Molecular Techniques in Crop Improvement
|
|
- Trevor Osborne
- 5 years ago
- Views:
Transcription
1 Molecular Techniques in Crop Improvement
2 S. Mohan Jain Editors D.S. Brar Molecular Techniques in Crop Improvement 2nd Edition
3 Editors S. Mohan Jain Department of Applied Biology University of Helsinki Finland D.S. Brar International Rice Research Institute (IRRI) Social Sciences Division Metro Manila Philippines ISBN e-isbn DOI / Springer Dordrecht Heidelberg London New York Library of Congress Control Number: Springer Science+Business Media B.V No part of this work may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, microfilming, recording or otherwise, without written permission from the Publisher, with the exception of any material supplied specifically for the purpose of being entered and executed on a computer system, for exclusive use by the purchaser of the work. Printed on acid-free paper Springer is part of Springer Science+Business Media (
4 Preface Most of the plant breeding programs aim to increase yield, disease and insect resistance, abiotic stress tolerance and to improve quality characteristics. The value of new plant breeding products and varieties in increasing food production has been demonstrated time and again. To meet growing need of ever increasing human population, we need to enhance food production for sustaining food supply. Furthermore, several biotic and abiotic stresses continue to threaten crop productivity. Moreover with urbanization, land for cultivation is shrinking and several environment concerns involving excessive use of fertilizers and agro-chemicals, soil and water pollution including water scarcity are key issues in increasing crop productivity and food sustainability. Plant breeders therefore, has the major challenge how to increase crop productivity with limited land, limited water, limited chemicals and limited labour particularly in the context of global climate changes. In the genomics era, advances in molecular biology have opened new opportunities to accelerate plant breeding processes and in overcoming some of the above constraints limiting crop productivity. Molecular markers have become important tools in the hands of plant breeders in marker assisted breeding and for enhancing the selection efficiency for various agronomic traits in precision plant breeding. The isolation, cloning and moving of genes from diverse biological sources into plant genomes holds promise to broaden the gene pool of crops and develop new plant varieties for specific traits that determine yield, quality, and resistance to biotic and abiotic stresses. New genomics tools will be of great value to support conventional breeding for sustainable food production especially under the climate change and meet demand of ever growing human population. The first edition of this book, Molecular techniques in crop improvement published in 2002 covered various topics related to molecular markers and their application in plant breeding. Since then, major advances have been made in molecular tagging of genes/qtls governing complex agronomic traits, identification of candidate genes and in applying marker assisted breeding for tolerance to biotic and abiotic stresses and quality traits. Recent advances in transgenic technologies, genome sequencing and functional genomics offer tremendous opportunities to support plant breeding programs. Therefore, we are encouraged to cover recent advances and come out with the second edition of this book. In this edition we have included 31 chapters, which are divided into four parts. Part I is on Plant
5 vi Preface Breeding in the genomic era and has four chapters. Part II deals with Molecular Markers and their application and contains six chapters. Eleven chapters dealing with different aspects of Genomics are covered in Part III. The remaining ten chapters dealing with Transgenic Technologies are dealt in Part IV. Some of the major topics covered in this book are on: QTL analysis, comparative genomics, functional genomics, bioinformatics, gene-based marker systems, automation of DNA marker analysis, molecular markers for abiotic and biotic stresses as well as for germ plasm conservation, gene pyramiding, gene stacking, gene silencing, TILLING, CISGENESIS, microarray, metablomics, proteomics, transcriptomics, micrornas, marker-free transformation, Plant RNAi, and floriculture genetic engineering. All manuscripts were peer reviewed and revised accordingly. We are thankful to all reviewers for sparing precious time to review manuscripts, and that certainly helped to improve their quality. This edition will certainly benefit plant breeders, biotechnologists, and molecular biologists, and an excellent source to provide advanced knowledge of molecular biology to post graduate students involved in biotechnology and plant breeding research. We take this opportunity to express our gratitude to Springer publisher for giving us this opportunity to bring out the second edition of this book. S. Mohan Jain D.S. Brar
