Supplementary information Activation of AMP-activated protein kinase
|
|
- Gilbert Kristopher Powers
- 5 years ago
- Views:
Transcription
1 Supplementary information Activation of AMP-activated protein kinase 2 by nicotine instigates formation of abdominal aortic aneurysms in mice in vivo Shuangxi Wang 1,2,5, Cheng Zhang 1,2,5, Miao Zhang 1, Bin Liang 1, Huaiping Zhu 1, Jiyeon Lee 1, Benoit Viollet 3, Lijun Xia 4, Yun Zhang 2 & Ming-Hui Zou 1,2 1 Division of Molecular Medicine, Department of Medicine, University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma, USA. 2 The Key Laboratory of Cardiovascular Remodeling and Function Research, Chinese Ministry of Education and Chinese Ministry of Health, Shandong University, Qilu Hospital, Jinan City, Shandong, China. 3 Institut Cochin, Université Paris Descartes, Centre national de la recherche scientifique (CNRS(UMR 8104), Paris, France. 4 Cardiovascular Biology Research Program, Oklahoma Medical Research Foundation, Oklahoma City, Oklahoma, USA. 5 These authors contributed equally to this work. Correspondence should be addressed to M.-H.Z. (ming-hui-zou@ouhsc.edu). Supplementary Figure 1-12 and legends Supplementary Table
2 Supplementary Figure 1 AMPK-α2 deficiency prevents high dose nicotine-induced AAA formation in Apoe / mice. Apoe /, Apoe / ; Prkaa1 / and Apoe / ; Prkaa2 / mice were infused with nicotine (5 mg/kg/day) or vehicle for 6 weeks by an osmotic pump. (a) Representative photographs showing macroscopic features of aneurysms induced by nicotine. Vehicle or nicotine was administered to mice of the indicated genotypes. Arrows indicate typical AAAs. (b) The incidence of nicotine-induced AAA and (c) maximal abdominal aortic diameter. BW means body weight. Ration is the aortic weight (g) to the total body weight (g) of the mouse and given as a percentage. * P<0.05 compared to vehicle-infused Apoe / mice. # P<0.05 compared to vehicle-infused Apoe / ; Prkaa1 / mice. $ P<0.05 compared to nicotine-infused Apoe / mice. N is 8-10 in each group. The P values were obtained by a 2 test in b and one-way analysis of variance plus a post hoc analysis using a Bonferroni test in c. The error bars in c are s.e.m. 2
3 Supplementary Figure 2 Ablation of AMPK- 2 prevents AngII-induced AAA formation in Apoe / mice. (a) Representative photographs showing the macroscopic features of aneurysms induced by AngII. Saline or AngII (1.44 mg/kg/day) was administered to mice of the indicated genotypes for 4 weeks. Arrows indicate typical AAAs. (b) The incidence of AngII-induced AAA, (c) maximal abdominal aortic diameter and (d) total aortic weights in mice of the indicated genotypes after saline or AngII infusion. BW means body weight. Ration is the aortic weight (g) to the total body weight (g) of the mouse and given as a percentage. (e) Representative staining with HE, elastin and -actin in the suprarenal aortas of mice of the indicated genotypes after saline or AngII infusion.the magnification of the two insets is 40-fold in the middle row. (f) Grade of elastin degradation in the aortic wall of mice of the indicated genotypes after saline or AngII infusion. *P < 0.05 compared to vehicle-infused Apoe / or Apoe / ; Prkaa1 / mice, #P < 0.05 compared to AngII- infused Apoe / mice. N is in each group. The P values were obtained by a 2 test in b and one-way analysis of variance plus a post hoc analysis using a Bonferroni test in c, d, and f. The error bars in c, d and f are s.e.m. 3
4 Supplementary Figure 3 Real-time PCR to repeat all samples of RT-PCR. Total RNA was extracted from mice aortas or cultured cells and transcripted to cdna by a kit. Real-time PCR was used to amplify cdna. (a, b) MMP2 mrna levels in Apoe /, Apoe / ; Prkaa1 / and Apoe / ; Prkaa2 / mice aortas infused by (a) nicotine or (b) AngII. N is in each group. * P<0.05 compared to control Apoe / mice, # P<0.05 compared to control Apoe / ; Prkaa1 / mice, $ P<0.05 compared to nicotine or AngII-infused Apoe / mice. (c, d) MMP2 mrna levels in human VSMCs untreated (control) or treated with (c) nicotine or (d) AngII in presence of compound C. N is 3 in each group. * P<0.05 compared to control without compound C, # P<0.05 compared to nicotine or AngII alone. (e) MMP2 mrna levels in human VSMCs transfected with control sirna, AMPK-α1 sirna, or AMPK-α2 sirna and incubated with nicotine or metformin. N=3 in each group. * P<0.05 compared to control sirna, # P<0.05 compared to AMPK-α1 sirna, $ P<0.05 compared to control sirna plus nicotine or metformin. (f) MMP2 mrna levels in human VSMCs