DNA Structure and Analysis. Chapter 4: Background
|
|
|
- Melvin Baker
- 6 years ago
- Views:
Transcription
1 DNA Structure and Analysis Chapter 4: Background
2 Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
3 Central Dogma DNA!RNA!Protein!Trait # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
4 Pop Quiz: What do you know about DNA???
5 Pop Quiz: What do you know about DNA???
6 The Structure of DNA Long molecule: Three basic components: Backbone formed by: Nucleotides can be joined together in any order.
7 The Structure of DNA Nitrogenous base Two Families: Purines Pyrimidines
8 Chargaff (1952) History of DNA
9 Rosalind Franklin (1952) History of DNA
10 History of DNA James Watson & Francis Crick (1953) Model: Discovered hydrogen bonds could form between nitrogenous bases. Principle of base pairing
11 History of DNA James Watson & Francis Crick (1953) Discovered structure of DNA. Model was double helix. Twisted ladder.
12 DNA and Chromosomes Eukaryotes: DNA located in nucleus in form of chromosomes.
13 DNA Length DNA molecules are very LONG. Prokaryote: DNA length = Cell size = DNA:
14 DNA Length DNA molecules are very LONG. Prokaryote: DNA length = 1.6 mm; Cell size = 1.6 µm. DNA is 1000 X longer than cell. Eukaryotes DNA packed even more tightly.
15 Chromosome Structure Chromosomes Packed tightly together to form DNA is tightly coiled around proteins
16 Chromosome Structure Chromatin in interphase = bowl of spaghetti. Chromatin during mitosis = chromosome pairs (X).
17 DNA Replication Structure Meets Function Structure of DNA explained how it could be copied. Each strand can be used to make the other strand.
18 DNA Replication Cell must duplicate its DNA before dividing.
19 DNA Replication Cell must duplicate its DNA before dividing. Each new cell has complete set of DNA molecules. DNA molecules separate into two strands.
20 DNA Replication Replication Hundreds of sites in genome. Occurs in both directions. Why? DNA replication animation
21 DNA Replication Replication carried out by enzymes. Each new DNA molecule: Real-time DNA replication
22 Central Dogma DNA!RNA!Protein!Trait The main flow of protein synthesis in a cell # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
23 DNA vs RNA DNA double helix explains HOW DNA can be replicated DOES NOT explain how a gene works!
24 Central Dogma of Biology Two BIG Steps:
25 DNA vs RNA DNA double helix explains HOW DNA can be replicated DOES NOT explain how a gene works! First step in decoding genes is to copy DNA into RNA.
26 Structure of RNA Long chain of nucleotides: Structure Meets Function- Three main differences between DNA and RNA:
27 Structure of RNA vs DNA
28 Structure of RNA Analogy: RNA is a working copy of a single gene. Main function:
29 Three main types: Types of RNA Messenger RNA (mrna)
30 Types of RNA Three main types: messenger RNA (mrna), ribosomal RNA (rrna), and transfer RNA (trna). Ribosomal RNA (rrna)
31 Types of RNA Three main types: messenger RNA (mrna), ribosomal RNA (rrna), and transfer RNA (trna). Transfer RNA (trna)
32 Making RNA from DNA: Transcription The process in a cell by which genetic material is copied from ONE strand of DNA to a complementary strand of RNA for protein production. Requires: How is RNA polymerase similar to DNA polymerase?
33 Making RNA from DNA: Transcription Sense strand Template Antisense strand RNA polymerase
34 Making RNA from DNA: Transcription First step of gene expression. Steps of transcription: RNA polymerase: Uses one strand of DNA as a template from which nucleotides are assembled into a strand of RNA. Can either strand of DNA be used as a template?