6 Contents Part I Plant Breeding in the Genomics Era 1 QTL Analysis in Plant Breeding... 3 Maria J. Asins, Guillermo P. Bernet, Irene Villalta, and Emilio A. Carbonell 2 Comparative Genomics in Crop Plants Mehboob-ur-Rahman and Andrew H. Paterson 3 Functional Genomics For Crop Improvement Seedhabadee Ganeshan, Pallavi Sharma, and Ravindra N. Chibbar 4 Bioinformatics Tools for Crop Research and Breeding Jayashree B and Dave Hoisington Part II Molecular Markers and Their Application 5 Gene-Based Marker Systems in Plants: High Throughput Approaches for Marker Discovery and Genotyping Rajeev K Varshney 6 Automation of DNA Marker Analysis for Molecular Breeding in Crops Christophe Dayteg and Stine Tuvesson 7 Pyramiding Genes for Enhancing Tolerance to Abiotic and Biotic Stresses Raveendran Muthurajan and Ponnuswami Balasubramanian 8 Application of Molecular Markers for Breeding Disease Resistant Varieties in Crop Plants Ana M. Torres
7 viii Contents 9 Molecular Markers Based Approaches for Drought Tolerance Deepmala Sehgal and Rattan Yadav 10 Molecular Markers for Characterizing and Conserving Crop Plant Germplasm G. Barcaccia Part III Genomics 11 Rice Genomics Narayana M. Upadhyaya and Elizabeth S. Dennis 12 Genomics for Wheat Improvement Michael G. Francki 13 TILLING for Mutations in Model Plants and Crops Zerihun Tadele, Chikelu MBA, and Bradley J. Till 14 Microarray Analysis for Studying the Abiotic Stress Responses in Plants Motoaki Seki, Masanori Okamoto, Akihiro Matsui, Jong-Myong Kim, Yukio Kurihara, Junko Ishida, Taeko Morosawa, Makiko Kawashima, Taiko Kim To, and Kazuo Shinozaki 15 Roles of MicroRNAs in Plant Abiotic Stress Ricky Lewis, Venugopal Mendu, David Mcnear, and Guiliang Tang 16 Molecular Tools for Enhancing Salinity Tolerance in Plants Jesus Cuartero, Maria C. Bolarin, Vicente Moreno, and Benito Pineda 17 DNA Microarray as Part of a Genomic-Assisted Breeding Approach Eva Vincze and Steve Bowra 18 Unravelling Gene Function Through Mutagenesis Andrea Hricová, Pedro Robles, and Víctor Quesada 19 Techniques in Plant Proteomics Ludovít Škultéty, Maxym Danchenko, Anna Pret ová, and Martin Hajduch 20 Metabolomics: Novel Tool for Studying Complex Biological Systems Federica Maltese and Robert Verpoorte
8 Contents ix 21 Transcriptomic Analysis of Multiple Enviornmental Stresses in Plants Niranjani Jambunathan, Michael Puckette, and Ramamurthy Mahalingam Part IV Transgenic Technologies 22 Marker-Free Targeted Transformation Hiroyasu Ebinuma and Kazuya Nanto 23 Promoter Trapping in Plants Using T-DNA Mutagenesis R. Srinivasan and Dipnarayan Saha 24 Plant Genome Engineering Using Zinc Finger Nucleases Sandeep Kumar and William F. Thompson 25 Cisgenesis Evert Jacobsen and Henk J. Schouten 26 Gene Stacking E. Douglas and C. Halpin 27 Gene Silencing Sunee Kertbundit, Miloslav Juříček, and Timothy C. Hall 28 Plant RNAi and Crop Improvement Masayuki Isshiki and Hiroaki Kodama 29 Metabolomics in Fruit Development Kati Hanhineva and Asaph Aharoni 30 Genetic Engineering in Floriculture Yoshikazu Tanaka and Ryutaro Aida 31 Transgenesis and Genomics in Forage Crops Toshihiko Yamada, Ken-ichi Tamura, Xun Wang, and Yukiko Aoyagi Author Index
Molecular Techniques in Crop Improvement
Molecular Techniques in Crop Improvement Molecular Techniques in Crop Improvement Edited by S. Mohan Jain International Atomic Energy Agency, FAO/IAEA Joint Division, Vienna, Austria D.S. Brar International
More informationMolecular Techniques in Crop Improvement
Molecular Techniques in Crop Improvement S. Mohan Jain Editors D.S. Brar Molecular Techniques in Crop Improvement 2nd Edition Editors S. Mohan Jain Department of Applied Biology University of Helsinki
More informationChapter 1 Molecular Genetic Approaches to Maize Improvement an Introduction
Chapter 1 Molecular Genetic Approaches to Maize Improvement an Introduction Robert T. Fraley In the following chapters prominent scientists will discuss the recent genetic improvements in maize that have
