NCBI & Other Genome Databases. BME 110/BIOL 181 CompBio Tools
|
|
|
- Gerald Hodges
- 6 years ago
- Views:
Transcription
1 NCBI & Other Genome Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2011
2 Admin Reading Dummies Ch 3 Assigned Review: "The impact of next-generation sequencing technology on genetics" by E. Mardis Recommended Review: "Application of next-generation sequencing technologies to microbial genetics" by MacLean et al. Discussion Sections Start Next Week Everyone have laptops?
3 Computational Biology Tools Human Genome: 3 billion A/C/T/G s staring at you - Now what?? Have we seen this sequence before? Similarity searching Discovering completely new genes The Gene Finders Finding a role for each new gene: Functional genomics
4 One sequence read from the human genome Is this part of a gene? What does it do? >ctg14072 CATGGAAACCCCANAAAAAACATGAAATGCATACCGAACTACAAAAAAGG AAAATAAATATAAACACATTCCAAAACTTAAAAATGAAGGAGATTTCAGA CAGTCCCTCCTGGTAAAATGTGAAATTGCACCCCAGCTGCAGCAGCTACT GTAAATATCCAAGGAATCAGTTTTAAGTGTTTGGGGATCCCAGGGATCCC TGCAAAGCACTCAGGATTTTAACATTAAGCTCACAAATTACAGCAGCTGG CCGGGCACAGTGGCTCACGCCCGTAATCCCAGCACTTTTGGAGGCCGAGG CAGGTGGATCACCTGAGGTCTCCACTAAAAATACAAAAAACTAGCCAGGG TGTGTGGCGGACATCTGTAATCCCAGCCACTTCGGGGGCTGAGGCAGGAG AATCACTTGAACCCGGGAGGTGGAGGTTGCATTGAGCTGACGTTATGCCA TTGCACTCCGGCCTGNGCAACAGAGAGAAACTTCATCTCTAACTACTAAT TACAGCAACCAACAGGCCTCTAGGTTAGTTACCACCCTAACCTTTTCGTT CGAGATTTTCAAACCACCTTGAACGTGGGTATTTTTTGTGGGTCCTTTAT CTTCATTCATTAATCACATTATCAGACATTCCCTGAGTGGCCTGGT
5 Annotating a Genome Goals: 1. Note the positions of any known or predicted genes 2. Give as much information about the function of genes as possible (and certainty of information) Purpose is to help biologists make connections between their work and the sequence you are annotating
6 What s in a Genome? 1. Genes 2. Introns (eukaryotes only) 3. Gene regulatory sequences (promotors, enhancers, silencers, suppressors) 4. Structural elements (telomeres, centromeres) 5. Repetitive DNA 6. Pseudogenes 7. Everything else (important??)
7 Two Types of Genes 1) Protein-coding Purpose: make proteins Common Pattern: [Start codon] [codon 1] [codon 2] [ ] [Stop codon] 2) Non-protein Coding RNAs (ncrnas): Purpose: make a functional RNA No common pattern shared by all ncrnas
8 Protein Gene Finders Based on statistical analysis of DNA for Start codon [ATG] (sometimes TTG/GTG) Stop codon [TGA], [TAG], [TAA] Codon frequencies Splice junctions - sequence motifs (patterns) at borders between exons and introns
9 Differences Between Eukaryotic and Prokaryotic Genes/Genomes Prokaryotes (Bacteria + Archaea) Usually no introns, so no need to detect introns; ORFs ~ genes Multiple genes are often organized into operons functionally related genes that are co-transcribed in one long mrna Usually a single large circular chromosome (0.5-5 Mbp); often with some small circular DNA elements called plasmids 70-95% of genome codes for genes Eukaryotes Genes broken up into exons and spliced out introns ; complicates accurate gene prediction Generally, minority of DNA in genome codes for genes Multicellular eukaryotes have much more complex regulation
10 Graphical Genome Browsing NCBI Source for sequences and default annotation for all genomes, as well as browsers UCSC Genome Browser human & many other genomes genome.ucsc.edu, archaea.ucsc.edu, microbes.ucsc.edu Ensembl major European human genome browser, similar goals as UCSC browsers JGI s IMG Newest, fanciest microbial genome browser and genome comparison tools
11 What Genomes Are Available? List of completed genomes increases almost every week GOLD Website: Listing of finished and in progress genomes published, completed genomes (30% increase from last year) 10,048+ genome sequencing projects in progress
