Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables

Size: px

Start display at page:

Download "Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables"

Neil Ellis
5 years ago
Views:

1 Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Data 1 Description: Complete mass isotopomer distribution of data displayed in Fig 6d and Fig S7d from U- 13C-proline after 24hrs. All data are presented as mean ± SEM. n=3 replicates per condition. M represents unlabelled molecules with each increasing number representing additional 13C-labelled carbons.

2 PDAC Normal pancreas #1 #6 #1 #14 #2 #7 #2 #15 #3 #8 #3 #16 #4 #9 #12 #17 #5 #1 #13 #18 #11 Supplementary Figure 1 PRODH1 is expressed in human PDAC samples. Staining of PRODH1 by IHC on human tissue macroarray (TMA) containing PDAC (n=1), adjacent normal pancreas (n=3, #1 to #3) and normal pancreas from PDAC-free patients (n=8, #4 to #11). Quantification of PRODH1 expression in TMA samples was determined by densitometry using Image J software (NIH) with the same threshold for all images. Scale bar: µm.

49.2 +/- 13.4% 68.5 +/- 11.3% 26.6 +/- 9.

mm Glc f mm Gln Col IV/DAPI Merge mm Gln 88.

5% b 4 * 3 1% O2 (48hrs) c c 2 * 1 Complete

Collagen I DQ fluorescein intensity Positive

Complete mm Glc mm Gln, 1% O 2 Lamp1/DAPI mm

take up and degrade collagen after glucose

(a) and (b) Representative flow cytometry

panels) representing the percentage of PK4A

Mean (c) Col I or (d) Col IV DQ fluorescence

during 48hrs under hypoxia (1% O2) as in Fig.

p<5), while letters indicate complete media

Col IV DQ and Lamp1 lysosomal marker in PK4A

3 49.2 +/- 13.4% /- 11.3% /- 9.4% Complete mm Glc mm Gln 8 +/- 14.5% 8 +/- 15.3% /- 9.2% /- % 1% O2 (48hrs) 1 b * Complete mm Glc f mm Gln Col IV/DAPI Merge mm Gln /- 2.8% /- 1.4% mm Glc, 1% O 2 Lamp1/DAPI mm Glc Col IV/DAPI / Complete Col IV DQ positive cells (%) Col I DQ positive cells (%) e 1% O2 (48hrs) Collagen IV DQ fluorescein intensity c Col I mean fluorescence intensity /- 4.5% b 4 * 3 1% O2 (48hrs) c c 2 * 1 Complete mm Glc d Col IV mean fluorescence intensity /- 8.2% mm Gln /- 8.9% mm Glc Positive cells (%) Complete Collagen I DQ fluorescein intensity Positive cells (%) a mm Gln 1% O2 (48hrs) Complete mm Glc mm Gln, 1% O 2 Lamp1/DAPI mm Gln Merge Supplementary Figure 2 PDAC cells take up and degrade collagen after glucose or glutamine deprivation under hypoxia. (a) and (b) Representative flow cytometry profiles (upper panels) and charts (lower panels) representing the percentage of PK4A cells taking up collagen I (a) or IV (b) DQ. Mean (c) Col I or (d) Col IV DQ fluorescence intensity (MFI) in PK4A cells cultured during 48hrs under hypoxia (1% O2) as in Fig. 3a-b. Data represent mean ± SEM (n=3 independent experiments). P values, indicated by asterisks, show statistical significance relative to respective culture condition without (* p<5), while letters indicate statistical significance relative to complete media without (c p<5, b p<1). Two-tailed unpaired Student s t-test. (e) and (f) Representative co-staining of Col IV DQ and Lamp1 lysosomal marker in PK4A cells cultured in glucose-free (e) or glutamine-free (f) media under hypoxic conditions with or without. Insets show magnification of Col IV, Lamp1 or Col IV/Lamp1 (merge) PKA4 cells in each condition. Images are representative of n=3 independent experiments. Scale bar: µm.

a Relative Mrc2 expression (fold) 2 2 1 1 Control *** PDAC b uparap/ Endo18 Amido Black Control PDAC -167 c Murine Human uparap/endo18

(a) mrna levels of the receptor uparap/endo18 (Mrc2 gene) measured by quantitative RT-PCR in PDAC from PKI mice (n=3) versus control pancreases

(b) Protein levels of uparap/endo18 in PDAC and control pancreas from PKI and KI mice, respectively (upper panel). Marker size in is indicated.