transfected with control sirna, AMPK-α1 sirna, or AMPK-α2 sirna and incubated with AngII or AICAR. N=3. * P<0.05 compared to control sirna alone, # P<0.05 compared to AMPK-α1 sirna, $ P<0.05 compared to control sirna plus AngII or AICAR. (g) MMP2 mrna levels in mouse VSMCs (WT, Prkaa1 /, and Prkaa2 / ) incubated with nicotine. N=3. * P<0.05 compared to WT, # P<0.05 compared to Prkaa1 /, $ P<0.05 compared to WT plus nicotine. (h) MMP2 mrna levels in mouse VSMCs (WT, Prkaa1 /, and Prkaa2 / ) incubated with AngII. N=3 in each group. * P<0.05 compared to WT, # P<0.05 compared to Prkaa1 /, $ P<0.05 compared to WT plus AngII. The P values were obtained by one-way analysis of variance plus a post hoc analysis using a Bonferroni test. All error bars are s.e.m. 4
5 Supplementary Figure 4 AngII infusion results in oxidative stress and enhances the expression of MMP2 and MMP9 through AMPK- 2 in vivo. (a) Representative immunostaining of MMP2, MMP9, MDA and 3-NT in the suprarenal aortas of saline- or AngII-infused mice. (b, c) MMP2 and MMP9 activity by zymography, MMP2 and GAPDH mrna by RT-PCR and protein expression by Western blot in b, and ROS production in c as assessed by measurement of DHE levels by HPLC in the aortas of saline- or AngII-infused mice of the indicated genotypes. Quantitative results are shown below in b. (Pro-MMP9)2 means dimer of pro-mmp9. Pro-MMP means full-length MMP. Lipocalin/Pro-MMP9 means Pro-MMP9 which binds with lipocalin. * P < 0.05 compared to saline-infused Apoe / mice, # P < 0.05 compared to saline-infused Apoe / ; Prkaa1 / mice, $ P < 0.05 compared to AngII-infused Apoe / mice. All reseults presents 5-10 mice. The P values were obtained by one-way analysis of variance plus a post hoc analysis using a Bonferroni test in b and c. The error bars in b,c are s.e.m. 5
6 Supplementary Figure 5 MMP2 is crucial for AngII- or nicotine-induced elastin degradation in Apoe / mice. After in vivo trnasfection of MMP2 sirna, Apoe / mice were infused with AngII (1.44 mg/kg/day) or nicotine (1 mg/kg/day) for 7 days. Mice aortas were subjected to measure (a) MMP2 activity by zymography, MMP2, pro-mmp2, collagen IV, pampk, AMPK and GAPDH protein expressions by western blot and quantitative results are shown below. (b) Elastin degradation by HE staining and collagen IV levels by immunohistochemistry and (c) elevation of elastin degradation by quantitative analysis. N is 5 in each group. * P < 0.05 compared to control sirna mice, # P < 0.05 compared to control sirna mice infused with AngII or nicotine. NS, no significant. The P values were obtained by one-way analysis of variance plus a post hoc analysis using a Bonferroni test. The error bars in a,c are s.e.m. 6
7 Supplementary Figure 6 Both nicotine and AngII activate AMPK in human VSMCs. (a, b) Human VSMCs were pre-incubated with AICAR (2 mm), ONOO - (50 μm), or nicotine ( μm) for 1 hour. Cells were used to determine (a) pampk and AMPK levels by Western blot and (b) AMPK activity by 32 P-ATP in vitro kinase phosphorylation. N is 3. * P < 0.05 compared to control group. (c) Cultured human VSMCs were incubated with nicotine (0.1 μm) for indicated times. AMPK phosphorylation and AMPK was assayed by Western blot by using Thr172-phosphorylated antibody. (d, e) Cultured human VSMCs were incubated with AngII (1 μm) for indicated times. Cell lysates were subjected to detect pampk and pacc by Western blot and AMPK activity by 32 P -ATP in vitro kinase phosphorylation. N is 3. * P < 0.05 compared to control (0 ) group. The P values were obtained by one-way analysis of variance plus a post hoc analysis using a Bonferroni test. The error bars are s.e.m. 7
8 Supplementary Figure 7 Inhibition of AMPK by compound C abolished both nicotine and AngII induced MMP2 upregulations in human VSMCs. (a) Cultured human VSMCs were pre-incubated with or without compound C (10 μm) for 30 and then treated with nicotine (0.1 μm) for 24 hours. The pro-mmp2 protein and mrna expression in total cell lysates was assayed by Western blot and RT-PCR, and activity in culture medium were detected by zymography. GAPDH protein and mrna, pampk and AMPK are also shown. * P<0.05 vs. control, # P<0.05 vs. Nicotine. (b) Cultured human VSMCs were pre-incubated with compound C (10 μm) or DMSO for 30 and then treated with AngII (1 μm) for 24 hours. The pro-mmp2 protein and mrna expressions, activity in culture medium were analyzed as in a. n = 3 independent experiments for all quantitative data. * P < 0.05 compared to control group, # P < 0.05 compared to Nicotine or AngII alone. The P values were obtained by one-way analysis of variance plus a post hoc analysis using a Bonferroni test. The error bars are s.e.m. 8
