Probiotic Strain Isolated from the Vagina of Healthy Women
|
|
- Nathan Malone
- 6 years ago
- Views:
Transcription
1 JB Accepts, published online ahead of print on 1 April 2011 J. Bacteriol. doi: /jb Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved Complete Genome Sequence of Lactococcus lactis subsp. lactis CV56, a Probiotic Strain Isolated from the Vagina of Healthy Women Yong Gao 1, Ying Lu 1, Kun-Ling Teng 1, Mei-Ling Chen 1, Hua-Jun Zheng 2, Yong-Qiang Zhu 2, Jin Zhong 1 * 1 State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese Academy of Sciences, Beijing , P.R. China 2 Chinese National Human Genome Center at Shanghai,Shanghai , P.R. China *Corresponding author. Mailing address: State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese Academy of Sciences, NO.1 Beichen West Road, Chaoyang District, Beijing , P.R. China. Phone/Fax: (86) zhongj@sun.im.ac.cn. 1
2 Abstract: Lactic acid bacteria existed in urinogenital system play an important role in maintaining the health of host. Here, we report the finished and annotated genome of a Lactococcus strain isolated from the vagina of healthy women, which shows probiotic properties including nisina production and adhesion to vaginal epithelial cells. The vast diversity of lactic acid bacteria (LAB) allows them to occupy different kinds of ecological niches such as dairy products, meats, gastrointestinal tract and vagina (5). As the dominant bacteria in the vaginal microflora of healthy women, Lactobacillus play an important role in maintaining the natural balance of microflora (2). So far, only a few probitoic Lactococcus strains like L. lactis ssp. lactis HV219 have been found in vaginal microflora (6). In this study, we identified a Lactococcus strain named L. lactis subsp. lactis CV56 from vaginal secretions of healthy women. This strain not only exhibits strong antimicrobial activity by producing bacteriocin nisina but also shows higher adhesion ability to vaginal epithelial cells than other Lactococcus strains such as L. lactis MG1363. The whole genome sequencing of L. lactis CV56 will help us identify the genomic diversity, metabolic diversity, probiotic and adaptation 2
3 properties of Lactococcus species in different environment. The whole genome was sequenced by using Roche GS FLX system. A total of 233,256 reads, counting up to 87,594,199 bases were obtained, providing a 36 fold coverage. Assembly was performed by Newbler ( and produced 77 contigs. The contig order was first determined through BLASTN against the reference strain L. lactis IL1403 and then confirmed by Polymerase Chain Reaction (PCR). Relationship of contigs that can t be ordered by reference was determined by multiplexa PCR. Gaps were closed by sequencing PCR fragments from the genomic DNA template using ABI Phred, Phrap and Consed software package ( was used for finally assembly and edition, and low quality regions of the genome were resequenced. Putative protein coding sequences were identified by Glimmer3 (1) and those shorter than 90 bp were eliminated. All predicted proteins were searched against KEGG databases, no-redundant protein database (nr, NCBI) and conserved domain database (CDD) using BLASTP or RPSBLAST. The trna genes were predicted by trna-scan SE1.21 (4) and the rrna genes were detected using RNAmmer 1.2 server (3). Functional classification of proteins was conducted using NCBI clusters of orthologous groups (COG). The complete genome of L. lactis CV56 consists of a single, circular 3
4 chromosome (2,399,458 bp, % GC content) and five plasmids: pcv56a (44,098 bp, 32.08% GC content), pcv56b (35,934 bp, 34.54% GC content), pcv56c (31,442 bp, 32.49% GC content), pcv56d (5,543 bp, 32.24% GC content) and pcv56e (2,262 bp, 33.82% GC content). The chromosome of L. lactis CV56 contains 2352 predicated protein-coding genes, 6 rrna operons and 62 trna genes, while the five plasmids contain 116 protein-coding genes. Of all the 2468 protein-coding genes, we assign 1812(73.42 % ) with biological function, 494(20.02 % )as conserved hypothetical protein, 102(4.13 %)as novel hypothetical protein and 60(2.43 %) as pseudogenes. Genes involved in nisina biosynthesis and cell adhesion are revealed on the chromosome. Besides, the five plasmids contain protein-coding genes involved in antibiotic resistance, bacteriophage resistance, cation transport and stress response. Nucleotide sequence accession numbers. The genome sequence of L. lactis CV56 has been deposited in GenBank under the accession numbers between CP and CP This research was supported by Beijing Natural Science Foundation ( ), the National Natural Science Foundation of China ( ) and Knowledge Innovation Program of the Chinese Academy of Sciences (KSCX2-EW-G-14, KSCX2-EW-J-6, KSCX2-EW-Q-14). 4