4 a Relative Mrc2 expression (fold) Control *** PDAC b uparap/ Endo18 Amido Black Control PDAC -167 c Murine Human uparap/endo18 Supplementary Figure 3 MRC2/Endo18 is expressed by PDAC tumour cells. (a) mrna levels of the receptor uparap/endo18 (Mrc2 gene) measured by quantitative RT-PCR in PDAC from PKI mice (n=3) versus control pancreases from KI mice (n=3). Data are presented as mean ± SEM. *** p<1; two-tailed unpaired Student s t-test. (b) Protein levels of uparap/endo18 in PDAC and control pancreas from PKI and KI mice, respectively (upper panel). Marker size in is indicated. Total protein stained with Amido black were used as loading control (lower panel). Uncropped images of blots are shown in Supplementary Fig. 1. (c) Representative uparap/endo18 staining in human and murine PDAC sections (n=4 patients and n=3 PKI mice). Scale bar: 1 µm.

a mm b mm Uncoated Col I-coated Uncoated

Representative images of unstained cells

5 a mm b mm Uncoated Col I-coated Uncoated Col I-coated Supplementary Figure 4 Collagen promotes PDAC cell survival. (a) and (b) Survival of PK4A cells cultured in glucose-free media on uncoated or coated-collagen I plates. Representative images of unstained cells (a) and cells stained with crystal violet (b) after 96hrs of treatment (n=2 independent experiments). Scale bar: 1, µm (a: upper images), 2 µm (a: lower images) and 5 mm (b).

6 Percent of Total Carbon mM Total Acc ounting 5mM mm mm Glutamine Non-Polar Protein Polar RNA DNA Percent of Total Carbon mM 5mM Protein mm mm Glutamine Percent of Total Carbon mM Nucleotides 5mM mm mm Glutamine RNA DNA Percent of Total Carbon mM Non-polar 5mM mm mm Glutamine Supplementary Figure 5 Accounting of proline-derived carbon contributions to different cellular macromolecules. Relative contributions of proline to proteins, nucleotides (RNA, DNA) and non-polar (lipids) fractions determined under different nutrient conditions. Each bar represents the average of n=3 biological replicates ± SEM.

7 a concentration (mm) Time (hrs) Lactate concentration (mm) *** **** **** **** Time (hrs) 25mM 5mM 1mM mm b Time 1hr 3hrs 6hrs 24hrs Glutamine 4mM 2mM.5mM 4mM 2mM.5mM 4mM 2mM.5mM 4mM 2mM.5mM M SEM M SEM M SEM M SEM Supplementary Figure 6 Glutamine depletion does not change relative glucose contribution to lactate production. (a) uptake (left panel) and lactate production (right panel) by subconfluent PK4A cells cultured under gradual glucose deprivation (25mM, 5mM, 1mM and mm) at 8, 14 and 24hrs. Data are mean ± SEM, n=4 independent experiments. P value indicated by asterisks is relative to lactate value in 25mM glucose media at each time point. *** p< 1, **** p< 1; two-way ANOVA followed by Bonferroni post-hoc test. (b) Complete mass isotopomer distribution (MID) of lactate from U-13C-glucose at 1, 3, 6 and 24hrs under a gradual decline in glutamine concentration. All data are presented as mean ± SEM. n=3 replicates per condition.

a MEF Collagen I Fibronectin Hsp9 ECM MEF ECM MEF ECM kd 2 1 MEF ECM kd 2 1 1 b ECM - Acid Hydrolysis Glu+Gln Hydroxyproline Proline c Short Exposure 4 Long Exposure 1 M M1 M2 M3 M4 M5 Mass

8 a MEF Collagen I Fibronectin Hsp9 ECM MEF ECM MEF ECM kd 2 1 MEF ECM kd b ECM - Acid Hydrolysis Glu+Gln Hydroxyproline Proline c Short Exposure 4 Long Exposure 1 M M1 M2 M3 M4 M5 Mass Isotopomer Distribution % of Total Amino Acids Pool ECM DMEM DMEM +1% FBS d Ala Arg Asp Glu +Asn +Gln Gly Ile Leu Lys Met Phe Pro Ser Thr Tyr Val Amino Acid Aspartate M M1 M2 M3 M4 Pyruvate M M1 M2 M3 CO 2 Malate M M1 M2 M3 M4 Acetyl-CoA Citrate M M1 M2 M3 M4 M5 M6 TCA Cycle mM 5mM mm mm Glutamine akg CO M M1 M2 M3 M4 M5 25mM 5mM mm mm Glutamine M Proline M5 Glutamate M M1 M2 M3 M4 M5 Supplementary Figure 7 Fumarate M M1 M2 M3 M4 Succinate M M1 M2 M3 M4 CO 2 Glutamine M M1 M2 M3 M4 M5 ECM is proline-rich and essential amino acid poor and proline supplies the TCA cycle. (a) Western blot of primary MEFs and de-cellularised ECM indicating successful de-cellularisation of ECM prior to PK4A cells plating. Uncropped blots are representative of n=2 independent experiments. (b) Full mass isotopomer distribution of labelled ECM after acid hydrolysis. Data is from n=1 experiment and is representative of n=2 experiments. M represents unlabelled molecules with each increasing number representing additional 13 C-labelled carbons. (c) Percent of total protein pool of each amino acid following acid hydrolysis of fibroblast-synthesized ECM, DMEM and DMEM + 1% FBS. (d) Full GCMS tracing analysis of U- 13 C-proline into central carbon metabolism in PDAC cells after 24hrs under indicated nutrient conditions. M represents unlabelled molecules with each increasing number representing another labelled carbon.