More informationT h i r d e d i t i o n For Instructors
T h i r d e d i t i o n For Instructors I n t r o d u c t i o n t o P l a n t B i o t e c h n o l o g y H. S. C h a w l a Introduction to Plant Biotechnology Third Edition T h i r d Edition I n t r o
More informationIMPROVEMENT OF CROP PLANTS FOR INDUSTRIAL END USES
IMPROVEMENT OF CROP PLANTS FOR INDUSTRIAL END USES Improvement of Crop Plants for Industrial End Uses Edited by P. RANALLI C.R.A. -ISCI, Bologna, Italy A C.I.P. Catalogue record for this book is available
More informationThe GMO Handbook. Genetically Modified Animals, Microbes, and Plants in Biotechnology. Edited by. Sarad R. Parekh, PhD
The GMO Handbook The GMO Handbook Genetically Modified Animals, Microbes, and Plants in Biotechnology Edited by Sarad R. Parekh, PhD Dow AgroSciences, Indianapolis, IN * Springer Science+Business Media,
More informationMicroarrays in Diagnostics and Biomarker Development
Microarrays in Diagnostics and Biomarker Development . Editor Microarrays in Diagnostics and Biomarker Development Current and Future Applications Editor CoReBio PACA Luminy Science Park 13288 Marseille
More informationBioinformatics, in general, deals with the following important biological data:
Pocket K No. 23 Bioinformatics for Plant Biotechnology Introduction As of July 30, 2006, scientists around the world are pursuing a total of 2,126 genome projects. There are 405 published complete genomes,
More informationFrançois Eudes Editor. Triticale
Triticale François Eudes Editor Triticale 123 Editor François Eudes Agriculture and Agri-Food Canada Lethbridge, AB Canada ISBN 978-3-319-22550-0 ISBN 978-3-319-22551-7 (ebook) DOI 10.1007/978-3-319-22551-7
More informationGrand Challenges. C r o p S c i e n c e S o c i e t y o f A m e r i c a. Plant Sciences for a Better World
Grand Challenges C r o p S c i e n c e S o c i e t y o f A m e r i c a Plant Sciences for a Better World Written by the Crop Science Society of America (CSSA) Grand Challenge Committee Crop Science Society
More informationMaize breeders decide which combination of traits and environments is needed to breed for both inbreds and hybrids. A trait controlled by genes that
Preface Plant breeding is a science of evolution. The scientific basis of plant breeding started in the 1900s. The rediscovery of Mendelian genetics and the development of the statistical concepts of randomization
More informationREDUCING THE LEVEL OF ANTI-NUTRITIONAL NUTRITIONAL FACTORS IN CANOLA MEAL
REDUCING THE LEVEL OF ANTI-NUTRITIONAL NUTRITIONAL FACTORS IN CANOLA MEAL Randall Weselake University of Alberta Jeff Parker Genome Alberta Canola Meal Research Meeting September 28, 2007 DESIGNING OILSEEDS
More informationSCSC, GENE, MEPS and BIOT 654: Analysis of Complex Genomes (Lec) Spring 2018
SCSC, GENE, MEPS and BIOT 654: Analysis of Complex Genomes (Lec) 1. Instructor: Spring 2018 Name: Professor Dr. Hongbin Zhang E-mail: hbz7049@tamu.edu Office: 427A Heep Center Office Phone: 862-2244 Office
More informationData Mining and Applications in Genomics
Data Mining and Applications in Genomics Lecture Notes in Electrical Engineering Volume 25 For other titles published in this series, go to www.springer.com/series/7818 Sio-Iong Ao Data Mining and Applications
More informationPhilippines Rice Breeding and Production. Elvira D. Morales Plant Variety Protection Office Philippines
Philippines Rice Breeding and Production Elvira D. Morales Plant Variety Protection Office Philippines O GOAL Increase productivity in the different rice growing ecosystems O OBJECTIVE To identify high
More informationWUEMED Drought Course, Bologna, 4-10 July 2006: 5 lectures on Omics and drought by John Bennett, IRRI IRRI. Anthers of field-grown rice cv IR74
Anthers of field-grown rice cv IR74 Apical pore WUEMED Drought Course, Bologna, 4-10 July 2006: 5 lectures on Omics and drought by John Bennett, Basal pore Omics and Drought: Lecture Outline 1. Integration
More informationNew Plant Breeding Techniques: Zn Finger Nucleases and Transcription Factors
New Plant Breeding Techniques: Zn Finger Nucleases and Transcription Factors Andrew F. Roberts, Ph.D. Deputy Director, CERA September 19, 2013 Contents of the talk Old Plant Breeding Techniques and Biosafety
More informationEthics for Biomedical Engineers
Ethics for Biomedical Engineers Jong Yong Abdiel Foo Stephen J. Wilson Andrew P. Bradley Winston Gwee Dennis Kwok-Wing Tam Ethics for Biomedical Engineers Jong Yong Abdiel Foo Electronic and Computer