12 Getting Sequences: NCBI Go to Choose Nucleotide or Protein Type in query, same rules as for making PubMed queries (logical operators, limits, etc) Or, to get a genome, choose Genome Project and type species name
13 Genbank File Format Completely annotated sequence LOCUS NC_ bp DNA circular BCT 07-APR-2003 DEFINITION Aeropyrum pernix, complete genome. ACCESSION NC_ SOURCE Aeropyrum pernix ORGANISM Aeropyrum pernix Archaea; Crenarchaeota; Thermoprotei; Desulfurococcales; Desulfurococcaceae; Aeropyrum. FEATURES Location /Qualifiers source /organism="aeropyrum pernix" /db_xref="taxon:56636" gene complement( ) /gene="ape0001" CDS complement( ) /gene="ape0001" /codon_start=1 /product="hypothetical protein" BASE COUNT a c g t ORIGIN 1 aaataataat aaaaattaag tgactcatgc attatcctac gaggtaaaaa tatgttataa 61 attgtcccag actaccatca atttagggac aatagtgttt aagggatggc cttcggagct 121 ggcagctcgc gggttcaaac tcgcgtaggg cccgagttct agttatagtt gcgtggattt...
14 FASTA File Format -Mostly sequence, little description -General format often used for web server analysis tools >Seq_name Description (all on first line) AGTACGGACCAGACAGGCCGATAGGACG AGGCCGATAGGACGAGGCCGATAGGACG CGTTA >Next_seq_name Description ACCGATTACCGA
15 Download A Whole Genome! NCBI Genomes ftp://ftp.ncbi.nih.gov/genomes/ What do all these files mean?.faa FASTA format, all predicted proteins.ffn FASTA format, all predicted protein genes (ORFs) (DNA).frn FASTA format, all predicted RNA genes (DNA).fna FASTA format, whole genome (DNA).gbk Genbank format, whole genome with complete annotation
16 Graphical Displays of Genome Information
17 UCSC Archaeal Genome Browser
18 Yeast Genome Database (SGD)
19 Yeast Gene Entry (ROK1)
20 Joint Genome Institute s Microbial Genome Browser: IMG
21 Demonstration UCSC genome browser
Genome and DNA Sequence Databases. BME 110: CompBio Tools Todd Lowe April 5, 2007
Genome and DNA Sequence Databases BME 110: CompBio Tools Todd Lowe April 5, 2007 Admin Reading: Chapters 2 & 3 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring07/bme110-calendar.html
COMPUTER RESOURCES II:
COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer
Computational gene finding. Devika Subramanian Comp 470
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) The biological context Lec 1 Lec 2 Lec 3 Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
TIGR THE INSTITUTE FOR GENOMIC RESEARCH
Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,
Agenda. Web Databases for Drosophila. Gene annotation workflow. GEP Drosophila annotation projects 01/01/2018. Annotation adding labels to a sequence
Agenda GEP annotation project overview Web Databases for Drosophila An introduction to web tools, databases and NCBI BLAST Web databases for Drosophila annotation UCSC Genome Browser NCBI / BLAST FlyBase
Wednesday, November 22, 17. Exons and Introns
Exons and Introns Introns and Exons Exons: coded regions of DNA that get transcribed and translated into proteins make up 5% of the genome Introns and Exons Introns: non-coded regions of DNA Must be removed
UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding
UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene
Hands-On Four Investigating Inherited Diseases
Hands-On Four Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise
Genomics and Gene Recognition Genes and Blue Genes
Genomics and Gene Recognition Genes and Blue Genes November 3, 2004 Eukaryotic Gene Structure eukaryotic genomes are considerably more complex than those of prokaryotes eukaryotic cells have organelles
DNA is normally found in pairs, held together by hydrogen bonds between the bases
Bioinformatics Biology Review The genetic code is stored in DNA Deoxyribonucleic acid. DNA molecules are chains of four nucleotide bases Guanine, Thymine, Cytosine, Adenine DNA is normally found in pairs,
MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE?
MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE? Lesson Plan: Title Introduction to the Genome Browser: what is a gene? JOYCE STAMM Objectives Demonstrate basic skills in using the UCSC Genome
Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.
Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions
CHAPTERS , 17: Eukaryotic Genetics
CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions
user s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
Prokaryotic Transcription
Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are
Chimp Sequence Annotation: Region 2_3
Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker
Genomics and Gene Recognition Genes and Blue Genes
Genomics and Gene Recognition Genes and Blue Genes November 1, 2004 Prokaryotic Gene Structure prokaryotes are simplest free-living organisms studying prokaryotes can give us a sense what is the minimum
Sequence Analysis Lab Protocol
Sequence Analysis Lab Protocol You will need this handout of instructions The sequence of your plasmid from the ABI The Accession number for Lambda DNA J02459 The Accession number for puc 18 is L09136
Chapter 5. explain how information is submitted to and processed by biological databases.
Introduction to Databases The computer belongs on the benchtop in the modern biology lab, along with other essential equipment. A network of online databases provides researchers with quick access to information
Computational Biology and Bioinformatics
Computational Biology and Bioinformatics Computational biology Development of algorithms to solve problems in biology Bioinformatics Application of computational biology to the analysis and management
user s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC
Outline. Introduction to ab initio and evidence-based gene finding. Prokaryotic gene predictions
Outline Introduction to ab initio and evidence-based gene finding Overview of computational gene predictions Different types of eukaryotic gene predictors Common types of gene prediction errors Wilson
MCDB 1041 Class 21 Splicing and Gene Expression
MCDB 1041 Class 21 Splicing and Gene Expression Learning Goals Describe the role of introns and exons Interpret the possible outcomes of alternative splicing Relate the generation of protein from DNA to
RNA Genomics II. BME 110: CompBio Tools Todd Lowe & Andrew Uzilov May 17, 2011
RNA Genomics II BME 110: CompBio Tools Todd Lowe & Andrew Uzilov May 17, 2011 1 TIME Why RNA? An evolutionary perspective The RNA World hypotheses: life arose as self-replicating non-coding RNA (ncrna)
Multiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
Computational Molecular Biology Intro. Alexander (Sacha) Gultyaev
Computational Molecular Biology Intro Alexander (Sacha) Gultyaev a.p.goultiaev@liacs.leidenuniv.nl Biopolymer sequences DNA: double-helical nucleic acid. Monomers: nucleotides C, A, T, G. RNA: (single-stranded)
Genome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks
Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional
Gene Identification in silico
Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction
Genomes summary. Bacterial genome sizes
Genomes summary 1. >930 bacterial genomes sequenced. 2. Circular. Genes densely packed. 3. 2-10 Mbases, 470-7,000 genes 4. Genomes of >200 eukaryotes (45 higher ) sequenced. 5. Linear chromosomes 6. On
Year III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics
Algorithms in Bioinformatics
Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline Central Dogma of Molecular
Genome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does
DNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
CS 4491/CS 7990 SPECIAL TOPICS IN BIOINFORMATICS
1 CS 4491/CS 7990 SPECIAL TOPICS IN BIOINFORMATICS * Some contents are adapted from Dr. Jean Gao at UT Arlington Mingon Kang, PhD Computer Science, Kennesaw State University 2 Genetics The discovery of
Student Learning Outcomes (SLOS)
Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get
PRiB - Mandatory Project 2. Gene finding using HMMs
PRiB - Mandatory Project 2 Gene finding using HMMs Viterbi decoding >NC_002737.1 Streptococcus pyogenes M1 GAS TTGTTGATATTCTGTTTTTTCTTTTTTAGTTTTCCACATGAAAAATAGTTGAAAACAATA GCGGTGTCCCCTTAAAATGGCTTTTCCACAGGTTGTGGAGAACCCAAATTAACAGTGTTA
Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]
![Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]](/thumbs/75/71877651.jpg "Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]")
BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Prequisites: None Resources: The BLAST web
O C. 5 th C. 3 rd C. the national health museum
Elements of Molecular Biology Cells Cells is a basic unit of all living organisms. It stores all information to replicate itself Nucleus, chromosomes, genes, All living things are made of cells Prokaryote,
Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
Analysis Report. Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly
Analysis Report Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly 1 Table of Contents 1. Result of Whole Genome Assembly
Bioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
Outline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018
Outline Overview of the GEP annotation projects Annotation of Drosophila Primer January 2018 GEP annotation workflow Practice applying the GEP annotation strategy Wilson Leung and Chris Shaffer AAACAACAATCATAAATAGAGGAAGTTTTCGGAATATACGATAAGTGAAATATCGTTCT
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with
3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome
Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts
Molecular Biology, Lecture 3 DNA Replication
Molecular Biology, Lecture 3 DNA Replication We will continue talking about DNA replication. We have previously t discussed the structure of DNA. DNA replication is the copying of the whole DNA content
Training materials.
