DNA. Using DNA to solve crimes

Transcription

1 DNA Using DNA to solve crimes

2 Physical characteristics are inherited from both parents

3 DNA contains all the inherited information for each person

4 DNA is contained in the nucleus of every cell in your body Cell Nucleus 4

5 DNA has a spiral staircase-like structure. The steps are formed by the nitrogen bases of the nucleotides where adenine pairs with thymine and cytosine with guanine.

6 Source: Alberts et al The Double Helix 6

7 Base pairs exist at the basic level of DNA bsapp.com

8 bsapp.com Base Pairs Adenine Thymine Guanine Cytosine

9 DNA is made up of Nucleotides Each nucleotide consists of a Phosphate Sugar Base A,T,G or C

10 DNA is packaged in chromosomes which contain matching genes called alleles Gene: Segments of DNA that get translated into proteins bsapp.com Allele: One of 2 variants of a gene, located on the same place on a chromosome. Example: The gene for ear lobes. The 2 alleles are detached and attached.

11 You get one chromosome from Mom and one from Dad. Each chromosome has many, many genes. Each gene has two alleles one from Mom, one from Dad. The Human Genome Project in the 1990s mapped all the human genes to specific Loci (plural of Locus) on the Chromosomes. Gene: Hairline Gene: Eye color Alleles: Widow s Peak or Straight Allele: Brown, Green, or blue A locus An allele

12 Human Genome human cells contain 46 chromosomes: 2 sex chromosomes (X,Y): XY in males. XX in females. 22 pairs of chromosomes named autosomes. 12

13 23 chromosome pairs 46 chromosomes 44 autosomes, 2 sex chromosomes X and Y chromosomes XX female XY Male

14 Genetic Information Genome the collection of genetic information. Chromosomes storage units of genes. Gene basic unit of genetic information. They determine the inherited characters. 14

15 The Genetic Code Describes how nucleotide sequence is converted to protein sequence Unit of three nucleotides = a codon A codon codes for a specific amino acid (structural component of protein)

16 Central Dogma Transcription Translation Gene mrna Protein cells express different subset of the genes In different tissues and under different conditions 16

17 Human Genome Project in the 1990s mapped every gene in human DNA They found that a lot of bases in our DNA don t seem to code for anything They are called non-coding DNA, or Junk DNA 17

18 There seem to be regions on all of our DNA that just don t code for anything 18

19 Non-coding, or Junk DNA, seems to increase as species get more complex Human DNA seems to be about 90% Junk 19

20 Genes The DNA strings include: Coding regions ( genes ) E. coli has ~4,000 genes Yeast has ~6,000 genes C. Elegans has ~13,000 genes Humans have ~32,000 genes Control regions These typically are adjacent to the genes They determine when a gene should be expressed Junk DNA (unknown function - ~90% of the DNA in human s chromosomes) 20

21 Genome Sizes E.Coli (bacteria) 4,600,000 bases Yeast (simple fungi) 15,000,000 bases Smallest human chromosome 50,000,000 bases Entire human genome 3,000,000,000 bases These are the 23 human chromosomes stretched out, showing the locations of some of our genes. The last 2 chromosmoes are the X chromosome (the bigger one) and the Y chromosome (smaller) 21

22 The Human genome... The different types of sequences that make up the total DNA of a human cell 3 billion base pairs about genes Only 2 % of the DNA encode proteins Genes include exons and introns Beside coding areas also additional secuences are found 50 % repeated sequences ( junk DNA )

23 bsapp.com Variable Number Tandem Repeaters (VNTR) Portions of DNA sequences are repeated These repetitions vary among individuals CACATCTATCTATCTATCTATCTAT CTATCTATCTATCTATCTATTGC

24 bsapp.com Basic Procedure for Typing

25 DNA is cut into different size VNTR s by the use of restriction enzymes bsapp.com

26 Fragments are placed on a gel plate bsapp.com

27 Fragments are separated by electrophoresis bsapp.com

28 The DNA is then transferred from the gel plate and made visible bsapp.com