More informationMETHODS IN MOLECULAR BIOLOGY TM
METHODS IN MOLECULAR BIOLOGY TM Series Editor John M. Walker School of Life Sciences University of Hertfordshire Hatfield, Hertfordshire, AL10 9AB, UK For other titles published in this series, go to www.springer.com/series/7651
More informationMEHDI FARID PAGE 1 OF 5
MEHDI FARID PAGE 1 OF 5 MEHDI FARID BSc. Agronomy, MSc. Crop Physiology, Ph.D. Plant Breeding & Genetics AFNS Department, University of Alberta Edmonton, Alberta T6G 2R3 587-778-3139 mfarid@ualberta.ca
More informationRISK MANAGEMENT AND THE ENVIRONMENT: AGRICULTURE IN PERSPECTIVE
RISK MANAGEMENT AND THE ENVIRONMENT: AGRICULTURE IN PERSPECTIVE Risk Management and the Environment: Agriculture in Perspective Edited by Bruce A. Babcock Center for Agricultural and Rural Development
More informationScience to Support Plant Protection for Horticulture AAFC s Science & Technology Branch
Science to Support Plant Protection for Horticulture AAFC s Science & Technology Branch Crop, Plant Protection and the Environment Committee March 15, 2018 Dr. Della Johnston Outline Strategic direction
More informationTexas A&M AgriLife Research LOWER RIO GRANDE VALLEY REGION RESEARCH GOALS AND IMPACTS. Texas A&M AgriLife Research and Extension Center at Weslaco
Texas A&M AgriLife Research LOWER RIO GRANDE VALLEY REGION RESEARCH GOALS AND IMPACTS Texas A&M AgriLife Research and Extension Center at Weslaco 2015 GOAL Protect water quality and increase the amount
More informationBio-Economic Models applied to Agricultural Systems
Bio-Economic Models applied to Agricultural Systems Guillermo Flichman Editor Bio-Economic Models applied to Agricultural Systems Editor Guillermo Flichman Centre International de Hautes Etudes Agronomiques
More informationDivision of Genetics, ICAR-Indian Agricultural Research Institute, New Delhi
Circular ICAR--HRM Training Programme for Scientific Staff ICAR 2017--18 2017 Genomics--Assisted Breeding Genomics for Crop Improvement (March 1-21, 2018) Programme Director: Dr. Ashok K. Singh Division
More informationAP 2010 Biotechnologie-Bioressources
AP 2010 Biotechnologie-Bioressources Développer de nouvelles variétés de blé pour une agriculture durable: une approche intégrée de la génomique à la sélection Breeding for economically and environmentally
More informationBioinformatics for High Throughput Sequencing
Bioinformatics for High Throughput Sequencing Naiara Rodríguez-Ezpeleta Ana M. Aransay Editors Michael Hackenberg Bioinformatics for High Throughput Sequencing Editors Naiara Rodríguez-Ezpeleta Genome
More informationGrand Challenges. Plant Science for a Better World
Grand Challenges Crop Science Society of America Plant Science for a Better World Written by the CSSA Grand Challenges Committee Crop Science Society of America Headquarters Offices Phone: (608) 273-8080
More informationLegal arguments to keep plants. such as cisgenesis outside the GMO regulation
Legal arguments to keep plants from novel breeding techniques such as cisgenesis outside the GMO regulation dr Henk J Schouten Wageningen University and Research Centre & Inova Fruit bv Content Definition
More informationNPBT in the European Union: Experience, regulation and existing guidance
NPBT in the European Union: Experience, regulation and existing guidance Boet Glandorf GMO Office National Institute of Public Health and the Environment The Netherlands Jaipur, October 10 2014 1 New plant
More informationLecture Notes in Energy 5
Lecture Notes in Energy 5 For further volumes: http://www.springer.com/series/8874 . Hortensia Amaris Monica Alonso Carlos Alvarez Ortega Reactive Power Management of Power Networks with Wind Generation
More informationGenomic resources and gene/qtl discovery in cereals
Genomic resources and gene/qtl discovery in cereals Roberto Tuberosa Dept. of Agroenvironmental Sciences & Technology University of Bologna, Italy The ABDC Congress 1-4 March 2010 Gudalajara, Mexico Outline
More informationStatistical Analysis of Clinical Data on a Pocket Calculator
Statistical Analysis of Clinical Data on a Pocket Calculator Ton J. Cleophas Aeilko H. Zwinderman Statistical Analysis of Clinical Data on a Pocket Calculator Statistics on a Pocket Calculator Prof. Ton
More informationCourse Syllabus for FISH/CMBL 7660 Fall 2008
Course Syllabus for FISH/CMBL 7660 Fall 2008 Course title: Molecular Genetics and Biotechnology Course number: FISH 7660/CMBL7660 Instructor: Dr. John Liu Room: 303 Swingle Hall Lecture: 8:00-9:15 a.m.
More informationGenetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection
Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection Awais Khan Adaptation and Abiotic Stress Genetics, Potato and sweetpotato International Potato
More informationOVERVIEW - STATUS OF SCIENCE AND TECHNOLOGY ADVANCES IN AGRICULTURE BIOTECHNOLOGY
OVERVIEW - STATUS OF SCIENCE AND TECHNOLOGY ADVANCES IN AGRICULTURE BIOTECHNOLOGY Jaipur, 9-10 October 2014 Peter Kearns, PhD OECD New Plant Breeding Techniques Working Group on Harmonization of Regulatory
More informationGene Environment Interaction Analysis. Methods in Bioinformatics and Computational Biology. edited by. Sumiko Anno
Gene Environment Interaction Analysis Methods in Bioinformatics and Computational Biology edited by Sumiko Anno Gene Environment Interaction Analysis Gene Environment Interaction Analysis Methods in
More informationSustainable Agriculture Reviews
Sustainable Agriculture Reviews Volume 4 Series Editor Eric Lichtfouse For other volumes: www.springer.com/series/8380 Other books by Dr. Eric Lichtfouse Sustainable Agriculture Volume 1, 2009 Organic
More informationFUTURE PROSPECTIVES FOR COTTON BIOTECHNOLOGY IN EGYPT
FUTURE PROSPECTIVES FOR COTTON BIOTECHNOLOGY IN EGYPT OSAMA A. MOMTAZ Deputy Director for Research, Agricultural Genetic Engineering Research Institute Agriculture Research Center- EGYPT The Government
More informationThe genetic improvement of wheat and barley for reproductive frost tolerance
The genetic improvement of wheat and barley for reproductive frost tolerance By Jason Reinheimer Bachelor of Agricultural Science, University of Adelaide A thesis submitted for the degree of Doctor of
More informationInnovation in Agriculture. Dr. Ryan K. Bartlett, Ph.D Compass Minerals Vice President of Innovation and Product Development
Innovation in Agriculture Dr. Ryan K. Bartlett, Ph.D Compass Minerals Vice President of Innovation and Product Development Welcome and Congratulations!! My Experience in Innovation Bachelors Degree in
More informationI.1 The Principle: Identification and Application of Molecular Markers
I.1 The Principle: Identification and Application of Molecular Markers P. Langridge and K. Chalmers 1 1 Introduction Plant breeding is based around the identification and utilisation of genetic variation.
More informationGENOME ANALYSIS AND BIOINFORMATICS
GENOME ANALYSIS AND BIOINFORMATICS GENOME ANALYSIS AND BIOINFORMATICS A Practical Approach T.R. Sharma Principal Scientist (Biotechnology) National Research Centre on Plant Biotechnology IARI Campus, Pusa,
More informationMolecular and Applied Genetics
Molecular and Applied Genetics Ian King, Iain Donnison, Helen Ougham, Julie King and Sid Thomas Developing links between rice and the grasses 6 Gene isolation 7 Informatics 8 Statistics and multivariate
More informationGenome research in eukaryotes
Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics
More informationGenomics-based approaches to improve drought tolerance of crops
Review TRENDS in Plant Science Vol.11 No.8 Full text provided by www.sciencedirect.com Genomics-based approaches to improve drought tolerance of crops Roberto Tuberosa and Silvio Salvi Department of Agroenvironmental
More informationPreface Improvement of Crops in the Era of Climatic Changes Volume 2
Preface Improvement of Crops in the Era of Climatic Changes Volume 2 Climate change is an unprecedented threat to the food security for hundreds of millions of people who depend on small-scale agriculture
More informationA Few Thoughts on the Future of Plant Breeding. Ted Crosbie VP Global Plant Breeding Monsanto Distinguished Science Fellow
A Few Thoughts on the Future of Plant Breeding Ted Crosbie VP Global Plant Breeding Monsanto Distinguished Science Fellow There are about 2,200 plant breeders in the USA. Most of them are working on food
More informationMAS refers to the use of DNA markers that are tightly-linked to target loci as a substitute for or to assist phenotypic screening.
Marker assisted selection in rice Introduction The development of DNA (or molecular) markers has irreversibly changed the disciplines of plant genetics and plant breeding. While there are several applications
More informationPlant Breeding as an integral part of Sustainable Agriculture
2 Plant Breeding as an integral part of Sustainable Agriculture Dr. Dirk Zimmermann Sustainable Agriculture Campaigner Greenpeace Germany International Cotton Conference, Bremen, 17.03.2016 dirk.zimmermann@greenpeace.de
More informationUsing molecular marker technology in studies on plant genetic diversity Final considerations
Using molecular marker technology in studies on plant genetic diversity Final considerations Copyright: IPGRI and Cornell University, 2003 Final considerations 1 Contents! When choosing a technique...!
