The Central Dogma of Molecular Biology
|
|
|
- Moses Robertson
- 5 years ago
- Views:
Transcription
1 he two strands of DN are complementary, meaning the sequence of bases in one strand can be used to create the correct sequence of bases in the other strand. Figure 9.8
2 he entral Dogma of Molecular Biology
3 Figure 9.7
4 One human chromosome has +/- 1,000 different genes. E. coli chromosome has ~5,000 different genes
5 hmps://xkcd.com/1605/
6 he process of turning on a gene to produce RN and protein is called gene expression. Each cell controls when and how its genes are expressed to make RN and protein, how much of the protein is made, and when it is me to stop making that protein because it is no longer needed
7
8 Sigma mrn start 35 region onsensus Pribnow box Promoter sequence RN polymerase (core enzyme) ranscription
9 Figure 9.18 Eukaryoc mrn contains introns that must be spliced out. 5' cap and 3' tail are also added.
10 Figure 9.23 here are five basic modes of alternave splicing. Segments of pre-mrn with exons shown in blue, red, orange, and pink can be spliced to produce a variety of new mature mrn segments.
11 LILE MIROBIOLOY
12 Figure 1.11
13 What are Microorganisms? Bacteria rchaea Fungi lgae Protozoa (Viruses) Prokaryotes Eukaryotes Microorganisms are organisms that cannot be seen with the naked eye. Microorganisms consist of a single cell or cell clusters. Microorganism Macroorganism (Microbes) ( Macrobes ) Prokaryote: cell or organism lacking a nucleus or other membrane-enclosed structures Eukaryote: cell or organism having a membrane-enclosed nucleus and usually other membrane-enclosed structures (organelles)
14 Microbes are small Micro, by definion Discovered with the invenon of the microscope
15 But they are VERY abundant 100 million in a gram of soil More cells on earth than stars in the universe omprise more biomass on earth than plants and animals (~60% of the biomass on earth) 10 mes as many microbial cells on/in us than there are human cells ll the microbes on/in us weigh more than our brains
16 Welcome to your microbial life! Presentation itle Here 16
17 Microbes 1 g of soil contains 1 million to 10 billion bacterial cells representing about 4,000-10,000 species (orsvik et al. 1990) otal population of the World as of 10/4/17 7,425,654,808
18 Figure 13.5
19 Horizontal gene transfer ransforma4on: cell takes in DN found in its environment that is shed by other prokaryotes, alive or dead. ransduc4on: bacteriophages, the viruses that infect bacteria, move DN from one bacterium to another. onjuga4on: DN is transferred from one prokaryote to another by means of a pilus that brings the organisms into contact with one another.
20 Pathogenicity islands and content Due to historical horizontal transfer events, the % inside pathogenicity islands sometimes strongly differs from the rest of the genome. Sp 1, 47% Sp 2, 38% Horizontal transfer of a pathogenicity island : ~38% : ~47%
21 How to detect a pathogenicity island 5' - - 3' 3' - - 5' >>> dna = "" >>> gcontent(dna) 0.476
22 How to detect a pathogenicity island Find distance between DN sequences - pathogenicity islands are nearly idencal, while rest of the genome is different % content (using bias) - pathogenicity islands have more similar % content odon bias - pathogenicity islands have similar codon bias
23 Not just pathogenicity islands also symbiosis islands!
24 an the genes encoded on a pathogenicity island tell us anything about how the microbe works?
25 Bacterial Diseases in Humans pathogen is an organism that causes a disease ll pathogenic prokaryotes are Bacteria; there are no known pathogenic rchaea in humans or any other organism. Pathogenic organisms evolved alongside humans. DN sequences can help us understand pathogenesis Most bacteria are NO pathogens!
26 he Story of yphoid Mary yphoid fever is a bacterial infecon caused by Salmonella typhi. (somemes named S. enterica typhi) In 2013, there were 11 million new cases reported worldwide. Vast decrease from prior decades, mostly due to chlorinaon of drinking water Untreated, 10-30% mortality; lower than 1%, since improvements in healthcare. 3-5% of individuals who are infected develop a chronic infecon in the gall bladder
27 he Story of yphoid Mary
28
29 Our problem: how does Salmonella get in?
30 It hijacks human protein machinery
31 omputaonal methods helped us understand this mechanism Salmonella pathogenicity island 1
Videos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
Videos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
Big Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
Gene Expression Transcription
Why? ene Expression Transcription How is mrn synthesized and what message does it carry? DN is often referred to as a genetic blueprint. In the same way that blueprints contain the instructions for construction
Fermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
Biotechnology Unit 3: DNA to Proteins. From DNA to RNA
From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of
Microbial Biotechnology agustin krisna wardani
Microbial Biotechnology agustin krisna wardani 1. The Structure of Microbes Microbes (microorganisms) are tiny organisms that are too small to be seen individually by the naked eye and must be viewed with
Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.
Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions
Transcription and Post Transcript Modification
Transcription and Post Transcript Modification You Should Be Able To 1. Describe transcription. 2. Compare and contrast eukaryotic + prokaryotic transcription. 3. Explain mrna processing in eukaryotes.
PS: the present of organisms in a sterile part in our body like the blood or the inner tissue it means there is infection
This lecture is an introduction about the bacteria cell. Microbiology specially is related to micro-organisms? We can't observe the microorganisms by our naked eyes but we could culture them in special
Genomes DNA Genes to Proteins. The human genome is a multi-volume instruction manual
Dr. Kathleen Hill Assistant Professor Department of Biology The University of Western Ontario khill22@uwo.ca Office Hours: Monday 1 to 5pm Room 333 Western Science Centre Research Website: http://www.uwo.ca/biology/faculty/hill/index.htm
Outline. Gene Expression. One Gene One Enzyme Hypothesis. 1. Central Dogma DNA RNA Protein
ene Expression: RN and Synthesis ene Expression RN synthesis synthesis enetic ode Outline Splicing enes Introns and Exons omparison of ene Expression in Prokaryotes and Eukaryotes ene Expression 1. entral
Make the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
Ch. 10 From DNA to Protein. AP Biology
Ch. 10 From DNA to Protein Protein Synthesis Metabolism and Gene Expression n Inheritance of metabolic diseases suggests that genes coded for enzymes n Diseases (phenotypes) caused by non-functional gene
Computational gene finding
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) Lec 1 Lec 2 Lec 3 The biological context Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
Chapter 2. An Introduction to Genes and Genomes
PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents
Bioinformatics: Sequence Analysis. COMP 571 Luay Nakhleh, Rice University
Bioinformatics: Sequence Analysis COMP 571 Luay Nakhleh, Rice University Course Information Instructor: Luay Nakhleh (nakhleh@rice.edu); office hours by appointment (office: DH 3119) TA: Leo Elworth (DH
GENETIC TRANSFER AND RECOMBINATION
GENETIC TRANSFER AND RECOMBINATION Genetic recombination! Genetic recombination is the rearrangement of genes to form new combinations. If two chromosomes break and are rejoined in such a way that some
Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL
Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct
Chapter 10 Microbial Genetics: New Genes for Old Germs
Chapter 10 Microbial Genetics: New Genes for Old Germs Objectives: After reading Chapter Ten, you should understand The structure and complexity of the bacterial chromosome and the significance of plasmids.
Gene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.
Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally
Genes and How They Work. Chapter 15
Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central
Viral Genomes. Genomes may consist of: 1. Double Stranded DNA 2. Double Stranded RNA 3. Single-stranded RNA 4. Single-stranded DNA
Chapter 19 Viral Genomes Genomes may consist of: 1. Double Stranded DNA 2. Double Stranded RNA 3. Single-stranded RNA 4. Single-stranded DNA Genome is usually organized as a single linear or circular molecule
Molecular Cell Biology - Problem Drill 06: Genes and Chromosomes
Molecular Cell Biology - Problem Drill 06: Genes and Chromosomes Question No. 1 of 10 1. Which of the following statements about genes is correct? Question #1 (A) Genes carry the information for protein
Introduction to Bioinformatics
Introduction to Bioinformatics Contents Cell biology Organisms and cells Building blocks of cells How genes encode proteins? Bioinformatics What is bioinformatics? Practical applications Tools and databases
Transcription. DNA to RNA
Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy
Lesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
Version 001 Transcription Translation Practice Questions mahon (JCPAPBIO2013) to allow RNA polymerase continuous access
Version 001 Transcription Translation Practice Questions mahon (JCPAPBIO2013) 1 This print-out should have 34 questions. Multiple-choice questions may continue on the next column or page find all choices
Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms
Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms Duncanrig Secondary JHM&MHC 2015 Page 1 of 18 On completion of this
Bis2A 12.0 Transcription *
OpenStax-CNX module: m56068 1 Bis2A 12.0 Transcription * Mitch Singer Based on Transcription by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License
3'A C G A C C A G T A A A 5'
AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of
From DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
Transcription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
5. the transformation of the host cell. 2. reject the virus. 4. initiate an attack on the virus.