35 Making RNA from DNA: Transcription How does RNA polymerase know where to begin and where to stop? RNA polymerase:
36 Making RNA from DNA: Transcription How does RNA polymerase know where to begin and where to stop?
37 Can you work like RNA polymerase and transcribe this DNA? TACTAGACGGTAGCACATATG (DNA)
38 Can you work like RNA polymerase and transcribe this DNA? TACTAGACGGTAGCACATATG (DNA) AUGACUGCCAUCGUGUAUAC (RNA)
39 RNA Editing mrna needs to be processed before it reaches its final destination. Gene is broke into 2 parts: Introns Exons
40 RNA Editing An enzyme: A cap and a tail:
41 Central Dogma DNA!RNA!Protein!Trait The main flow of protein synthesis in a cell Exceptions to Central Dogma Reverse Transcription # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
42 Restriction Enzymes Formed in bacteria Recognize Cut in either # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
43 Restriction Enzymes Formed in bacteria to resist infection by viral DNA Recognize a particular nucleotide pattern Cut in either a blunt or staggered pattern # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
44 Naming Restriction Enzymes EcoRI E = co = R = I = PstI P = St = I = # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
45 Using Restriction Enzymes Cut source DNA and plasmid DNA with the same enzyme or enzymes Mix the fragments Add DNA ligase to reform sugar phosphate bonds # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
46 Electrophoresis # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
47 How the Gel Box Works When gel box is running, water is separated into hydrogen and oxygen gas Buffers ensure that the ph remains constant 2 H 2 O 2 e - H 2 _ + H + e - O 2 H 2 O Cathode (reduction): Anode (oxidation): 4 H e - 2 H 2 H O H e O HO O HO NH + OH H 3 C O - # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
48 Gel Imaging and Size Estimation FAST Blast DNA Stain SYBR Safe Inverted image # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
49 Size Estimation Size (bp) Distance (mm) 100,000 23, , , , Size, base pairs 10,000 1,000 B 2, , A 24 Distance, mm # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
DNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information
DNA: CH 13 How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information Discovering DNA s Function 1928: Frederick Griffith studied
DNA and RNA. Chapter 12
DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your
Adv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.
DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,
From Gene to Protein
8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are
Chapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins
KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.
Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.
Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions
DNA & RNA. Chapter Twelve and Thirteen Biology One
DNA & RNA Chapter Twelve and Thirteen Biology One I. DNA Structure A. DNA monomers = nucleotides *1. sugar bonded to PO4 & one of four possible nitrogen bases 2. bases = Adenine, Guanine, Cytosine, Thymine
II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes Frank Griffith- discovered DNA in 1928
HEREDITY = passing on of characteristics from parents to offspring I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin= uncoiled DNA
A. I think it is DNA or RNA (circle your answer) because: B. I think it is DNA or RNA (circle your answer) because:
Name: Test Date: Block: Biology I: Unit 7 Molecular Genetics and Biotechnology Review for Unit Test Directions: You should use this as a guide to help you study for your test. You should also read through
To truly understand genetics, biologists first had to discover the chemical nature of genes
To truly understand genetics, biologists first had to discover the chemical nature of genes Identifying the structure that carries genetic information makes it possible to understand how genes control
Nucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
Videos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
Macromolecule Review
DNA: CH 13 Macromolecule Review Nucleic acid Monomer = nucleotide Polymer = DNA, RNA Function = genetic information Protein Monomer = amino acid Polymer = polypeptide Function = structure and chemical
Ch 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
DNA and RNA. Chapter 12
DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus
March 26, 2012 NUCLEIC ACIDS AND PROTEIN SYNTHESIS
NUCLEIC ACIDS AND PROTEIN SYNTHESIS MAIN MAIN TOPICS TOPICS TO TO BE BE COVERED COVERED THIS THIS UNIT: UNIT: I. I. EVIDENCE EVIDENCE OF OF DNA DNA AS AS THE THE GENETIC GENETIC CODE CODE II. II. DNA DNA
Ch Molecular Biology of the Gene
Ch. 12 - Molecular Biology of the Gene AP BIOLOGY CHAPTER GUIDE 1. In the middle of the unraveling the mysteries of DNA, researchers knew that genetic material must be able to. It must be stable so it
Biology. DNA & the Language of Life