More informationEvogene - Bayer CropScience Multi-year Collaboration to Improve Wheat Seed. December 13, 2010
Evogene - Bayer CropScience Multi-year Collaboration to Improve Wheat Seed December 13, 2010 1 2 Agenda Evogene Bayer CropScience Collaboration Wheat Background Complementary Capabilities Create Opportunity
More informationThe Search for Human Chromosomes
The Search for Human Chromosomes ThiS is a FM Blank Page Wilson John Wall The Search for Human Chromosomes A History of Discovery Wilson John Wall Bewdley United Kingdom ISBN 978-3-319-26334-2 ISBN 978-3-319-26336-6
More informationChapter 1. from genomics to proteomics Ⅱ
Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more
More informationNew Plant Breeding Techniques - NPBTs. Assessment of potential risks associated with their application
New Plant Breeding Techniques - NPBTs Assessment of potential risks associated with their application 1 Biosafety of NPBT-crops? Until recently Biosafety was not a focal issue of discussions about NPBT
More informationGenomics assisted Genetic enhancement Applications and potential in tree improvement
Genomics assisted Genetic enhancement Applications and potential in tree improvement Sheshshayee MS, Sumanthkumar K and Raju BR Dept. of Crop Physiology and Genetics and Plant breeding UAS, GKVK, Bangalore
More informationGroups of new plant breeding techniques
WORKSHOP COMPERATIVE SITUATION OF NEW PLANT BREEDING TECHNIQUES 12-13 SEPTEMBER 2011 SEVILLE, SPAIN Groups of new plant breeding techniques Maria Lusser Joint Research Centre, European Commission Workshop
More informationSustainability of food systems. Agri-food environment. Agriculture is the integration of many disciplines
Harnessing New Agriculture Technologies for Affordable and Sustainable Food Supply New Technologies and Innovations in Improving and Delivering Sustainable Food Production Systems Les Copeland Editor-in-Chief,
More informationTexas A&M University Departmental Request for a Change in Course Undergraduate Graduate Professional Submit original fonn and attachments.
, I 1. Request submitted by (Department or Program Name): 2. Course prefix, number and complete title of course: 3. Change requested Texas A&M University Departmental Request for a Change in Course Undergraduate
More informationRegulation of New Plant Breeding Techniques in Canada and the United States
Regulation of New Plant Breeding Techniques in Canada and the United States New Breeding Techniques RNA interference Cisgenesis and intragenesis Oligonucleotide directed mutagenesis Grafting (on transgenic
More informationTexas A&M University Departmental Request for a Change in Course Undergraduate Graduate Professional Submit original form and attachments.
Texas A&M University Departmental Request for a Change in Course Undergraduate Graduate Professional Submit original form and attachments. 1. This request is submitted by the Department of Soil and Crop
More informationBIOTECHNOLOGY AGRICULTURE
Syllabus BIOTECHNOLOGY AGRICULTURE - 73534 Last update 19-10-2017 HU Credits: 3 Degree/Cycle: 2nd degree (Master) Responsible Department: biotechnology Academic year: 0 Semester: 2nd Semester Teaching
More informationdomesticated crop species. Rice is known to be a staple food for one third of the world s
1 CHAPTER 1 INTRODUCTION Oryza sativa, commonly known as rice holds a unique position among domesticated crop species. Rice is known to be a staple food for one third of the world s population and also
More informationTooling up for Functional Genomics
Tooling up for Functional Genomics Michael Abberton, Iain Donnison, Phil Morris, Helen Ougham, Mark Robbins, Howard Thomas From model to crop species 6 Genomes and genome mapping 7 The transcriptome 7
More informationDNA Methods in Clinical Microbiology
DNA Methods in Clinical Microbiology DNA Methods Ill Clinical Microbiology by Paul Singleton SPRINGER-SCIENCE+BUSINESS MEDIA, B.V. A C.I.P. Catalogue record for this book is available from the Library
More informationUnited States Department of Agriculture Final Report. Alfalfa and Forage Program. Departments Monteros Lab {NO DATA ENTERED}
Title: Root Traits to Enhance Nutrient and Water Use in Alfalfa Sponsoring Agency Funding Source Accession No. Project Start Date Reporting Period Start Date Submitted By NIFA Non Formula 1004474 09/01/2014
More informationThe Genetics of Obesity
The Genetics of Obesity Struan F.A. Grant Editor The Genetics of Obesity Editor Struan F.A. Grant Children s Hospital of Philadelphia Research Institute Philadelphia, PA, USA ISBN 978-1-4614-8641-1 ISBN
More informationHUMAN CELL CULTURE Volume VI: Embryonic Stem Cells
HUMAN CELL CULTURE Volume VI: Embryonic Stem Cells Human Cell Culture Volume 6 The titles published in this series are listed at the end of this volume. Human Cell Culture Volume VI Embryonic Stem Cells
More informationBIOTECHNOLOGY FOR AGRICULTURAL CROP PRODUCTION
Syllabus BIOTECHNOLOGY FOR AGRICULTURAL CROP PRODUCTION - 73902 Last update 07-11-2016 HU Credits: 2 Degree/Cycle: 2nd degree (Master) Responsible Department: field and vegetable crops-international prog.