5 Delcher, A. L., D. Harmon, S. Kasif, O. White, and S. L. Salzberg Improved microbial gene identification with GLIMMER. Nucleic Acids Res 27: Donati, L., A. Di Vico, M. Nucci, L. Quagliozzi, T. Spagnuolo, A. Labianca, M. Bracaglia, F. Ianniello, A. Caruso, and G. Paradisi Vaginal microbial flora and outcome of pregnancy. Arch Gynecol Obstet 281: Lagesen, K., P. Hallin, E. A. Rodland, H. H. Staerfeldt, T. Rognes, and D. W. Ussery RNAmmer: consistent and rapid annotation of ribosomal RNA genes. Nucleic Acids Res 35: Lowe, T. M., and S. R. Eddy trnascan-se: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res 25: Pfeiler, E. A., and T. R. Klaenhammer The genomics of lactic acid bacteria. Trends in Microbiology 15: Todorov, S. D., M. Botes, S. T. Danova, and L. M. Dicks Probiotic properties of Lactococcus lactis ssp. lactis HV219, isolated from human vaginal secretions. J Appl Microbiol 103:
Complete genome sequence of Clostridium acetobutylicum. DSM 1731, a solvent producing strain with multi-replicon
JB Accepts, published online ahead of print on 8 July 2011 J. Bacteriol. doi:10.1128/jb.05596-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationComplete Genome Sequence of Bifidobacterium longum subsp. longum KACC 91563
JB Accepts, published online ahead of print on 8 July 2011 J. Bacteriol. doi:10.1128/jb.05620-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationComplete Genome Sequence of Pathogenic Bacterium
JB Accepts, published online ahead of print on 25 March 2011 J. Bacteriol. doi:10.1128/jb.00301-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationGenome sequence of Acinetobacter baumannii MDR-TJ
JB Accepts, published online ahead of print on 11 March 2011 J. Bacteriol. doi:10.1128/jb.00226-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationComplete Genome Sequence of the Polycyclic Aromatic Hydrocarbon-Degrading. Bacterium Alteromonas sp. Strain SN2
JB Accepts, published online ahead of print on 24 June 2011 J. Bacteriol. doi:10.1128/jb.05252-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationGenome sequence of Enterobacter mori type strain LMG 25706, a
JB Accepts, published online ahead of print on 20 May 2011 J. Bacteriol. doi:10.1128/jb.05200-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationACCEPTED. Korean patient isolate in an effort to understand the prevalence, antibiotic resistance, and
JB Accepts, published online ahead of print on June 00 J. Bacteriol. doi:./jb.00-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. 1 1 1 1 1
More informationTitle: Genome sequence of lineage III Listeria monocytogenes strain HCC23
JB Accepts, published online ahead of print on 20 May 2011 J. Bacteriol. doi:10.1128/jb.05236-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationfor industrial production of guanosine and ribavirin
JB Accepts, published online ahead of print on 22 April 2011 J. Bacteriol. doi:10.1128/jb.00440-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationCECT 5716, a probiotic strain isolated from human milk
JB Accepts, published online ahead of print on 1 July 0 J. Bacteriol. doi:./jb.000- Copyright 0, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. 1 GENOME
More informationProkaryotic Annotation Pipeline SOP HGSC, Baylor College of Medicine
1 Abstract A prokaryotic annotation pipeline was developed to automatically annotate draft and complete bacterial genomes. The protein coding genes in the genomes are predicted by the combination of Glimmer
More informationJB Accepts, published online ahead of print on 24 June 2011 J. Bacteriol. doi: /jb
JB Accepts, published online ahead of print on 24 June 2011 J. Bacteriol. doi:10.1128/jb.05345-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationJB Accepts, published online ahead of print on 26 February 2010 J. Bacteriol. doi: /jb
JB Accepts, published online ahead of print on 26 February 2010 J. Bacteriol. doi:10.1128/jb.00109-10 Copyright 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights
More informationGene Prediction Group
Group Ben, Jasreet, Jeff, Jia, Kunal TACCTGAAAAAGCACATAATACTTATGCGTATCCGCCCTAAACACTGCCTTCTTTCTCAA AGAAGATGTCGCCGCTTTTCAACCGAACGATGTGTTCTTCGCCGTTTTCTCGGTAGTGCA TATCGATGATTCACGTTTCGGCAGTGCAGGCACCGGCGCATATTCAGGATACCGGACGCT
More informationComplete nucleotide sequence of pld-tex-kl, a 66-kb plasmid of Legionella dumoffii TEX-KL strain
Complete nucleotide sequence of pld-tex-kl, a 66-kb plasmid of Legionella dumoffii TEX-KL strain Plasmid, 2007 Tian Qin a,*, Hideki Hirakawa b, Ken-ichiro Iida a, Kenshiro Oshima c, Masahira Hattori c,d,