Biology DNA & the Language of Life Genes are Made of DNA Fredrick Griffith (1928) studied pneumonia strains (one was harmless while the other was pathogenic, or disease-causing) Made non-harmful strains
Chapter 10 - Molecular Biology of the Gene
Bio 100 - Molecular Genetics 1 A. Bacterial Transformation Chapter 10 - Molecular Biology of the Gene Researchers found that they could transfer an inherited characteristic (e.g. the ability to cause pneumonia),
Videos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
Biology Celebration of Learning (100 points possible)
Name Date Block Biology Celebration of Learning (100 points possible) Matching (1 point each) 1. Codon a. process of copying DNA and forming mrna 2. Genes b. section of DNA coding for a specific protein
Fermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
Lesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1
Lesson 8 DNA: The Molecule of Heredity Gene Expression and Regulation Introduction to Life Processes - SCI 102 1 Genes and DNA Hereditary information is found in discrete units called genes Genes are segments
Chapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
Unit 5 DNA, RNA, and Protein Synthesis
1 Biology Unit 5 DNA, RNA, and Protein Synthesis 5:1 History of DNA Discovery Fredrick Griffith-conducted one of the first experiment s in 1928 to suggest that bacteria are capable of transferring genetic
ADENINE, THYMINE,CYTOSINE, GUANINE
MOLECULAR GENETICS Molecular Genetics - the branch of genetics concerned with the structure and activity of genetic material at the molecular level Genetic Material - chromatin (chromosomes) within the
Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
12 1 DNA. Slide 1 of 37. End Show. Copyright Pearson Prentice Hall:
12 1 DNA 1 of 37 http://www.biologyjunction.com/powerpoints_dragonfly_book_prent.htm 12 1 DNA Griffith and Transformation Griffith and Transformation In 1928, Fredrick Griffith was trying to learn how
Resources. How to Use This Presentation. Chapter 10. Objectives. Table of Contents. Griffith s Discovery of Transformation. Griffith s Experiments
How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or
Section 3: DNA Replication
Section 3: DNA Replication Main Idea: Replication- process by which DNA is copied during the cell cycle DNA Polymerase- a group of enzymes that bond the new nucleotides together 1 DNA Replication Replication
DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
Nucleic Acids: DNA and RNA
Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,
How can something so small cause problems so large?
How can something so small cause problems so large? Objectives Identify the structural components of DNA and relate to its function Create and ask questions about a model of DNA DNA is made of genes. Gene
KEY CONCEPT DNA was identified as the genetic material through a series of experiments. Found live S with R bacteria and injected
Section 1: Identifying DNA as the Genetic Material KEY CONCEPT DNA was identified as the genetic material through a series of experiments. VOCABULARY bacteriophage MAIN IDEA: Griffith finds a transforming
Chapter 2. An Introduction to Genes and Genomes
PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents
translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
Honors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless
Honors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless bacteria some living bacteria cells converted to disease causing
Summary 12 1 DNA RNA and Protein Synthesis Chromosomes and DNA Replication. Name Class Date
Chapter 12 Summary DNA and RNA 12 1 DNA To understand genetics, biologists had to learn the chemical structure of the gene. Frederick Griffith first learned that some factor from dead, disease-causing
Chapter 12 DNA & RNA
Chapter 12 DNA & RNA Experiments with Heredity Material Griffith s Experiments: injected mice with bacteria that cause pneumonia Concluded genetic info is transformed from one bacteria to another Avery
Multiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
DNA- THE MOLECULE OF LIFE
DNA- THE MOLECULE OF LIFE STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,
DNA Structure and Replica2on
DNA Structure and Replica2on Structure of DNA James Watson and Francis Crick (with Maurice Wilkins) awarded the Nobel Prize in 1962 for the construc2on of the double helix model of DNA Rosalind Franklin
REVIEW SHEET: Units 9 & 10 Cell Cycle, DNA, & Gene Expression
REVIEW SHEET: Units 9 & 10 Cell Cycle, DNA, & Gene Expression HONORS BIOLOGY Textbook Reading: Cell Cycle (Ch. 10.1 and 10.2), DNA (Ch. 12), and Gene Expression (Ch. 13) Handouts:! Online Tutorial: Cell
Lecture Overview. Overview of the Genetic Information. Marieb s Human Anatomy and Physiology. Chapter 3 DNA & RNA Protein Synthesis Lecture 6
Marieb s Human Anatomy and Physiology Marieb Hoehn Chapter 3 DNA & RNA Protein Synthesis Lecture 6 Lecture Overview The Genetic Information Structure of DNA/RNA DNA Replication Overview of protein synthesis
DNA. Essential Question: How does the structure of the DNA molecule allow it to carry information?