Training materials Ensembl training materials are protected by a CC BY license http://creativecommons.org/licenses/by/4.0/ If you wish to re-use these materials, please credit Ensembl for their creation
Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
Transcription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
Bio 121 Practice Exam 3
The material covered on Exam 3 includes lecture since the last exam and text chapters 13-21. Be sure that you read chapter 19, which was not represented in the notes. 1. Which of the following is an enveloped
Computational analysis of non-coding RNA. Andrew Uzilov BME110 Tue, Nov 16, 2010
Computational analysis of non-coding RNA Andrew Uzilov auzilov@ucsc.edu BME110 Tue, Nov 16, 2010 1 Corrected/updated talk slides are here: http://tinyurl.com/uzilovrna redirects to: http://users.soe.ucsc.edu/~auzilov/bme110/fall2010/
CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
Genes and gene finding
Genes and gene finding Ben Langmead Department of Computer Science You are free to use these slides. If you do, please sign the guestbook (www.langmead-lab.org/teaching-materials), or email me (ben.langmead@gmail.com)
RNA-Seq Software, Tools, and Workflows
RNA-Seq Software, Tools, and Workflows Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 1, 2016 Some mrna-seq Applications Differential gene expression analysis Transcriptional profiling Assumption:
Last Update: 12/31/2017. Recommended Background Tutorial: An Introduction to NCBI BLAST
BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by T. Cordonnier, C. Shaffer, W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Recommended Background
Ensembl Tools. EBI is an Outstation of the European Molecular Biology Laboratory.
Ensembl Tools EBI is an Outstation of the European Molecular Biology Laboratory. Questions? We ve muted all the mics Ask questions in the Chat box in the webinar interface I will check the Chat box periodically
Developmental Biology BY1101 P. Murphy
Developmental Biology BY1101 P. Murphy Lecture 7 Cellular differentiation and the regulation of gene expression. In this lecture we looked at two main questions: How is gene expression regulated? (revision
Nucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.
Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid
CHAPTER 21 LECTURE SLIDES
CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
Outline. Gene Finding Questions. Recap: Prokaryotic gene finding Eukaryotic gene finding The human gene complement Regulation
Tues, Nov 29: Gene Finding 1 Online FCE s: Thru Dec 12 Thurs, Dec 1: Gene Finding 2 Tues, Dec 6: PS5 due Project presentations 1 (see course web site for schedule) Thurs, Dec 8 Final papers due Project
Name Class Date. Practice Test
Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.