More informationDr. Sabri M. Naser Department of Biology and Biotechnology An-Najah National University Nablus, Palestine
Molecular identification of lactic acid bacteria Enterococcus, Lactobacillus and Streptococcus based on phes, rpoa and atpa multilocus sequence analysis (MLSA) Dr. Sabri M. Naser Department of Biology
More informationDetection of Mobile Genetic Elements (MGEs) in Bacterial Genomes
Detection of Mobile Genetic Elements (MGEs) in Bacterial Genomes PhD student: Zheng WANG Supervisor: Professor Margaret IP Department of Microbiology, CUHK Date: 3rd Dec, 2013 Contents Introduction Methodology
More informationApplied bioinformatics in genomics
Applied bioinformatics in genomics Productive bioinformatics in a genome sequencing center Heiko Liesegang Warschau 2005 The omics pyramid: 1. 2. 3. 4. 5. Genome sequencing Genome annotation Transcriptomics
More informationLeonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
More informationGene Prediction Background & Strategy Faction 2 February 22, 2017
Gene Prediction Background & Strategy Faction 2 February 22, 2017 Group Members: Michelle Kim Khushbu Patel Krithika Xinrui Zhou Chen Lin Sujun Zhao Hannah Hatchell rohini mopuri Jack Cartee Introduction
More informationGene Prediction Final Presentation
Gene Prediction Final Presentation Final Proposed Pipeline Assembled Genome Protein - coding Gene Prediction Ab Initio Prodigal Glimmer GeneMarkS RNA Gene Prediction ncrna Specific trnascanse (trna) RNAmmer
More informationUCSC Genome Browser. Introduction to ab initio and evidence-based gene finding
UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene
More informationApplications of Next Generation Sequencing in Metagenomics Studies
Applications of Next Generation Sequencing in Metagenomics Studies Francesca Rizzo, PhD Genomix4life Laboratory of Molecular Medicine and Genomics Department of Medicine and Surgery University of Salerno
More informationBioinformatics Course AA 2017/2018 Tutorial 2
UNIVERSITÀ DEGLI STUDI DI PAVIA - FACOLTÀ DI SCIENZE MM.FF.NN. - LM MOLECULAR BIOLOGY AND GENETICS Bioinformatics Course AA 2017/2018 Tutorial 2 Anna Maria Floriano annamaria.floriano01@universitadipavia.it
More informationCorynebacterium pseudotuberculosis genome sequencing: Final Report
Summary To provide an invaluable resource to assist in the development of diagnostics and vaccines against caseous lymphadenitis (CLA), the sequencing of the genome of a virulent, United Kingdom Corynebacterium
More informationContact us for more information and a quotation
GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA
More informationOptimal clone identifier for genomic shotgun libraries: OC Identifier tool
Optimal clone identifier for genomic shotgun libraries: OC Identifier tool M.E. Cantão 1,2, J.E. Ferreira 1 and E.G.M. Lemos 2 1 Departamento de Ciência da Computação, Instituto de Matemática e Estatística,
More informationab initio and Evidence-Based Gene Finding
ab initio and Evidence-Based Gene Finding A basic introduction to annotation Outline What is annotation? ab initio gene finding Genome databases on the web Basics of the UCSC browser Evidence-based gene
More informationA Novel Approach for Rapid Identification and Sequencing of Different Bacteriocins Produced by LAB Based on a Practical Immunity Class
A Novel Approach for Rapid Identification and Sequencing of Different Bacteriocins Produced by LAB Based on a Practical Immunity Class S. Macwana and P.M. Muriana Story in Brief Bacteriocins (i.e., inhibitory
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature12212 Supplementary Discussion Contamination Assessment We evaluated the amount of human contamination in our viral DNA preparations by identifying sequences
More informationFunctional annotation of metagenomes
Functional annotation of metagenomes Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Introduction Functional analysis Objectives:
More informationBig Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
More information(A) Extrachromosomal DNA (B) RNA found in bacterial cells (C) Is part of the bacterial chromosome (D) Is part of the eukaryote chromosome
Microbiology - Problem Drill 07: Microbial Genetics and Biotechnology No. 1 of 10 1. A plasmid is? (A) Extrachromosomal DNA (B) RNA found in bacterial cells (C) Is part of the bacterial chromosome (D)
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationComparative genomics of clinical isolates of Pseudomonas fluorescens, including the discovery of a novel disease-associated subclade.