9 Supplementary Figure 8 AngII and nicotine promote co-localization of AMPK-α2 to AP-2α in human VSMCs. Cultured human VSMCs were incubated with AngII (1 μm) or nicotine (0.1 μm) for 2 h in the presence of compound C (10 μm). Cells were mounted in formalin and subjected to immunofluoresence staining by AP-2α- or AMPK-α2 primary antibidy to determine the subcellular locations of AP-2α and AMPK-α2. Red, AMPK-α2; Green, AP-2α; Yellow, AMPK-α2 plus AP-2α overlap; Blue, DAPI/nucleus; Merge, AMPK-α2/AP-2α/DAPI. The images (40-fold) are representative of three independent experiments. 9
10 Supplementary Figure 9 The domains and amino acid sequence of human AP-2α. (a) Full length of human AP-2α amino acid sequence. (b) The domains and structure of human AP-2α protein. (c) Alignments of human AP-2α serine residues relative to an optimal AMPK motif by positional scanning peptide library screening. 10
11 Supplementary Figure 10 Mutant of AP-2α S219A suppressed AngII/nicotine-induced MMP2 upregulation in VSMCs. Human VSMCs were transfected with WT and S219A constructs of AP-2α for 48 hours and then treated with AngII (1 μm) or nicotine (0.1 μm) for 24 hours. (a) MMP2 and GAPDH mrna by RT-PCR, pro-mmp2 and GAPDH protein by Western blot in total cell lysates, and MMP2 activity in culture medium by zymography, (b) AP-2α DNA affinity by EMSA, and (c) the binding of AP-2α to MMP2 gene promoter by ChIP were measured. All pictures are a representative picture from 3 independent experiments. 11
12 Supplementary Figure 11 Increased AMPK-α2 activity, AMPK Thr172 phosphorylation, and ACC Ser79 phosphorylation in human AAA. Abdominal aortic tissues from age-matched patients with AAA or non-aaa patients were homogenated. The phosphorylations of AMPK Thr172, ACC Ser79, AMPK-α2 activity were assayed. (a) Increased detection of pampk and pacc in aortic tissues from patients with AAA. The blot is a representive blot obtained from 6 individuals; (b) Increased AMPK-α2 activity in aortic tissues from patients with AAAs. N is 6. # P < 0.05 compared to non-aaa; (c) cigarette smoking increased the phosphorylations of both AMPK Thr172 and ACC Ser79 and AMPK-α2 activity (d) in the plasma. The blot is a representive blot obtained from six blots. # P < 0.05 compared to non-smoking. The P values were obtained by t-test between two groups. All error bars are s.e.m. 12
13 Supplementary Figure 12 A proposed schem of AngII/nicotine-induced AAA formation via AMPK-α2 and AP-2α in mice. AngII/nicotine binds to its receptors in vascular smooth muscle cell to activate G-protein, which further activates NADPH oxidase via unknown mechanisms. NADPH oxidase produces a lot of reactive oxygen species (O 2 -, ONOO -, H 2 O 2, etc.) and secretions of cytokines (IFN-γ, TNF-α, CypA, etc) to phosphorylate AMPK-α at Thr172, which triggers the nuclear translocation of AMPK-α2 from cytoplasm. In nucleus, AMPK-α2 binds to AP-2α and phosphorylates AP-2α at serine 219, resulting in the formation of AMPK-α2/AP-2α/MMP2 promoter complex. Activated AP-2α triggers the gene transcription of MMP2, and subsequent protein synthesis, MMP2 secretion to outside of cells and cleaved to active MMP2 by MT1-MMP. In vascular walls, active MMP2 degrades extracellular matrix, which weakens the resistant of vascular wall to blood flow, causing the formation of aortic aneurysm. 13
14 14
15 15
16 16
17 17
Supplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total
Supplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total ERK in the aortic tissue from the saline- or AngII-infused
More informationAt E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
More informationSupplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates
Supplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates vascular calcification (VC). (a) Von Kossa staining shows that TSA potentiated the Pi-induced VC. Scale bar, 100
More informationWnt16 smact merge VK/AB
A WT Wnt6 smact merge VK/A KO ctrl IgG WT KO Wnt6 smact DAPI SUPPLEMENTAL FIGURE I: Wnt6 expression in MGP-deficient aortae. Immunostaining for Wnt6 and smooth muscle actin (smact) in aortae from 7 day
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/9/eaat5401/dc1 Supplementary Materials for GLK-IKKβ signaling induces dimerization and translocation of the AhR-RORγt complex in IL-17A induction and autoimmune
More informationAccelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells. in the injured sites
Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells in the injured sites Yunyuan Li, Reza Baradar Jalili, Aziz Ghahary Department of Surgery, University of British Columbia,
More informationStargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression
Supplementary Information Stargazin regulates AMPA receptor trafficking through adaptor protein complexes during long term depression Shinji Matsuda, Wataru Kakegawa, Timotheus Budisantoso, Toshihiro Nomura,
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation
More informationSupplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.
Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. (a) A graphic depiction of the approach to determining the stability of
More informationSupplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.
Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3230 a GM13267(ZW) WCE C N M H 2 O 2 : p(s1981) 2 2 LDH Lamin A/C β-integrin c b d AT Flag- WT Flag- RQ H 2 O 2 IgG p (S1981) p (S1981) 2 IP: Flag N.S. 2 e f A: Untreated AT5 cells B: AT5
More informationWT Day 90 after injections
Supplementary Figure 1 a Day 1 after injections Day 9 after injections Klf5 +/- Day 1 after injections Klf5 +/- Day 9 after injections BLM PBS b Day 1 after injections Dermal thickness (μm) 3 1 Day 9 after
More informationFigure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
More informationSupplementary information for: Ten-Eleven Translocation-2 (Tet2) Is Involved in Myogenic Differentiation of Skeletal Myoblast Cells in
Supplementary information for: Ten-Eleven Translocation-2 (Tet2) Is Involved in Myogenic Differentiation of Skeletal Myoblast Cells in Vitro Xia Zhong*, Qian-Qian Wang*, Jian-Wei Li, Yu-Mei Zhang, Xiao-Rong
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3562 In the format provided by the authors and unedited. Supplementary Figure 1 Glucose deficiency induced FH-ATF2 interaction. In b-m, immunoblotting or immunoprecipitation analyses were
More informationSupplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy
Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy of various tumor type TRCs, including H22 (murine hepatocarcinoma) and CT26 (murine colon cancer). Bar, 50 µm. b, B16 cells
More informationSupplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and
Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary
More informationSupplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4
SUPPLEMENTARY FIGURE LEGENDS Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4 directly up-regulates the expression of NIPP1 and CCNF that together inhibit protein phosphatase
More informationSupplementary Information
Supplementary Information Supplementary Figures Supplementary Figure 1. MLK1-4 phosphorylate MEK in the presence of RAF inhibitors. (a) H157 cells were transiently transfected with Flag- or HA-tagged MLK1-4
More informationSupplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide,
Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, conjugated with either TAT or Myristic acid and biotin for
More informationSupplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2
Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 female) or wild-type (5 months old, 1 male; 11 months old,
More informationSupplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,
Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time
More informationFig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination
More informationMa, et al. Supplemental Data
Ma, et al Supplemental Data Title: Calpain mediates pulmonary vascular remodeling in rodent models of pulmonary hypertension and its inhibition attenuates pathologic features of disease Authors: Wanli
More informationDual PI3K/ERK inhibition induces necroptotic cell death of Hodgkin Lymphoma cells through IER3 downregulation
Dual PI3K/ERK inhibition induces necroptotic cell death of Hodgkin Lymphoma cells through IER3 downregulation *Silvia Laura Locatelli, 1 Giuseppa Careddu, 1 Giuliano Giuseppe Stirparo, 1 Luca Castagna,
More informationSupplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated
Supplementary Figure Legends Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated with either vehicle (left; n=3) or CCl 4 (right; n=3) were co-immunostained for NRP-1 (green)
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Generation of the AARE-Gene system construct. (a) Position and sequence alignment of AAREs extracted from human Trb3, Chop or Atf3 promoters. AARE core sequences are boxed in grey.