DNA Essential Question: How does the structure of the DNA molecule allow it to carry information? Fun Website to Explore! http://learn.genetics.utah.edu/content/molecules/ DNA History Griffith Experimented
Essential Questions. DNA: The Genetic Material. Copyright McGraw-Hill Education
Essential Questions Which experiments led to the discovery of DNA as the genetic material? What is the basic structure of DNA? What is the basic structure of eukaryotic chromosomes? Vocabulary Review nucleic
Key Concepts. Ø DNA Replication Ø Protein Synthesis Ø Transcription: Ø Translation: Ø messenger RNA (mrna)
Heredity B-4.3 Explain how DNA functions as the code of life and the blueprint for proteins. (Focus on DNA replication) B-4.4: Summarize the basic process involved in protein synthesis (including transcription
Semester 2: Unit 1: Molecular Genetics
Semester 2: Unit 1: Molecular Genetics Information Overload : Cells store information in DNA. Information is used to build molecules needed for cell growth. As cell size increases, the demands on that
DNA. Discovery of the DNA double helix
DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:
What does DNA stand for?
DNA and RNA What does DNA stand for? DNA = deoxribonucleic acid NOTE: the DNA from one cell would stretch 3 metre DNA are coiled and folded. DNA has two strands. What four bases are used in DNA? The four
what are proteins? what are the building blocks of proteins? what type of bond is in proteins? Molecular Biology Proteins - review Amino Acids
Molecular Biology The Study of Proteins and Nucleic Acids what are proteins? what are the building blocks of proteins? what type of bond is in proteins? Proteins - review functions include: catalysts for
DNA, Replication and RNA
DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is
Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein)
Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) I. Review A. Cells copy their DNA (in S phase of Interphase)-Why? Prepare for Cell Division (Mitosis & Cytokinesis) Genes
Pre-AP Biology DNA and Biotechnology Study Guide #1
Last Name: First Name: Per. Pre-AP Biology DNA and Biotechnology Study Guide #1 Structure of DNA: Number of strands. Parallel or antiparallel?. Rosalind Franklin s x-ray crystallography image indicated
Chapter 16 The Molecular Basis of Inheritance
Chapter 16 The Molecular Basis of Inheritance Chromosomes and DNA Morgan s experiments with Drosophila were able to link hereditary factors to specific locations on chromosomes. The double-helical model
Chapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics
Ch 12 Lecture Notes - DNA I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics 1 II. Griffith and Transformation
Lesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
8.1. KEY CONCEPT DNA was identified as the genetic material through a series of experiments. 64 Reinforcement Unit 3 Resource Book
8.1 IDENTIFYING DNA AS THE GENETIC MATERIAL KEY CONCEPT DNA was identified as the genetic material through a series of experiments. A series of experiments helped scientists recognize that DNA is the genetic
DNA Chapter 12. DNA and RNA B.1.4, B.1.9, B.1.21, B.1.26, B DNA and RNA B.1.4, B.1.9, B.1.21, B.1.26, B Griffith s Experiment
DNA Chapter 12 DNA and RNA B.1.4, B.1.9, B.1.21, B.1.26, B.1.27 To truly understand genetics, biologists after Mendel had to discover the chemical nature of the gene. In 1928, Frederick Griffith was trying
DNA, RNA, and Protein Synthesis
http://faculty.uca.edu/~johnc/mbi1440.htm DNA, RNA, and Protein Synthesis http://www.wappingersschools.org/rck/staff/teacherhp/johnson/visualvocab/mrna.gif DNA base pairs carry the genetic Section 12-1
PROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
Big Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
The Central Dogma: This explains how the information to make proteins is carried: DNA RNA proteins
7.1 DNA and RNA The Central Dogma: This explains how the information to make proteins is carried: DNA RNA proteins Discovering DNA It was not always known that DNA contains all of the genetic material.