9 a Proline Time 25mM + 4mM Gln 5mM + 4mM Gln mm + 4mM Gln 25mM + mm Gln O2 21% 1% 21% 1% 21% 1% 21% 1% M SEM M SEM M SEM M SEM M SEM M SEM Glutamate Time 25mM + 4mM Gln 5mM + 4mM Gln mm + 4mM Gln 25mM + mm Gln O2 21% 1% 21% 1% 21% 1% 21% 1% M SEM M SEM M SEM M SEM M SEM M SEM b akg Time 25mM + 4mM Gln 5mM + 4mM Gln mm + 4mM Gln 25mM + mm Gln O2 21% 1% 21% 1% 21% 1% 21% 1% M SEM M SEM M SEM M SEM M SEM M SEM Citrate akg Succinate mM Aspartate Fumarate Malate Proline Glutamine Glutamate DHP + DHP Citrate akg Succinate mM Glutamine Aspartate Fumarate Malate Proline Glutamine Glutamate Supplementary Figure 8 Hypoxia does not influence proline conversion to glutamate or alpha-ketoglutarate but DHP inhibits metabolism of proline to TCA. (a) Complete mass isotopomer distribution of proline, glutamate and alpha-ketoglutarate (α-kg) from U- 13 C-proline after 24hrs at the indicated conditions in normoxia (21% O 2 ) and hypoxia (1% O 2 ). All data are presented as mean ± SEM. n=3 replicates per condition. M represents unlabelled molecules with each increasing number representing additional 13 C-labelled carbons. (b) Fractional labelling of proline, glutamine and TCA intermediate from U- 13 C-proline after 24hrs at 5mM glucose (left charts) or.5mm glutamine (right charts) with or without DHP 1mM. All data presented as mean ± SEM. n=3 replicates per condition.

PRODH1 _clone 9 _clone 3 a b sg-control _clone 9 sg-control - Complete _clone 3 β-actin - PRODH1 (Relative expression) 12 8 4 sg-control * * _clone 9 _clone 3

(a) Illustration and quantification (upper and lower panels, respectively) of PRODH1 levels in sg-control and _clone9 and _clone3 PK4A cells revealed by western blot

Uncropped images of blots are shown in supplementary Fig. 1. * p<5, two-tailed unpaired Student s t-test.

10 PRODH1 _clone 9 _clone 3 a b sg-control _clone 9 sg-control - Complete _clone 3 β-actin - PRODH1 (Relative expression) sg-control * * _clone 9 _clone 3 Colony-forming area 1 1 sg-control * * _clone 9 _clone 3 Supplementary Figure 9 Prodh1 gene-editing in PK4A cells using the CRISPR-Cas9 system. (a) Illustration and quantification (upper and lower panels, respectively) of PRODH1 levels in sg-control and _clone9 and _clone3 PK4A cells revealed by western blot analysis (marker size indicated in ). Protein levels in each cell line are normalised to β-actin. Data are expressed as mean ± SEM (n=2 independent experiments). Uncropped images of blots are shown in supplementary Fig. 1. * p<5, two-tailed unpaired Student s t-test. (b) Representative clonogenic assay (upper panel) and quantification of sg-control and _clone 9 and _clone 3 PK4A cells colony-forming area (lower panel) in complete media. Data are mean ± SEM (n=3 independent experiments). * p<5, two-tailed unpaired Student s t-test. Scale bar: 5 mm