Comparative genomics of clinical isolates of Pseudomonas fluorescens, including the discovery of a novel disease-associated subclade. by Brittan Starr Scales A dissertation submitted in partial fulfillment
More informationGenetics. Chapter 9 - Microbial Genetics. Chromosome. Genes. Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination
Chapter 9 - Microbial Genetics Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination Genetics Genome (The sum total of genetic material of a cell is referred to as the genome.) Chromosome
More informationWhole Genome Sequence Data Quality Control and Validation
Whole Genome Sequence Data Quality Control and Validation GoSeqIt ApS / Ved Klædebo 9 / 2970 Hørsholm VAT No. DK37842524 / Phone +45 26 97 90 82 / Web: www.goseqit.com / mail: mail@goseqit.com Table of
More informationBacterial Genetics. Prof. Dr. Asem Shehabi Faculty of Medicine University of Jordan
Bacterial Genetics Prof. Dr. Asem Shehabi Faculty of Medicine University of Jordan Bacterial Genes-1 All patterns of growth, metabolism, essential cellular structures, biological characteristics of bacteria
More informationGene Prediction: Preliminary Results
Gene Prediction: Preliminary Results Outline Preliminary Pipeline Programs Program Comparison Tests Metrics Gene Prediction Tools: Usage + Results GeneMarkS Glimmer 3.0 Prodigal BLAST ncrna Prediction
More informationDNA REPLICATION & BIOTECHNOLOGY Biology Study Review
DNA REPLICATION & BIOTECHNOLOGY Biology Study Review DNA DNA is found in, in the nucleus. It controls cellular activity by regulating the production of, which includes It is a very long molecule made up
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationI. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics
Ch 12 Lecture Notes - DNA I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics 1 II. Griffith and Transformation
More informationTwo methods for the genetic di erentiation of Lactococcus lactis ssp. lactis and cremoris based on di erences in the 16S rrna gene sequence
FEMS Microbiology Letters 166 (1998) 15^20 Two methods for the genetic di erentiation of Lactococcus lactis ssp. lactis and cremoris based on di erences in the 16S rrna gene sequence Lawrence J.H. Ward
More informationGenome Analysis. Bacterial genome projects
Genome Analysis Bacterial Genome sequencing does this help us in the investigation of adaptive responses/regulatory systems? Genome Sequencing Projects strategy & methods annotation Comparative genomics
More informationAnalysis Report. Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly
Analysis Report Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly 1 Table of Contents 1. Result of Whole Genome Assembly
More informationHigh throughput omics and BIOINFORMATICS
High throughput omics and BIOINFORMATICS Giuseppe D'Auria Seville, February 2009 Genomes from isolated bacteria $ $ $ $ $ $ $ $ $$ $ $ $ $ $ $ $ se q se uen q c se uen ing q c se uen ing qu c en ing c
More informationInsights into mutualism mechanism and versatile. metabolism of Ketogulonicigenium vulgare Hbe602 based on
SUPPLEMENTARY INFORMATION Insights into mutualism mechanism and versatile metabolism of Ketogulonicigenium vulgare Hbe602 based on comparative genomics and metabolomics studies Nan Jia, Ming-Zhu Ding *,
More informationDetermining presence/absence threshold for your dataset
Determining presence/absence threshold for your dataset In PanCGHweb there are two ways to determine the presence/absence calling threshold. One is based on Receiver Operating Curves (ROC) generated for
More informationMatthew Tinning Australian Genome Research Facility. July 2012
Next-Generation Sequencing: an overview of technologies and applications Matthew Tinning Australian Genome Research Facility July 2012 History of Sequencing Where have we been? 1869 Discovery of DNA 1909
More informationInfectious Disease Omics
Infectious Disease Omics Metagenomics Ernest Diez Benavente LSHTM ernest.diezbenavente@lshtm.ac.uk Course outline What is metagenomics? In situ, culture-free genomic characterization of the taxonomic and
More information1. Page 90: Cellular Metabolism Explain what the everyday use of the word metabolism means to you.
