhancing Endosomal Escape for Intracellular Delivery. of Macromolecular Biologic Therapeutics

Supplementary Materials Enhancing Endosomal Escape for Intracellular Delivery of Macromolecular Biologic Therapeutics Peter Lönn 1,2, Apollo D. Kacsinta 1, Xian-Shu Cui 1, Alexander S. Hamil 1, Manuel

Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells

Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells Ryosuke Horie. Kagawa University of medecine, Kita-gun, Japan. Disclosures: R. Horie: None.

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Yamaguchi et al., http://www.jcb.org/cgi/content/full/jcb.201009126/dc1 S1 Figure S2. The expression levels of GFP-Akt1-PH and localization

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/6/259/ra5/dc1 Supplementary Materials for Systems Biology Approach Identifies the Kinase Csnk1a1 as a Regulator of the DNA Damage Response in Embryonic Stem Cells

TE5 KYSE510 TE7 KYSE70 KYSE140

TE5 KYSE5 TT KYSE7 KYSE4 Supplementary Figure. Hockey stick plots showing input normalized, rank ordered H3K7ac signals for the candidate SE-associated lncrnas in this study. Rpm Rpm Rpm Chip-seq H3K7ac

Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor

Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor Nicholas Love 11/28/01 A. What is p21? Introduction - p21 is a gene found on chromosome 6 at 6p21.2 - this gene

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb3230 a GM13267(ZW) WCE C N M H 2 O 2 : p(s1981) 2 2 LDH Lamin A/C β-integrin c b d AT Flag- WT Flag- RQ H 2 O 2 IgG p (S1981) p (S1981) 2 IP: Flag N.S. 2 e f A: Untreated AT5 cells B: AT5

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 4.52E-18 PDK1 6.77E-18 CSRP2 4.42E-17 PFKP 1.23E-14 MSH2 3.79E-13 NARF_A 5.56E-13 ADFP 5.56E-13 FAM13A1 1.56E-12 FAM29A_A 1.22E-11 CA9 1.54E-11

Figure S1. Generation of HspA4 -/- mice. (A) Structures of the wild-type (Wt) HspA4 -/- allele, targeting vector and targeted allele are shown together with the relevant restriction sites. The filled rectangles

SureSilencing sirna Array Technology Overview

SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference

MicroRNA Analysis Paired with Novel Cell Health Assays: A Complete Workflow

MicroRNA Analysis Paired with Novel Cell Health Assays: A Complete Workflow Brad Hook, Ph.D Manager, NA Scientific Applications 2016 Presentation Outline From cells to RNA a seemingly easy, yet complex

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification.

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Gene Direction Primer sequence (5 3 ) Annealing Temperature Size (bp) BRCA1 Forward TTGCGGGAGGAAAATGGGTAGTTA 50 o C 292

Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr

Supplemental figure legends Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr A, LβT2 cells were transfected with either scrambled or PEA-15 sirna. Cells were then

Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium

Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium Iodide (Invitrogen, Carlsbad, CA) staining. Briefly, 2x10 5 cells were washed once in cold PBS and resuspended

Supplemental Materials and Methods

Supplemental Materials and Methods Co-immunoprecipitation (Co-IP) assay Cells were lysed with NETN buffer (20 mm Tris-HCl, ph 8.0, 0 mm NaCl, 1 mm EDT, 0.5% Nonidet P-40) containing 50 mm β-glycerophosphate,

Title: The cleaved FAS ligand activates the Na + /H + exchanger NHE1 through. Akt/ROCK1 to stimulate cell motility.

Title: The cleaved FAS ligand activates the Na + /H + exchanger NHE through Akt/ROCK to stimulate cell motility. Authors : Monet Michael, Poët Mallorie, Tauzin Sébastien 2,#, Fouqué Amélie 3, Cophignon

Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto

Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics

TRIM31 is recruited to mitochondria after infection with SeV.

Supplementary Figure 1 TRIM31 is recruited to mitochondria after infection with SeV. (a) Confocal microscopy of TRIM31-GFP transfected into HEK293T cells for 24 h followed with SeV infection for 6 h. MitoTracker

Supplementary Information. ATM and MET kinases are synthetic lethal with. non-genotoxic activation of p53

Supplementary Information ATM and MET kinases are synthetic lethal with non-genotoxic activation of p53 Kelly D. Sullivan 1, Nuria Padilla-Just 1, Ryan E. Henry 1, Christopher C. Porter 2, Jihye Kim 3,

Supplementary Figure 1

Supplementary Figure 1 Virus infection induces RNF128 expression. (a,b) RT-PCR analysis of Rnf128 (RNF128) mrna expression in mouse peritoneal macrophages (a) and THP-1 cells (b) upon stimulation with