Vocabulary. Nucleic Acid Nucleotide Base pairing Complementary Template Strand Semiconservative Replication Polymerase
DNA and Replication TEKS (6) Science concepts. The student knows the mechanisms of genetics, including the role of nucleic acids and the principles of Mendelian Genetics. The student is expected to: (A)
From Gene to Protein. Making Sense of DNA
From Gene to Protein Making Sense of DNA The 4 th Macromolecule DNA (deoxyribonucleic acid) carbohydrates lipids The 4 major organic macromolecules nucleic acids proteins the building blocks of organisms
Chapter 12 Reading Questions
Chapter 12 Reading Questions Name Section 11 In Frederick Griffith s experiment, what four substances were given to laboratory mice, and what was the result of each? 4. Which result was surprising, and
Exam: Structure of DNA and RNA 1. Deoxyribonucleic Acid is abbreviated: a. DRNA b. DNA c. RNA d. MRNA
Exam: Structure of DNA and RNA 1. Deoxyribonucleic Acid is abbreviated: a. DRNA b. DNA c. RNA d. MRNA 2. Which two scientists discovered DNA? a. Mendel and Newton b. Bohr and Crick c. Watson and Crick
Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.
Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions
3/10/16 DNA. Essential Question. Answer in your journal notebook/ What impact does DNA play in agriculture, science, and society as a whole?
DNA Essential Question. Answer in your journal notebook/ What impact does DNA play in agriculture, science, and society as a whole? 1 Benchmark SC.912.N.1.3, SC912.L16.9 Explain how & why the genetic code
DNA and RNA. Chapter 12
DNA and RNA Chapter 12 Section 12-1 DNA DNA Griffith and Transformation Frederick Griffith bacteriologist studying how certain types of bacteria produce pneumonia Isolated 2 strains of pneumonia from mice
GENETICS 1 Classification, Heredity, DNA & RNA. Classification, Objectives At the end of this sub section you should be able to: Heredity, DNA and RNA
Classification, Heredity, DNA and Objectives At the end of this sub section you should be able to: RNA Heredity and Variation Gene Expression DNA structure DNA Profiling Protein Synthesis 1. Discuss the
DNA STRUCTURE & REPLICATION
DNA STRUCTURE & REPLICATION A MODEL OF DNA In 1953, two scientists named Watson & Crick built a model of DNA that demonstrates its exact structure and function. They called this model a double helix, which
DNA- THE MOLECULE OF LIFE. Link
DNA- THE MOLECULE OF LIFE Link STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,
DNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base
DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells
Chapter 12 Molecular Genetics
Section 1: DNA: The Genetic Material Section 2: Replication of DNA Section 3: DNA, RNA, and Protein Section 4: Gene Regulation and Mutation 12.1 DNA: The Genetic Material Objectives: 1. Summarize the experiments
Lesson Overview. The Structure of DNA
Lesson Overview The Structure of DNA Related Videos Stated Clearly: http://youtu.be/zwibgnge4ay Bozeman Nucleic acids: http://youtu.be/nnasrkiu5fw Bozeman People who discovered DNA: http://youtu.be/qoervswkmgk
DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
DNA: The Primary Source of Heritable Information. Genetic information is transmitted from one generation to the next through DNA or RNA
DNA and Replication DNA: The Primary Source of Heritable Information Genetic information is transmitted from one generation to the next through DNA or RNA Chromosomes Non-eukaryotic (bacteria) organisms
DNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
Unit 6 Molecular Genetics
Unit 6 Molecular Genetics I. DNA and RNA structure pages 2-6 II. DNA replication pages 6-7 III. Protein Synthesis pages 7-10 South Dakota State Standard 9-12.L.1.1 Students are able to relate cellular
8.1. DNA was identified as the genetic material through a series of experiments. Injected mice with R bacteria. Injected mice with S bacteria
SECTION 8.1 IDENTIFYING DNA AS THE GENETIC MATERIAL Study Guide KEY CONCEPT DNA was identified as the genetic material through a series of experiments. VOCABULARY bacteriophage Griffith finds a transforming
PROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
THE COMPONENTS & STRUCTURE OF DNA
THE COMPONENTS & STRUCTURE OF DNA - How do genes work? - What are they made of, and how do they determine the characteristics of organisms? - Are genes single molecules, or are they longer structures made
Study Guide A. Answer Key
From DNA to Proteins Answer Key SECTION 1. IDENTIFYING DNA AS THE GENETIC MATERIAL 1. Mice lived 2. Mice died 3. Mice lived 4. Mice died 5. S 6. bacteria 7. DNA; DNA; DNA 8. protein 9. radioactive 10.
Name Date Class. The Central Dogma of Biology
Concept Mapping The Central Dogma of Biology Complete the events chain showing the events that occur as DNA codes for RNA, which guides the synthesis of proteins, the central dogma of biology. These terms
(deoxyribonucleic acid)
1 The Central Dogma of Molecular Biology Mark Mayo Cypress College 2 The Central Dogma of Molecular Biology 3 Importance of Proteins There are three main kinds: structural - make up most body parts hormone
Bundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
Structure and Replication
Structure and Replication 6.A: Students will identify components of DNA, and describe how information for specifying traits of an organism is carried in the DNA 6.B: Students will recognize that components
DNA, RNA and protein synthesis
DNA, RNA and protein synthesis DNA is deoxyribonucleic acid DNA contains all the genetic instructions for making proteins within the cell. Each DNA molecule is made of repeating subunits called nucleotides.
Biology 30 DNA Review: Importance of Meiosis nucleus chromosomes Genes DNA
Biology 30 DNA Review: Importance of Meiosis Every cell has a nucleus and every nucleus has chromosomes. The number of chromosomes depends on the species. o Examples: Chicken 78 Chimpanzee 48 Potato 48
# Date Title Page # 1. 01/20/15 Chapter 11: Genetics /09/15 Chapter 14: Human Genetics /05/15 Chapter 12: DNA and RNA 49
Table of Contents # Date Title Page # 1. 01/20/15 Chapter 11: Genetics 1 2. 02/09/15 Chapter 14: Human Genetics 28 3. 03/05/15 Chapter 12: DNA and RNA 49 i 1 03/06/14 Ch. 12: DNA 49 Objective: Students
Structure. Structural Components of Nucleotides Base. Sugar. Introduction Nucleotide to Cells & Microscopy and Nucleic Acid. Phosphate Glycosidic bond
11 Structural Components of Nucleotides Base Sugar Introduction Nucleotide to Cells & Microscopy and Nucleic Acid Structure Phosphate Glycosidic bond H NUCLEOTIDE H Nucleic acid polymer of nucleotides
3'A C G A C C A G T A A A 5'
AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of
12 2 Chromosomes and DNA Replication Chromosomes and DNA Replication. Slide 1 of 21. Copyright Pearson Prentice Hall
12-2 Chromosomes and 1 of 21 DNA and Chromosomes DNA and Chromosomes In prokaryotic cells, DNA is located in the cytoplasm. Most prokaryotes have a single DNA molecule containing nearly all of the cell