Biology 100 Winter 2013 North Seattle Community College Reading Guide 10 Metabolism, Enzymes, and Building a Protein Reading: 1) Chapter 5 (various pages) in Microbiology Demystified 2) Chapter 7 (various
More informationChapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering
Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death
More informationFunctional Annotation - Faction 2 Background and Strategy
Functional Annotation - Faction 2 Background and Strategy March 8, 2017 Khushbu Patel Karan Kapuria Angela Mo Harrison Kim David Lu Christian Colon Nolan English Bowen Yang Cong Gao RECAP. WE ARE HERE!!
More informationNGS part 2: applications. Tobias Österlund
NGS part 2: applications Tobias Österlund tobiaso@chalmers.se NGS part of the course Week 4 Friday 13/2 15.15-17.00 NGS lecture 1: Introduction to NGS, alignment, assembly Week 6 Thursday 26/2 08.00-09.45
More informationMicrobial Community Assembly and Dynamics:.from AMD biofilms to colonization of the premature infant gut
Microbial Community Assembly and Dynamics:.from AMD biofilms to colonization of the premature infant gut Jill Banfield Talk Overview i) AMD microbial biofilms: an example of reproducible community assembly
More informationCloning and Sequencing of the Gene Encoding Curvaticin FS47, an Anti- Listerial Bacteriocin Produced by Lactobacillus curvatus FS47
Cloning and Sequencing of the Gene Encoding Curvaticin FS47, an Anti- Listerial Bacteriocin Produced by Lactobacillus curvatus FS47 S. Macwana, L. Ma, M.A. Cousin, and P.M. Muriana Story in Brief Curvaticin
More informationProtein Synthesis: From Gene RNA Protein Trait
Protein Synthesis: From Gene RNA Protein Trait Human Genome The human genome contains about genes. Each gene is a of DNA (sequence of nitrogen bases) contained within each chromosome. Each chromosome contains
More informationBacterial Genome Annotation
Bacterial Genome Annotation Bacterial Genome Annotation For an annotation you want to predict from the sequence, all of... protein-coding genes their stop-start the resulting protein the function the control
More informationThe gene. Fig. 1. The general structure of gene
The gene is the basic unit of heredity and carries the genetic information for a given protein and/or RNA molecule. In biochemical terms a gene represents a fragment of deoxyribonucleic acid (DNA), which
More informationDraft 3 Annotation of DGA06H06, Contig 1 Jeannette Wong Bio4342W 27 April 2009
Page 1 Draft 3 Annotation of DGA06H06, Contig 1 Jeannette Wong Bio4342W 27 April 2009 Page 2 Introduction: Annotation is the process of analyzing the genomic sequence of an organism. Besides identifying
More informationa-dB. Code assigned:
This form should be used for all taxonomic proposals. Please complete all those modules that are applicable (and then delete the unwanted sections). For guidance, see the notes written in blue and the
More information4. Analysing genes II Isolate mutants*
.. 4. Analysing s II Isolate mutants* Using the mutant to isolate the classify mutants by complementation analysis wild type study phenotype of mutants mutant 1 - use mutant to isolate sequence put individual
More informationModule 6 Microbial Genetics. Chapter 8
Module 6 Microbial Genetics Chapter 8 Structure and function of the genetic material Genetics science of o Study of what genes are, how they determine the characteristics of an organism, how they carry
More informationGreene 1. Finishing of DEUG The entire genome of Drosophila eugracilis has recently been sequenced using Roche
Greene 1 Harley Greene Bio434W Elgin Finishing of DEUG4927002 Abstract The entire genome of Drosophila eugracilis has recently been sequenced using Roche 454 pyrosequencing and Illumina paired-end reads