More informationRevision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines
Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines Further information can be found at: http://stke.sciencemag.org/sites/default/files/researcharticlerevmsinstructions_0.pdf.
More informationSarker et al. Supplementary Material. Subcellular Fractionation
Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged
More informationSupplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various
Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various GST-tagged N-terminal truncated APP fragments including GST-APP full-length (FL), APP (123-695), APP (189-695), or
More informationSUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells
SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal
More informationSupplementary Table 1. PCR amplification conditions for each primer pair. Primer sequence
- 1 - Supplementary Tables Supplementary Table 1. PCR amplification conditions for each primer pair Primer sequence FN1 S - CAAAGCAAGCCCGGTTGT AS - CGCTCCCACTGTTGATTTATCTG ITGα2 S - TTAGGTTACTCTGTGGCTGCAATT
More informationSupplementary Data. Flvcr1a TCTAAGGCCCAGTAGGACCC GGCCTCAACTGCCTGGGAGC AGAGGGCAACCTCGGTGTCC
Supplementary Data Supplementary Materials and Methods Measurement of reactive oxygen species accumulation in fresh intestinal rings Accumulation of reactive oxygen species in fresh intestinal rings was
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 Sox2 localizes in neutrophils of mouse spleen. (a) Microscopy analysis of Sox2 and MPO in wild-type mouse spleen. Nucl, nucleus. (b) Immunohistochemistry staining of Sox2 and MPO
More informationCell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
More informationIntestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by. Regulating Occludin
Intestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by Regulating Occludin Chaithanya Chelakkot 1,ǂ, Jaewang Ghim 2,3,ǂ, Nirmal Rajasekaran 4, Jong-Sun Choi 5, Jung-Hwan
More informationSupplementary Information. A novel human endogenous retroviral protein inhibits cell-cell fusion. Supplementary Figures:
Supplementary Information A novel human endogenous retroviral protein inhibits cell-cell fusion Jun Sugimoto, Makiko Sugimoto, Helene Bernstein, Yoshihiro Jinno and Danny J. Schust Supplementary Figures:
More informationSupplementary Information
Supplementary Information Sam68 modulates the promoter specificity of NF-κB and mediates expression of CD25 in activated T cells Kai Fu 1, 6, Xin Sun 1, 6, Wenxin Zheng 1, 6, Eric M. Wier 1, Andrea Hodgson
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12119 SUPPLEMENTARY FIGURES AND LEGENDS pre-let-7a- 1 +14U pre-let-7a- 1 Ddx3x Dhx30 Dis3l2 Elavl1 Ggt5 Hnrnph 2 Osbpl5 Puf60 Rnpc3 Rpl7 Sf3b3 Sf3b4 Tia1 Triobp U2af1 U2af2 1 6 2 4 3
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2271 Supplementary Figure a! WM266.4 mock WM266.4 #7 sirna WM266.4 #10 sirna SKMEL28 mock SKMEL28 #7 sirna SKMEL28 #10 sirna WM1361 mock WM1361 #7 sirna WM1361 #10 sirna 9 WM266. WM136
More informationSupplementary Figure 1.
Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed
More informationHPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,
1 HPV E oncoprotein targets histone methyltransferases for modulating specific gene transcription 3 5 Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, Cheng-Ming Chiang, Sheng-Chung
More informationSupplementary Figure 1 Collision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK2, PPK3 and PPK4 respectively.
Supplementary Figure 1 lision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK, PPK3 and PPK respectively. % of nuclei with signal / field a 5 c ppif3:gus pppk1:gus 0 35 30 5 0 15 10
More informationOnline Supplementary Information
Online Supplementary Information NLRP4 negatively regulates type I interferon signaling by targeting TBK1 for degradation via E3 ubiquitin ligase DTX4 Jun Cui 1,4,6,7, Yinyin Li 1,5,6,7, Liang Zhu 1, Dan
More informationResveratrol inhibits epithelial-mesenchymal transition of retinal. pigment epithelium and development of proliferative vitreoretinopathy
Resveratrol inhibits epithelial-mesenchymal transition of retinal pigment epithelium and development of proliferative vitreoretinopathy Keijiro Ishikawa, 1,2 Shikun He, 2, 3 Hiroto Terasaki, 1 Hossein
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2743 Figure S1 stabilizes cellular protein level, post-transcriptionally. (a, b) and DDR1 were RNAi-depleted from HEK.293.-CBG cells. Western blots with indicated antibodies (a). RT-PCRs
More informationLong Noncoding RNA LOC Suppresses Apoptosis by. Targeting mir p and mir-4767 in Vascular Endothelial Cells
Long Noncoding RNA LOC100129973 Suppresses Apoptosis by Targeting mir-4707-5p and mir-4767 in Vascular Endothelial Cells Wei Lu 1, ShuYa Huang 1, Le Su 1, BaoXiang Zhao 2, *, JunYing Miao 1, 3, * 1 Shandong
More informationRegulation of axonal and dendritic growth by the extracellular calcium-sensing
Regulation of axonal and dendritic growth by the extracellular calcium-sensing receptor (CaSR). Thomas N. Vizard, Gerard W. O Keeffe, Humberto Gutierrez, Claudine H. Kos, Daniela Riccardi, Alun M. Davies
More informationFigure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible
More informationSupplementary Figure Legends. Figure-S1 Molecular basis of ASS1 deficiency in myxofibrosarcoma: (A)
Supplementary Figure Legends Figure-S1 Molecular basis of ASS1 deficiency in myxofibrosarcoma: (A) High-resolution oligonucleotide-based array comparative genomic hybridization shows normal DNA copy number
More informationCancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information
Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information 1. Supplementary Figure S1-S10: Pages 2-11 2. Supplementary References:
More informationSupplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail
Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail were stained with propidium iodide (PI), anti-cd45 (FITC),
More informationsupplementary information
DOI: 10.1038/ncb2172 Figure S1 p53 regulates cellular NADPH and lipid levels via inhibition of G6PD. (a) U2OS cells stably expressing p53 shrna or a control shrna were transfected with control sirna or
More informationAppendix. Table of Contents: Appendix Table S1. Appendix Figure S1. Appendix Figure S2. Appendix Figure S3. Appendix Figure S4. Appendix Figure S5
Appendix Table of Contents: Appendix Table S1 Appendix Figure S1 Appendix Figure S2 Appendix Figure S3 Appendix Figure S4 Appendix Figure S5 Appendix Figure Legends 1 Cases Stain Intensity Multiple Lesions
More informationGiardia RNAi Paper Discussion. Supplemental - VSG clonality. Variant-specific surface protein VSP9B10
Giardia RNAi Paper Discussion Supplemental - VSG clonality VSP9B10 Green - VSP9B10 antibody Blue - DAPI Demonstration that cell line expresses a single VSP Variant-specific surface protein Outside Inside
More informationJCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Kimura et al.,
Supplemental material JCB Kimura et al., http://www.jcb.org/cgi/content/full/jcb.201503023/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. TRIMs regulate IFN-γ induced autophagy. (A and B) HC image analysis
More informationSupplementary Information. Conversion of vascular endothelial cells into multipotent stem-like cells
Supplementary Information Conversion of vascular endothelial cells into multipotent stem-like cells Damian Medici 1, Eileen M. Shore 2,3,4, Vitali Y. Lounev 2,4, Frederick S. Kaplan 2,4,5, Raghu Kalluri
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Nakajima and Tanoue, http://www.jcb.org/cgi/content/full/jcb.201104118/dc1 Figure S1. DLD-1 cells exhibit the characteristic morphology
More informationSupplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured
Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured under static conditions. Cells were seeded in the chamber area of the device and cultured overnight without medium perfusion.