More informationA brief introduction to Marker-Assisted Breeding. a BASF Plant Science Company
A brief introduction to Marker-Assisted Breeding a BASF Plant Science Company Gene Expression DNA is stored in chromosomes within the nucleus of each cell RNA Cell Chromosome Gene Isoleucin Proline Valine
More informationInnovative Trait Development Tools in Plant Breeding will be Crucial for Doubling Global Agricultural Productivity by 2050
Innovative Trait Development Tools in Plant Breeding will be Crucial for Doubling Global Agricultural Productivity by 2050 Greg Gocal, Ph.D., Senior Vice President, Research and Development CRISPR Precision
More informationRECOMBINANT TECHNOLOGY IN HEMOSTASIS AND THROMBOSIS
RECOMBINANT TECHNOLOGY IN HEMOSTASIS AND THROMBOSIS RECOMBINANT TECHNOLOGYIN HEMOST ASIS AND THROMBOSIS Edited hy Leon W. Hoyer and William N. Drohan Jerome H. Holland Laboratory American Red Cross B100d
More informationSSR Markers For Assessing The Hybrid Nature Of Two High Yielding Mulberry Varieties
International Journal of Genetic Engineering and Biotechnology. ISSN 0974 3073 Volume 5, Number 2 (2014), pp. 191-196 International Research Publication House http://www.irphouse.com SSR Markers For Assessing
More informationEssentials of Plant Breeding
Essentials of Plant Breeding Essentials of Plant Breeding K.V. MOHANAN Professor (Genetics and Plant Breeding Division) Department of Botany University of Calicut Kerala New Delhi-110001 2010 Rs. 125.00
More informationCrop Science Society of America
Crop Science Society of America Grand Challenge Statements Crop science is a highly integrative science employing the disciplines of conventional plant breeding, transgenic crop improvement, plant physiology,
More informationCRISPR-Cas9 Genome Editing. New Era of Agricultural Biotechnology
2017 Grains Research Update - CRISPR-Cas9 Genome Editing New Era of Agricultural Biotechnology Yong Han & Chengdao Li y.han@murdoch.edu.au Western Barley Genetics Alliance 28 Feb,2017 One of the ten breakthrough
More informationBiology 644: Bioinformatics
Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....
More informationCould benefit organic: High use in Hawaii has lowered virus levels to allow organic production. Herd immunity
Advances in Crop Biotechnology- Cisgenics and Genome Editing Michael M. Neff Ph.D. Thoughts from previous talk Many examples of GMO bacteria in medicine (e.g. insulin, taxol) and food (vitamins, chymosin
More informationShabbir A. Shahid Mahmoud A. Abdelfattah Michael A. Wilson John A. Kelley Joseph V. Chiaretti. United Arab Emirates Keys to Soil Taxonomy
Shabbir A. Shahid Mahmoud A. Abdelfattah Michael A. Wilson John A. Kelley Joseph V. Chiaretti United Arab Emirates Keys to Soil Taxonomy United Arab Emirates Keys to Soil Taxonomy Shabbir A. Shahid Mahmoud
More informationGenetics and Biotechnology. Section 1. Applied Genetics
Section 1 Applied Genetics Selective Breeding! The process by which desired traits of certain plants and animals are selected and passed on to their future generations is called selective breeding. Section
More informationIntegrated Pest Management
Integrated Pest Management Integrated Pest Management Edited by J. Lawrence Apple North Carolina State University at Raleigh and Ray F. Smith University of California at Berkeley PLENUM PRESS. NEW YORK
More informationGlobal Pre breeding Strategy with Focus on Minor Crops
Global Pre breeding Strategy with Focus on Minor Crops Elcio P. Guimarães Workshop on Nordic PPP on Pre breeding 17 February 2011 With contributors from: Steve Beebe; Hernan Ceballos; Daniel Debouck; Clair
More informationThe Role of Plant Pathology in Food Safety and Food Security
The Role of Plant Pathology in Food Safety and Food Security Plant Pathology in the 21st Century For other titles published in this series, go to www.springer.com/series/8169 R.N. Strange Editors Maria
More informationGenetic and Molecular Epidemiology of Multiple Myeloma
Genetic and Molecular Epidemiology of Multiple Myeloma Suzanne Lentzsch Editor Genetic and Molecular Epidemiology of Multiple Myeloma Editor Suzanne Lentzsch College of Physicians and Surgeons Multiple
More informationWhy Biotech Solutions are Needed to Address Forest Health. Steve Strauss Oregon State University / USA
Why Biotech Solutions are Needed to Address Forest Health Steve Strauss Oregon State University / USA Why advocate for recdna tech? Science rdna starts from nature Innovation Builds on nature to enhance
More informationE E. International Series in Operations Research & Management Science. Series Editor: Fredrick S. Hillier Stanford University
E E International Series in Operations Research & Management Science Series Editor: Fredrick S. Hillier Stanford University Special Editorial Consultant: Camille C. Price Stephen F. Austin State University
More informationTEXAS A&M PLANT BREEDING BULLETIN
TEXAS A&M PLANT BREEDING BULLETIN November 2015 Our Mission: Educate and develop Plant Breeders worldwide Our Vision: Alleviate hunger and poverty through genetic improvement of plants I am pleased to
More informationSTANDER, l.r., Betaseed, Inc. P.O. Box 859, Kimberly, ID The relationship between biotechnology and classical plant breeding.