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationFluorescent markers for strains in mixed cheese starter cultures
Fluorescent markers for strains in mixed cheese starter cultures fermentation, starter cultures, fluorescent proteins Svetlana Alexeeva (svetlana.alexeeva@wur.nl) MSc - 6 months Cheese manufacturing relies
More informationSupplemental Materials. DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC
Supplemental Materials DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC BAA-1523 = JCM 15061) was grown in defined basal medium amended with 0.5 mm 1,1,2- trichloroethane (1,1,2-TCA)
More informationRecombinant DNA recombinant DNA DNA cloning gene cloning
DNA Technology Recombinant DNA In recombinant DNA, DNA from two different sources, often two species, are combined into the same DNA molecule. DNA cloning permits production of multiple copies of a specific
More informationName: Ally Bonney. Date: January 29, 2015 February 24, Purpose
Name: Ally Bonney Title: Genome sequencing and annotation of Pseudomonas veronii isolated from Oregon State University soil and 16S rrna characterization of Corvallis, OR soil microbial populations Date:
More informationGene Prediction Chengwei Luo, Amanda McCook, Nadeem Bulsara, Phillip Lee, Neha Gupta, and Divya Anjan Kumar
Gene Prediction Chengwei Luo, Amanda McCook, Nadeem Bulsara, Phillip Lee, Neha Gupta, and Divya Anjan Kumar Gene Prediction Introduction Protein-coding gene prediction RNA gene prediction Modification
More informationMate-pair library data improves genome assembly
De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate
More informationBacterial Genetics. Stijn van der Veen
Bacterial Genetics Stijn van der Veen Differentiating bacterial species Morphology (shape) Composition (cell envelope and other structures) Metabolism & growth characteristics Genetics Differentiating
More informationNCBI & Other Genome Databases. BME 110/BIOL 181 CompBio Tools
NCBI & Other Genome Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2011 Admin Reading Dummies Ch 3 Assigned Review: "The impact of next-generation sequencing technology on genetics" by E.
More informationSequence Analysis Lab Protocol
Sequence Analysis Lab Protocol You will need this handout of instructions The sequence of your plasmid from the ABI The Accession number for Lambda DNA J02459 The Accession number for puc 18 is L09136
More informationM I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication
More informationGene Prediction. Lab & Preliminary Results. Faction 2 Saturday, March 11, 2017
Gene Prediction Lab & Preliminary Results Faction 2 Saturday, March 11, 2017 Group Members: Michelle Kim Khushbu Patel Krithika Xinrui Zhou Chen Lin Sujun Zhao Hannah Hatchell rohini mopuri Jack Cartee
More informationVideos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
More informationWhy study sequence similarity?
Sequence Similarity Why study sequence similarity? Possible indication of common ancestry Similarity of structure implies similar biological function even among apparently distant organisms Example context:
More informationThe draft genome sequence of a marine Streptomyces sp. strain PP-C42 isolated from the Baltic Sea
JB Accepts, published online ahead of print on 13 May 2011 J. Bacteriol. doi:10.1128/jb.05097-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationThis is the accepted version of this conference paper: Buckingham, Lawrence and Hogan, James and Mann, Scott
QUT Digital Repository: http://eprints.qut.edu.au/ This is the accepted version of this conference paper: Buckingham, Lawrence and Hogan, James and Mann, Scott and Wirges, Sally (2010) BLAST Atlas : a
More informationTECHNIQUES FOR STUDYING METAGENOME DATASETS METAGENOMES TO SYSTEMS.