11 Fig 1e Complete hrs 48hrs Prolidase Fig 2d Control 2 3 PDAC Control PDAC Control PDAC P4HA3 PRODH1 Amido black Fig 4b mm.5 mm Glutamine -ColIV +ColIV -ColIV +ColIV perk1/2 perk1/2 ERK1/2 ERK1/2 mm -ColIV +ColIV.5 mm Glutamine -ColIV +ColIV pt389-p7s6k pt389-p7s6k Supplementary Figure 1a

12 mm -ColIV +ColIV.5 mm Glutamine -ColIV + ColIV p7s6k p7s6k Fig 4c Supp. Fig 3b 148 mm 24hrs 48hrs mm Glutamine 24hrs 48hrs 1 Control 2 3 PDAC uparap/endo18 Prolidase Amido black Supp. Fig 9a KDa sg-control clone 9 clone 3 KDa sg-control clone 9 clone 3 PRODH1 β-actin Supplementary Figure 1b

13 Supplementary Table 1. Primer sequences (mus musculus) used to determine transcript expression profiles by real-time PCR Gene name Forward primer (5'-->3') Reverse primer (5'-->3') RefSeq mrna pepd GGGAAAGATCCATTCCAAGG CACTGCCACTGTCTGTGTTG NM_882 mmp2 CCAGATCACATACAGGATCATT CCATCATGGATTCGAGAAAA NM_861 mmp9 CAGCTGGCAGAGGCATACTT TTCTGAAGCATCAGCAAAGC NM_ mmp13 GGGACTAAAGAACATGGTGACT AGCCTTTGGAACTGCTTGTC NM_867.2 b4 GCTGATGGGCAAGAACACCA CCCAAAGCCTGGAAGAAGGA NM_ endo18 GCCCCATCAAGAGTAACGAC CGTGATACTCAGCAAGTCTGC NM_ Supplementary Table 2. Amino Acid Fragments Used for Isotope Quantification Metabolite Carbons a Formula b Mass (m/z) KG C 14 H 28 O 5 NSi Ala 23 C 1 H 26 ONSi Ala 123 C 11 H 26 O 2 NSi 2 26 Arg C 17 H 38 N 3 Si 2 34 Arg C 2 H 44 O 2 N 3 Si Asp 12 C 14 H 32 O 2 NSi 2 32 Asp 234 C 17 H 4 O 3 NSi 3 39 Asp 1234 C 18 H 4 O 4 NSi Cit C 2 H 39 O 6 Si Cit C 26 H 55 O 7 Si Fum 1234 C 12 H 23 O 4 NSi Gln C 19 H 43 O 3 N 2 Si Glu 2345 C 16 H O 2 NSi 2 33 Glu C 19 H 42 O 4 NSi Gly 2 C 9 H 24 ONSi Gly 12 C 1 H 24 O 2 NSi Ile C 11 H 26 NSi 2 Ile C 13 H 32 ONSi Ile C 14 H 32 O 2 NSi 2 32 Lac 123 C 11 H 25 O 3 Si Leu C 11 H 26 NSi 2 Leu C 13 H 32 ONSi Leu C 14 H 32 O 2 NSi 2 32 Lys C 17 H 41 N 2 Si Lys C 2 H 47 O 2 N 2 Si Mal 1234 C 18 H 39 O 5 Si Met 2345 C 1 H 24 NSiS 218 Met 2345 C 12 H 3 ONSi 2 S 292 Met C 13 H 3 O 2 NSi 2 S 32 Phe C 14 H 24 NSi 234 Phe C 14 H 32 O 2 NSi 2 38 Phe C 17 H 3 O 2 NSi 2 3 Pro C 16 H O 2 NSi 2 33 (Hydroxy)Pro C 19 H 45 O 3 NSi Pyr 123 C 6 H 12 O 3 NSi 174 Suc 1234 C 12 H 25 O 4 Si Ser 23 C 14 H 34 ONSi Ser 12 C 14 H 32 O 2 NSi 2 32 Ser 23 C 16 H 4 O 2 NSi 3 2 1

14 Ser 123 C 17 H 4 O 3 NSi 3 39 Thr 234 C 17 H 42 O 2 NSi Thr 1234 C 18 H 42 O 3 NSi 3 44 Tyr C 2 H 38 ONSi 2 3 Val 2345 C 12 H 3 ONSi 2 26 Val C 13 H 3 O 2 NSi a = Carbons indicates the carbons present in the derivative that is measured via GC-MS. b = chemical formula of the derivative measured via GC-MS (derivatization process described in the method section) 2

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12138 Supplementary Figure 1. Knockdown of KRAS leads to a reduction in macropinocytosis. (a) KRAS knockdown in MIA PaCa-2 cells expressing KRASspecific shrnas