Eukaryotic Gene Structure
Eukaryotic Gene Structure Terminology Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Gene Basic physical and
Mapping strategies for sequence reads
Mapping strategies for sequence reads Ernest Turro University of Cambridge 21 Oct 2013 Quantification A basic aim in genomics is working out the contents of a biological sample. 1. What distinct elements
MATH 5610, Computational Biology
MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class
Introduction to Bioinformatics
Introduction to Bioinformatics Contents Cell biology Organisms and cells Building blocks of cells How genes encode proteins? Bioinformatics What is bioinformatics? Practical applications Tools and databases
Introduction to the UCSC genome browser
Introduction to the UCSC genome browser Dominik Beck NHMRC Peter Doherty and CINSW ECR Fellow, Senior Lecturer Lowy Cancer Research Centre, UNSW and Centre for Health Technology, UTS SYDNEY NSW AUSTRALIA
Bio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
Genomic region (ENCODE) Gene definitions
DNA From genes to proteins Bioinformatics Methods RNA PROMOTER ELEMENTS TRANSCRIPTION Iosif Vaisman mrna SPLICE SITES SPLICING Email: ivaisman@gmu.edu START CODON STOP CODON TRANSLATION PROTEIN From genes
Lecture 2: Central Dogma of Molecular Biology & Intro to Programming
Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Central Dogma of Molecular Biology Proteins: workhorse molecules of biological systems Proteins are synthesized from the genetic blueprints
Lecture 2: Biology Basics Continued
Lecture 2: Biology Basics Continued Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine, Guanine, Thymine, and Cytosine which pair A-T and
Gene-centered resources at NCBI
COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving
The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
Transcription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
The Central Dogma of Molecular Biology
The Central Dogma of Molecular Biology In the Central Dogma of Molecular Biology, this process occurs when mrna is made from DNA? A. TranscripBon B. TranslaBon C. ReplicaBon 1 DNA: The ultimate instruction
Annotating 7G24-63 Justin Richner May 4, Figure 1: Map of my sequence
Annotating 7G24-63 Justin Richner May 4, 2005 Zfh2 exons Thd1 exons Pur-alpha exons 0 40 kb 8 = 1 kb = LINE, Penelope = DNA/Transib, Transib1 = DINE = Novel Repeat = LTR/PAO, Diver2 I = LTR/Gypsy, Invader
Regulation of Gene Expression
CAMPBELL BIOLOGY IN FOCUS URRY CAIN WASSERMAN MINORSKY REECE 15 Regulation of Gene Expression Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge, Simon Fraser University SECOND EDITION
Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
Relationship of Gene s Types and Introns
Chi To BME 230 Final Project Relationship of Gene s Types and Introns Abstract: The relationship in gene ontology classification and the modification of the length of introns through out the evolution
What is RNA? Another type of nucleic acid A working copy of DNA Does not matter if it is damaged or destroyed
RNA Section 3.1 What is RNA? Another type of nucleic acid A working copy of DNA Does not matter if it is damaged or destroyed Used to direct the production of proteins that determines an organisms characteristics
DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
Bundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
DNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
Chapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
REGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes
REGULATION OF PROTEIN SYNTHESIS II. Eukaryotes Complexities of eukaryotic gene expression! Several steps needed for synthesis of mrna! Separation in space of transcription and translation! Compartmentation
Lecture 11: Gene Prediction
Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are
Guided tour to Ensembl
Guided tour to Ensembl Introduction Introduction to the Ensembl project Walk-through of the browser Variations and Functional Genomics Comparative Genomics BioMart Ensembl Genome browser http://www.ensembl.org
Fig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
Ch. 10 Notes DNA: Transcription and Translation
Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that
Genome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)
Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA
Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)
AP Biology Biology, Campbell and Reece, 10th Edition Adapted from chapter reading guides originally created by Lynn Miriello Name: Chapter 16 The Molecular Basis of Inheritance Concept 16.1 DNA is the
RNA-Seq with the Tuxedo Suite
RNA-Seq with the Tuxedo Suite Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 2015 Workshop The Basic Tuxedo Suite References Trapnell C, et al. 2009 TopHat: discovering splice junctions with
Chapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
KEY CONCEPT DNA was identified as the genetic material through a series of experiments. Found live S with R bacteria and injected
Section 1: Identifying DNA as the Genetic Material KEY CONCEPT DNA was identified as the genetic material through a series of experiments. VOCABULARY bacteriophage MAIN IDEA: Griffith finds a transforming
PrimePCR Assay Validation Report
Gene Information Gene Name SRY (sex determining region Y)-box 6 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SOX6 Human This gene encodes a member of the
Name Per AP: CHAPTER 27: PROKARYOTES (Bacteria) p559,
AP: CHAPTER 27: PROKARYOTES (Bacteria) p559, 561-564 1. How does the bacterial chromosome compare to a eukaryotic chromosome? 2. What is a plasmid? 3. How fast can bacteria reproduce? 4. What is a bacterial
Agenda. Annotation of Drosophila. Muller element nomenclature. Annotation: Adding labels to a sequence. GEP Drosophila annotation projects 01/03/2018
Agenda Annotation of Drosophila January 2018 Overview of the GEP annotation project GEP annotation strategy Types of evidence Analysis tools Web databases Annotation of a single isoform (walkthrough) Wilson
AP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.