TECHNIQUES FOR STUDYING METAGENOME DATASETS METAGENOMES TO SYSTEMS. Ian Jeffery I.Jeffery@ucc.ie What is metagenomics Metagenomics is the study of genetic material recovered directly from environmental
More informationOverview: The DNA Toolbox
Overview: The DNA Toolbox Sequencing of the genomes of more than 7,000 species was under way in 2010 DNA sequencing has depended on advances in technology, starting with making recombinant DNA In recombinant
More informationTutorial for Stop codon reassignment in the wild
Tutorial for Stop codon reassignment in the wild Learning Objectives This tutorial has two learning objectives: 1. Finding evidence of stop codon reassignment on DNA fragments. 2. Detecting and confirming
More information9/19/13. cdna libraries, EST clusters, gene prediction and functional annotation. Biosciences 741: Genomics Fall, 2013 Week 3
cdna libraries, EST clusters, gene prediction and functional annotation Biosciences 741: Genomics Fall, 2013 Week 3 1 2 3 4 5 6 Figure 2.14 Relationship between gene structure, cdna, and EST sequences
More informationBiosc10 schedule reminders
Biosc10 schedule reminders Review of molecular biology basics DNA Is each person s DNA the same, or unique? What does DNA look like? What are the three parts of each DNA nucleotide Which DNA bases pair,
More informationBIOINFROMATIC APPROACHES FOR BUILDING COMPARATIVE MOLECULAR DATABASE OF BACTERIOCIN PRODUCING SELECTED LACTIC ACID BACTERIA
Original Research Article DOI - 10.26479/2017.0304.06 BIOINFROMATIC APPROACHES FOR BUILDING COMPARATIVE MOLECULAR DATABASE OF BACTERIOCIN PRODUCING SELECTED LACTIC ACID BACTERIA Priyanka Gautam Bioinformatics
More informationGlossary of Commonly used Annotation Terms
Glossary of Commonly used Annotation Terms Akela a general use server for the annotation group as well as other groups throughout TIGR. Annotation Notebook a link from the gene list page that is associated
More informationDeveloping the CRISPR Interference System to Understand Bacterial Gene Function
Developing the CRISPR Interference System to Understand Bacterial Gene Function Dept. of Veterinary Microbiology and Preventative Medicine Megan Weems, April Nelson, Victoria Thompson, Dr. Gregory Phillips
More informationGene Prediction Chengwei Luo, Amanda McCook, Nadeem Bulsara, Phillip Lee, Neha Gupta, and Divya Anjan Kumar
Gene Prediction Chengwei Luo, Amanda McCook, Nadeem Bulsara, Phillip Lee, Neha Gupta, and Divya Anjan Kumar Gene Prediction Introduction Protein-coding gene prediction RNA gene prediction Modification
More informationB.Sc V Semester Question Bank. B.Sc V Semester Question Bank. Prepared by Nitin Swamy, Department of Biotechnology, SACJ Page 1 of 6
B.Sc V Semester Question Bank Prepared by Nitin Swamy, Department of Biotechnology, SACJ Page 1 of 6 UNIT I Genetic Material Different forms of DNA (DNA topology):- B-form, Z-form, D-form; Gene structure-introns,exons
More informationGenome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does
More informationChapter 10 Microbial Genetics: New Genes for Old Germs
Chapter 10 Microbial Genetics: New Genes for Old Germs Objectives: After reading Chapter Ten, you should understand The structure and complexity of the bacterial chromosome and the significance of plasmids.
More informationFrom Infection to Genbank
From Infection to Genbank How a pathogenic bacterium gets its genome to NCBI Torsten Seemann VLSCI - Life Sciences Computation Centre - Genomics Theme - Lab Meeting - Friday 27 April 2012 The steps 1.
More informationFermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
More informationMCB 102 University of California, Berkeley August 11 13, Problem Set 8
MCB 102 University of California, Berkeley August 11 13, 2009 Isabelle Philipp Handout Problem Set 8 The answer key will be posted by Tuesday August 11. Try to solve the problem sets always first without
More informationPractical Bioinformatics for Life Scientists. Week 14, Lecture 27. István Albert Bioinformatics Consulting Center Penn State
Practical Bioinformatics for Life Scientists Week 14, Lecture 27 István Albert Bioinformatics Consulting Center Penn State No homework this week Project to be given out next Thursday (Dec 1 st ) Due following
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationGenomes DNA Genes to Proteins. The human genome is a multi-volume instruction manual
Dr. Kathleen Hill Assistant Professor Department of Biology The University of Western Ontario khill22@uwo.ca Office Hours: Monday 1 to 5pm Room 333 Western Science Centre Research Website: http://www.uwo.ca/biology/faculty/hill/index.htm
More information3. This is the name of the small fragments of DNA that are replicated with several RNA primers in between them:
Section A: Multiple Choice [15] 1. The central dogma states that: a) DNA is held in the nucleus, which is translated into an amino acid strand, which leaves the nucleus and is transcribed into a mrna strand
More information