More informationXiaoqing Zhang, Guo Zhang, Hai Zhang, Michael Karin, Hua Bai, and Dongsheng Cai
Cell, Volume 135 Supplemental Data Hypothalamic IKKβ/NF-κB and ER Stress Link Overnutrition to Energy Imbalance and Obesity Xiaoqing Zhang, Guo Zhang, Hai Zhang, Michael Karin, Hua Bai, and Dongsheng Cai
More informationSupplementary Methods
Supplementary Methods Microarray Data Analysis Gene expression data were obtained by hybridising a total of 24 samples from 6 experimental groups (n=4 per group) to Illumina HumanHT-12 Expression BeadChips.
More informationSUPPLEMENTARY INFORMATION
(Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).
More informationFig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector.
Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector. (a) Western blotting analysis and (b) qpcr analysis of eif6 expression in HEK293 T cells transfected with either
More informationSupplementary materials
Supplementary materials NADPH oxidase promotes Parkinsonian phenotypes by impairing autophagic flux in an mtorc1- independent fashion in a cellular model of Parkinson s disease Rituraj Pal 1, Lakshya Bajaj
More informationSupplementary Data. For generation of stable cell lines, U87MG cells posttransfection
Supplementary Data Supplementary Materials and Methods Chromatin immunoprecipitation In this study, chromatin immunoprecipitation (ChIP) experiments were performed with the SimpleChIP Enzymatic Chromatin
More informationSupporting Information
Supporting Information Chakrabarty et al. 10.1073/pnas.1018001108 SI Materials and Methods Cell Lines. All cell lines were purchased from the American Type Culture Collection. Media and FBS were purchased
More informationNature Structural & Molecular Biology: doi: /nsmb.1583
Acetylation by GCN5 regulates CDC6 phosphorylation in the S-phase of the cell cycle Roberta Paolinelli 1,2, Ramiro Mendoza-Maldonado 2, Anna Cereseto 1 and Mauro Giacca 2 1 Molecular Biology Laboratory,
More informationTranscriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death
SUPPLEMENTAL DATA Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death Huajun Jin 1, Arthi Kanthasamy 1, Vellareddy Anantharam
More informationSupplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
More information(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower
Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that
More informationSupplementary Methods Plasmid constructs
Supplementary Methods Plasmid constructs. Mouse cdna encoding SHP-1, amplified from mrna of RAW264.7 macrophages with primer 5'cgtgcctgcccagacaaactgt3' and 5'cggaattcagacgaatgcccagatcacttcc3', was cloned
More informationNature Immunology: doi: /ni.3015
Supplementary Figure 1 Role of RIP1-RIP3 and PGAM5 in RNA virus induced inflammasome activation. (a) LDH release from LPS-primed BMDMs from wild-type mice (WT), Rip3 -/- or Nlrp3 -/- mice infected with
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3164 Supplementary Figure 1 Validation of effective Gnas deletion and epithelial thickness. a, Representative genotyping in mice treated or not with tamoxifen to show Gnas deletion. To
More informationSupplemental Information. Mitophagy Controls the Activities. of Tumor Suppressor p53. to Regulate Hepatic Cancer Stem Cells
Molecular Cell, Volume 68 Supplemental Information Mitophagy Controls the Activities of Tumor Suppressor to Regulate Hepatic Cancer Stem Cells Kai Liu, Jiyoung Lee, Ja Yeon Kim, Linya Wang, Yongjun Tian,
More informationSUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION
SUPPLEMENTAL MATERIALS SIRTUIN PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF ACTIVATION Haranatha R. Potteti*, Subbiah Rajasekaran*, Senthilkumar B. Rajamohan*, Chandramohan R. Tamatam,
More informationSupplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.
Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Scale bar represent 100 nm. The sizes of EVs from MDA-MB-231-D3H1 (D3H1),
More informationIsolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
More informationmonoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in
Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal
More informationSupplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1
Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 4.52E-18 PDK1 6.77E-18 CSRP2 4.42E-17 PFKP 1.23E-14 MSH2 3.79E-13 NARF_A 5.56E-13 ADFP 5.56E-13 FAM13A1 1.56E-12 FAM29A_A 1.22E-11 CA9 1.54E-11
More informationSupplementary Figure S1. N-terminal fragments of LRRK1 bind to Grb2.
Myc- HA-Grb2 Mr(K) 105 IP HA 75 25 105 1-1163 1-595 - + - + - + 1164-1989 Blot Myc HA total lysate 75 25 Myc HA Supplementary Figure S1. N-terminal fragments of bind to Grb2. COS7 cells were cotransfected
More informationSupplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA
More informationMeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132
Conservation Figure S1. Schematic showing 3 UTR (top; thick black line), mir132 MRE (arrow) and nucleotide sequence conservation (vertical black lines; http://genome.ucsc.edu). a GFP mir1-1 mir132 b GFP
More informationSupplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans
Supplemental Materials Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Madhusudhan Budatha, Shayzreen Roshanravan, Qian Zheng, Cecilia Weislander, Shelby L. Chapman,
More informationSupplementary Figure 1
Supplementary Figure 1 PTEN promotes virus-induced expression of IFNB1 and its downstream genes. (a) Quantitative RT-PCR analysis of IFNB1 mrna (left) and ELISA of IFN-β (right) in HEK 293 cells (2 10
More informationSupplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray
More informationTime allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.
UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2017-18 CELL BIOLOGY BIO-5005B Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section
More informationSupplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated
Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated reporter luciferase constructs, HEK293T cells were stimulated
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature06721 SUPPLEMENTARY INFORMATION. Supplemental Figure Legends Supplemental Figure 1 The distribution of hatx-1[82q] in Cos7 cells. Cos7 cells are co-transfected with hatx-1[82q]-gfp (green)
More informationThe Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit
Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline
More informationSingle cell resolution in vivo imaging of DNA damage following PARP inhibition. Supplementary Data
Single cell resolution in vivo imaging of DNA damage following PARP inhibition Katherine S. Yang, Rainer H. Kohler, Matthieu Landon, Randy Giedt, and Ralph Weissleder Supplementary Data Supplementary Figures
More informationSupplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr
Supplemental figure legends Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr A, LβT2 cells were transfected with either scrambled or PEA-15 sirna. Cells were then
More informationtranscription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1,
Supplementary Data Supplementary Figure Legends Supplementary Figure 1 FHL-mediated TGFβ-responsive reporter transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected
More informationP21 Regulates Mmp-13 Expression Through Stat3 Signaling In Chondrocytes
P21 Regulates Mmp-13 Expression Through Stat3 Signaling In Chondrocytes Shinya Hayashi, MD, PhD, Takaaki Fujishiro, Shingo Hashimoto, Noriyuki Kanzaki, Kenjiro Iwasa, Shuhei Sakata, Nobuaki Chinzei, Shinsuke
More informationControl + SDS + 2BME. Control + SDS. Control
Supplementary Figure 1 2BME:2-mercaptoethanol Control Control + SDS Control + SDS + 2BME Control Control + SDS Control + SDS + 2BME Control Control + SDS Control + SDS + 2BME Ephrin-B2 Oligomers Ephrin-B2
More informationSupplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
More information(a) Immunoblotting to show the migration position of Flag-tagged MAVS
Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing
More informationSite-Directed Mutagenesis. Mutations in four Smad4 sites of mouse Gat1 promoter
Supplement Supporting Materials and Methods Site-Directed Mutagenesis. Mutations in four Smad4 sites of mouse Gat1 promoter were independently generated using a two-step PCR method. The Smad4 binding site
More informationSupplementary Table, Figures and Videos
Supplementary Table, Figures and Videos Table S1. Oligonucleotides used for different approaches. (A) RT-qPCR study. (B) qpcr study after ChIP assay. (C) Probes used for EMSA. Figure S1. Notch activation
More informationSupplementary Figure 1
Supplementary Figure 1 Virus infection induces RNF128 expression. (a,b) RT-PCR analysis of Rnf128 (RNF128) mrna expression in mouse peritoneal macrophages (a) and THP-1 cells (b) upon stimulation with
More information