Version 001 Bacterial/Viral Genetics mahon (26) 1 This print-out should have 28 questions. Multiple-choice questions may continue on the next column or page find all choices before answering. Holt Bio
Gene Expression: From Genes to Proteins
The Flow of Genetic Information Gene Expression: From Genes to Proteins Chapter 9 Central Dogma in Molecular Biology molecule Gene 1 Strand to be transcribed Gene 2 Gene 3 strand Codon : Polymerase transcribes
From DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
BIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction
BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY Recombinant DNA technology involves sticking together bits of DNA from different sources. Made possible because DNA & the genetic code are universal. 2004 Biology
Regulation of bacterial gene expression
Regulation of bacterial gene expression Gene Expression Gene Expression: RNA and protein synthesis DNA ----------> RNA ----------> Protein transcription translation! DNA replication only occurs in cells
I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics
Ch 12 Lecture Notes - DNA I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics 1 II. Griffith and Transformation
Division Ave. High School AP Biology
Division ve. High School Making s From ene to Protein How enes Work Organelles nucleus ribosomes endoplasmic reticulum (ER) olgi apparatus vesicles small nuclear pore ribosomal mrn large ribosomal cytoplasm
Biotechnology. Cloning. Transformation 2/4/ glue DNA
Biotechnology Cloning The production of multiple copies of a single gene (gene cloning) For basic research on genes and their protein products To make a protein product (insulin, human growth hormone)
DNA: STRUCTURE AND REPLICATION
DNA: STRUCTURE AND REPLICATION DNA was known to be a chemical in cells by the end of the nineteenth century, has the capacity to store genetic information, and can be copied and passed from generation
BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.
!! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide
Microbial Genetics. Chapter 8
Microbial Genetics Chapter 8 Structure and Function of Genetic Material Genome A cell s genetic information Chromosome Structures containing DNA that physically carry hereditary information Gene Segments
Chapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
B. Incorrect! Centromeric DNA is largely heterochromatin, which is inactive DNA.
MCAT Biology - Problem Drill 06: Molecular Biology of Eukaryotes Question No. 1 of 10 1. Which type of DNA would have the highest level of expression? Question #01 (A) Heterochromatin. (B) Centromeric
8.1. KEY CONCEPT DNA was identified as the genetic material through a series of experiments. 64 Reinforcement Unit 3 Resource Book
8.1 IDENTIFYING DNA AS THE GENETIC MATERIAL KEY CONCEPT DNA was identified as the genetic material through a series of experiments. A series of experiments helped scientists recognize that DNA is the genetic
The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16
Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes
CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
Biotechnology and DNA Technology
11/27/2017 PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College CHAPTER 9 Biotechnology and DNA Technology Introduction to Biotechnology Learning Objectives Compare
Unit 3c. Microbial Gene0cs
Unit 3c Microbial Gene0cs Microbial Genetics! Gene0cs: the science of heredity Genome: the gene0c informa0on in the cell Genomics: the sequencing and molecular characteriza0on of genomes Gregor Mendel
I. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site.
Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site. Still having trouble understanding the material? Check
UNIT 3B. Yesterday s Picture DNA RNA. protein
Warm-Up Insulin is a protein hormone released into the bloodstream by the pancreas to regulate blood glucose (sugar) levels. Describe how insulin is secreted by pancreatic cells. Use at least FOUR organelles,
UNIT 3B. Yesterday s Picture DNA RNA. protein
Warm-Up Insulin is a protein hormone released into the bloodstream by the pancreas to regulate blood glucose (sugar) levels. Describe how insulin is secreted by pancreatic cells. Use at least FOUR organelles,
Expression of the genome. Books: 1. Molecular biology of the gene: Watson et al 2. Genetics: Peter J. Russell
Expression of the genome Books: 1. Molecular biology of the gene: Watson et al 2. Genetics: Peter J. Russell 1 Transcription 1. Francis Crick (1956) named the flow of information from DNA RNA protein the
CH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription.
13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription. The Role of RNA 1. Complete the table to contrast the structures of DNA and RNA. DNA Sugar Number of Strands Bases
DNA, Genes and their Regula4on. Me#e Voldby Larsen PhD, Assistant Professor
DNA, Genes and their Regula4on Me#e Voldby Larsen PhD, Assistant Professor Learning Objecer this talk, you should be able to Account for the structure of DNA and RNA including their similari
Chapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins
KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.
MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization
Overview & Recap of Molecular Biology before the last two sections MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription Gene Organization Joy Winuthayanon, PhD School of Molecular Biosciences
Molecular Cloning. Restriction Enzymes and Ligases
Tools in Genetic engineering The science of using living systems to benefit humankind is called biotechnology. Technically speaking, the domestication of plants and animals through farming and breeding
Transcription & Translation notes
Transcription & Translation notes TRNSRIPTION The entral Dogma DN RN proteins Protein Synthesis The DN inherited by an organism leads to specific traits by dictating the synthesis of proteins The process
MICROBIAL GENETICS. Rita Shintawati
MICROBIAL GENETICS Rita Shintawati Medical genetics in the past : 1. Minor subject in the school. 2. Related to uncommon diseases. 3. Only specialist and affected patients concern to the subject. Medical
Gene Regulation and Expression Lexile 950L
Gene Regulation and Expression Lexile 950L 1 Most of the traits that can be observed in organisms come from the genetic information contained within their genes. The genes found in our N control everything
MOLECULAR BIOLOGY 9/27/2015. The study of heredity at the genetic level. Frederick Griffith work with bacteria in 1928
MOLEULR BIOLOY 1 MOLEULR BIOLOY he study of heredity at the genetic level Frederick riffith work with bacteria in 1928 hromosomes ( + proteins) Began the field of molecular biology 2 1 HERSHEY & HSE Showed
DNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
GENE REGULATION. Gene regulation occurs at the level of transcription or production of mrna
GENE REGULATION Virtually every cell in your body contains a complete set of genes But they are not all turned on in every tissue Each cell in your body expresses only a small subset of genes at any time
Transcription: Synthesis of RNA
Transcription: Synthesis of RNA The flow of information in the cells (the central dogma of molecular biology): Transcription = RNA synthesis on a DNA template. The mrna will provide the information for
Wednesday, November 22, 17. Exons and Introns
Exons and Introns Introns and Exons Exons: coded regions of DNA that get transcribed and translated into proteins make up 5% of the genome Introns and Exons Introns: non-coded regions of DNA Must be removed
Transcription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
Lecture Series 10 The Genetics of Viruses and Prokaryotes
Lecture Series 10 The Genetics of Viruses and Prokaryotes The Genetics of Viruses and Prokaryotes A. Using Prokaryotes and Viruses for Genetic Experiments B. Viruses: Reproduction and Recombination C.
Fig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
BS 50 Genetics and Genomics Week of Oct 24
BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.
Year III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
From Genes to Protein
From Genes to Protein Transcription and Translation Metabolism Teaches Us About Genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from
Chapter 9 Microbial Genetics
Chapter 9 Microbial Genetics You are expected to know details of 1) DNA replication 2) RNA synthesis (transcription) 3) Protein synthesis (translation) Genome & Genes A genome is all the genetic information
Gene Regulation 10/19/05
10/19/05 Gene Regulation (formerly Gene Prediction - 2) Gene Prediction & Regulation Mon - Overview & Gene structure review: Eukaryotes vs prokaryotes Wed - Regulatory regions: Promoters & enhancers -
Lesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1
Lesson 8 DNA: The Molecule of Heredity Gene Expression and Regulation Introduction to Life Processes - SCI 102 1 Genes and DNA Hereditary information is found in discrete units called genes Genes are segments
Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
Chapter 18. Bacterial Genetics. AP Biology
Chapter 18. Bacterial Genetics 1 Why study bacterial genetics?! Its an easy place to start " history " we know more about it! systems better understood " simpler genome " good model for control of genes!
Biology 3201 Genetics Unit #5
Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process
AP Biology
Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)
DNA. Using DNA to solve crimes
DNA Using DNA to solve crimes Physical characteristics are inherited from both parents DNA contains all the inherited information for each person DNA is contained in the nucleus of every cell in your body
Importance. Prokaryotes vs. Eukaryotes. Viruses: a form of life or not?
1 Importance Microorganisms (esp. bacteria) plays a key role in the decomposition and stabilization of organic matter Control of diseases caused by pathogenic organisms of human origin Prokaryotes vs.
DNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
AP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
Computational gene finding. Devika Subramanian Comp 470
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) The biological context Lec 1 Lec 2 Lec 3 Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
BIOLOGY 205 Midterm II - 19 February Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?
BIOLOGY 205 Midterm II - 19 February 1999 Name Multiple choice questions 4 points each (Best 12 out of 13). 1. Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?
DNA: The Genetic Material. Chapter 14. Genetic Material
DNA: The Genetic Material Chapter 14 Genetic Material Frederick Griffith, 1928 Streptococcus pneumoniae, a pathogenic bacterium causing pneumonia 2 strains of Streptococcus: - S strain virulent - R strain
Chapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
Biology A: Chapter 9 Annotating Notes Protein Synthesis
Name: Pd: Biology A: Chapter 9 Annotating Notes Protein Synthesis -As you read your textbook, please fill out these notes. -Read each paragraph state the big/main idea on the left side. -On the right side
Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
Gene function at the level of traits Gene function at the molecular level
Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines
Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype)
Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Question#1: One-Gene, One-Polypeptide The figure below shows the results of feeding trials with one auxotroph strain of Neurospora
Essential Question. What is the structure of DNA, and how does it function in genetic inheritance?
DNA Dr. Bertolotti Essential Question What is the structure of DNA, and how does it function in genetic inheritance? What is the role of DNA in hereditary? Transformation Transformation is the process
Key Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?