STANDER, l.r., Betaseed, Inc. P.O. Box 859, Kimberly, ID 83341. The relationship between biotechnology and classical plant breeding. Plant breeders have been relatively successful over the years. Duvick
More informationSolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze
SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David
More informationWhat Role Will Biotechnology Play In the Produce Sector? Steve Savage
What Role Will Biotechnology Play In the Produce Sector? Steve Savage May 18, 2016 In Twenty Years of Commercial GMO Crops only a few have been fruit or vegetables Flavr Savr Tomato NewLeaf Beetle Resistant
More informationU.S. Government Funding for Prebreeding: Role of the Private Sector. Nora Lapitan and Jennifer Long US Agency for International Development
U.S. Government Funding for Prebreeding: Insights, Forecast and the Role of the Private Sector Nora Lapitan and Jennifer Long US Agency for International Development Outline How US Federal funding agencies
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationAGR 5307: Molecular Genetics for Crop Improvement Course Objectives: Learning Outcomes: 65 % lectures 15 % laboratory demonstrations 15 % papers 5 %
AGR 5307: Molecular Genetics for Crop Improvement Spring Semester 2016, 3 credits Monday (3108 McCarty B) Period 4; Wednesday (3108 McCarty B) Period 3 and 4; Friday (3096 McCarty B) Period 4 Instructor:
More informationEngineering Genetic Circuits
Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art
More informationPlant Breeding. Opportunities of New Plant Breeding Techniques. Breeding projects at WUR-Plant Breeding
Opportunities of New Plant Breeding Techniques Jan Schaart Plant Breeding Important for crop improvement Combining of genetic variation Based on the steps of crossing and selection Limitations polyploidy,
More informationSPO GRANTS (2001) PHASES
2002 SPO GRANTS (2001) PHASES MAIN PHASES Legal organisation of the Institute of Biotechnology Ankara University Biotechnology Labs Organisation of Central Lab of the Institute of Biotechnology/ Purchase
More informationGenetic Analyses of Wheat and Molecular Marker- Assisted Breeding, Volume 1 Genetics Map and QTL Mapping
Jichun Tian Zhiying Deng Kunpu Zhang Haixia Yu Xiaoling Jiang Chun Li Genetic Analyses of Wheat and Molecular Marker- Assisted Breeding, Volume 1 Genetics Map and QTL Mapping Genetic Analyses of Wheat
More informationLIFE IN EXTREME ENVIRONMENTS
LIFE IN EXTREME ENVIRONMENTS , Life in Extreme Environments by RICARDO AMILS Universidad Auto noma de Madrid, Centro de Biologı a Molecular del CSIC, Madrid, Spain CYNAN ELLIS-EVANS British Antarctic Survey,
More informationNew approaches for analyzing multi-channel image data and post-processing of phenotypic data
New approaches for analyzing multi-channel image data and post-processing of phenotypic data Christian Klukas Leibniz Institute of Plant Genetics and Crop Plant Research (IPK) LemnaTec GmbH, 52076 Aachen,
More informationUtilization of Genomic Information to Accelerate Soybean Breeding and Product Development through Marker Assisted Selection
Utilization of Genomic Information to Accelerate Soybean Breeding and Product Development through Marker Assisted Selection Presented by: Ruth Wagner August 5, 2014 SOY2014 Rico Caldo,Vergel Concibido,
More information