Supplementary Fig S1 Nutlin-3a treatment does not affect cell cycle progression in the absence

Supplementary Figure Legends Supplementary Fig S1 Nutlin-3a treatment does not affect cell cycle progression in the absence of p53 or p21. HCT116 cells which were null for either p53 (A) or p21 (B) were

Supplementary Figure 1. GST pull-down analysis of the interaction of GST-cIAP1 (A, B), GSTcIAP1

Legends Supplementary Figure 1. GST pull-down analysis of the interaction of GST- (A, B), GST mutants (B) or GST- (C) with indicated proteins. A, B, Cell lysate from untransfected HeLa cells were loaded

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rainero et al., http://www.jcb.org/cgi/content/full/jcb.201109112/dc1 Figure S1. The expression of DGK- is reduced upon transfection

Identification of a Rhodium(III) Complex as a Wee1 Inhibitor Against

Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal

FBH1 Catalyzes Regression of Stalled Replication Forks

Cell Reports Supplemental Information FBH1 Catalyzes Regression of Stalled Replication Forks Kasper Fugger, Martin Mistrik, Kai J. Neelsen, Qi Yao, Ralph Zellweger, Arne Nedergaard Kousholt, Peter Haahr,

Genetic screening for synthetic lethal partners of polynucleotide kinase/phosphatase: potential for targeting SHP-1 depleted cancers

Genetic screening for synthetic lethal partners of polynucleotide kinase/phosphatase: potential for targeting SHP-1 depleted cancers T.R. Mereniuk et al. Supplemental tlmt Material: il Supplemental l Figures

supplementary information

DOI: 10.1038/ncb2116 Figure S1 CDK phosphorylation of EZH2 in cells. (a) Comparison of candidate CDK phosphorylation sites on EZH2 with known CDK substrates by multiple sequence alignments. (b) CDK1 and

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/3/146/ra80/dc1 Supplementary Materials for DNMT1 Stability Is Regulated by Proteins Coordinating Deubiquitination and Acetylation-Driven Ubiquitination Zhanwen

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

SUPPLEMENTAL EXPERIMENTAL PROCEDURES Luciferase Assays Cells were seeded on 24well plates and grown to 7% confluency. Cells were then transfected with ng of reporter constructs and 1 ng of the renilla

SUPPLEMENTAL MATERIAL. Carvajal et al. Supplemental Table 1. List of quantitative PCR primers used for cdna analyses and

UPPLEMEAL MATERIAL Carvajal et al. upplemental Table 1. List of quantitative PCR primers used for cdna analyses and chromatin immunoprecipitation assays. Figure 1. DNA damage-induced transcriptional repression

Supporting Information (Pabla et al.)

Supporting Information (Pabla et al.) Materials and Methods Antibodies and Immunoblot Analysis. The following antibodies were used for initial immunoblot analysis of Chk1: anti-n-terminus Chk1 (Epitomics-E250),

CDK5 is essential for TGF-β1-induced epithelial-mesenchymal transition and breast cancer progression

Supplementary information for: CDK5 is essential for TGF-β1-induced epithelial-mesenchymal transition and breast cancer progression Qian Liang, Lili Li, Jianchao Zhang, Yang Lei, Liping Wang, Dong-Xu Liu,

Supporting Information

Supporting Information Johnson et al. 10.1073/pnas.1305170110 SI Materials and Methods Cell Lines and Reagents. Cell lines were obtained from the American Type Culture Collection. Puromycin, blasticidin,

Supplemental Material

Supplemental Material Figure S1.(A) Immuno-staining of freshly isolated Myf5-Cre:ROSA-YFP fiber (B) Satellite cell enumeration in WT and cko mice from resting hind limb muscles. Bulk hind limb muscles

Cell death analysis using the high content bioimager BD PathwayTM 855 instrument (BD

Supplemental information Materials and Methods: Cell lines, reagents and antibodies: Wild type (A3) and caspase-8 -/- (I9.2) Jurkat cells were cultured in RPMI 164 medium (Life Technologies) supplemented

File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:

File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. dcas9-mq1 fusion protein induces de novo

SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION

SUPPLEMENTAL MATERIALS SIRTUIN PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF ACTIVATION Haranatha R. Potteti*, Subbiah Rajasekaran*, Senthilkumar B. Rajamohan*, Chandramohan R. Tamatam,

Lullaby sirna Transfection Reagent - Results

sirna Transfection Reagent - Results OZ Biosciences is delighted to announce the launching of a new sirna transfection reagent: -sirna. This lipid based transfection reagent is specifically designed for

Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera

SUPPLEMENTARY INFORMATION Roles of human POLD1 and POLD3 in genome stability Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera SUPPLEMENTARY METHODS Cell proliferation After sirna