Division Ave. High School AP Biology
|
|
- Horace O’Connor’
- 6 years ago
- Views:
Transcription
1 Division ve. High School Making s From ene to Protein How enes Work Organelles nucleus ribosomes endoplasmic reticulum (ER) olgi apparatus vesicles small nuclear pore ribosomal mrn large ribosomal cytoplasm Nucleus & Nucleolus Nucleolus Function ribosome production build ribosome s from rrn & s exit through nuclear pores to cytoplasm & combine to form functional ribosomes large small rrn & s ribosome nucleolus Ribosomes Function production Structure rrn & 2 s combine Ribosomes Rough ER large small 0.08µm ypes of Ribosomes Free ribosomes suspended in cytosol synthesize s that function in cytosol Bound ribosomes attached to endoplasmic reticulum synthesize s for export or for membranes Smooth ER membrane s PDF reated with deskpdf PDF Writer - rial :: 1
2 Division ve. High School DN nucleus RN endoplasmic reticulum vesicle on its way! O: O: O: End of the our O: vesicle ribosomes O: finished Making Proteins olgi apparatus What happens in the cell when a gene is read? Where are the genes? Y Where does a gene start? Where does the gene end? from DN? How is one gene read and another one not? How do s create phenotype? How do cells make s abolism taught us about genes Inheritance of metabolic diseases metabolic pathway suggested that genes coded for enzymes each disease (phenotype) is caused by non-functional gene product lack of an enzyme ay sachs PKU (phenylketonuria) albinism m I just the sum of my s? disease disease disease disease B D E enzyme 1 enzyme 2 enzyme 3 enzyme 4 Beadle & atum one gene : one enzyme hypothesis One gene / one enzyme hypothesis Damage to specific gene, mapped to nutritional mutations chromosome gene cluster 1 arg-e gene cluster 2 arg-f gene cluster 3 arg- arg-h eorge Beadle encoded enzyme enzyme E enzyme F enzyme enzyme H Edward atum "for their discovery that genes act by regulating definite chemical events" glutamate ornithine citruline arginosuccinate arginine substrate in gene that P biochemical Biology pathway was damaged PDF reated with deskpdf PDF Writer - rial :: 2
3 Division ve. High School he entral Dogma Flow of genetic information in a cell DN How do we move information from DN to s? replication transcription RN translation DN gets all the glory, but s do all the work! trait RN ribose sugar N-bases uracil instead of thymine U : : single stranded lots of RNs mrn, trn, rrn, sirn DN transcription RN ranscription from DN nucleic acid language to RN nucleic acid language ranscription Making mrn transcribed DN strand = template strand untranscribed DN strand = coding strand same sequence as RN synthesis of complementary RN strand transcription bubble enzyme coding strand RN polymerase 5 DN 3 rewinding mrn 5 build RN 5 3 U RN polymerase 3 U 3 5 unwinding template strand ranscription in Prokaryotes Psssst no nucleus! ell membrane ell wall Bacterial chromosome ranscription mrn ranscription in Prokaryotes Initiation RN polymerase binds to promoter sequence on DN Role of promoter Starting point where to start reading start of gene emplate strand which strand to read Direction on DN always read DN 3 5 P Biology build RN 5 3 PDF reated with deskpdf PDF Writer - rial :: 3
4 Division ve. High School enzyme ranscription in Prokaryotes read DN 3 5 Promoter sequences Promoter RN polymerase 35 sequence 10 sequence RN polymerase bacterial DN RN polymerase molecules bound to bacterial DN strong vs. weak promoters ranscription in Prokaryotes Elongation RN polymerase copies DN as it unwinds Simple proofreading 1 error/10 5 bases make many mrns mrn has short life not worth editing! ~20 base pairs at a time bases in gene builds RN 5 3 reads DN 3 5 ranscription in Prokaryotes ermination RN polymerase stops at termination sequence ranscription in Eukaryotes RN hairpin turn Psssst DN can t leave nucleus! ranscription RN Processing ranslation Protein Prokaryote vs. Eukaryote genes Prokaryotes eukaryotic DN DN in cytoplasm circular chromosome naked DN no introns Eukaryotes DN in nucleus linear chromosomes DN wound on histone s introns vs. exons intron = noncoding (inbetween) sequence exon = coding (expressed) sequence introns come out! ranscription in Eukaryotes 3 RN polymerase enzymes RN polymerase 1 only transcribes rrn genes makes ribosomes RN polymerase 2 transcribes genes into mrn RN polymerase 3 only transcribes trn genes each has a specific promoter sequence it recognizes PDF reated with deskpdf PDF Writer - rial :: 4
5 Division ve. High School ranscription in Eukaryotes Initiation complex transcription factors bind to promoter region upstream of gene suite of s which bind to DN turn on or off transcription box binding site recognition site for transcription factors transcription factors trigger the binding of RN polymerase to DN Post-transcriptional processing Primary transcript (pre-mrn) eukaryotic mrn needs work after transcription mrn processing (making mature mrn) mrn splicing = edit out introns protect mrn from enzymes in cytoplasm eukaryotic DN primary mrn transcript add 5 cap add poly tail mature mrn transcript cap PPP exon = coding (expressed) sequence mrn intron = noncoding (inbetween) sequence pre-mrn poly- tail s ~10,000 bases ~1,000 bases spliced mrn Bacterial chromosome ranslation from nucleic acid language to amino acid language ranslation in Prokaryotes Psssst no nucleus! ranscription ranslation mrn ell membrane ell wall ranslation in Prokaryotes ranscription & translation are simultaneous in bacteria DN is in cytoplasm no mrn editing ribosomes read mrn as it is being transcribed ranslation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DN to RN processing PDF reated with deskpdf PDF Writer - rial :: 5
6 Division ve. High School ranslation in Eukaryotes From gene to DN transcription mrn leaves nucleus through nuclear pores mrn translation ribosome nucleus cytoplasm s synthesized by ribosomes using instructions on mrn How does mrn code for s? DN 4 mrn 4 20 U U U UU U? rg Valsn lays la How can you code for 20 amino acids with only 4 nucleotide bases (,U,,)? mrn codes for s in triplets DN mrn U U UU U? codon rg Valsn lays la racking the code rick Nirenberg & Khorana determined 3-letter (triplet) codon system W H Y DIDHERED B EHEFR Nirenberg (47) & Khorana (17) determined mrn amino acid match added fabricated mrn to test tube of ribosomes, trn & amino acids created artificial UUUUU mrn found that UUU coded for phenylalanine (phe) Marshall Nirenberg Har Khorana PDF reated with deskpdf PDF Writer - rial :: 6
7 Division ve. High School he code ode for LL life! strongest support for a common origin for all life ode is redundant several codons for each amino acid 3rd base wobble Why is the wobble good? Start codon U methionine Stop codons U, U, U How are the codons matched to amino acids? 3 5 DN mrn trn amino acid 5 3 U U UU U 3 5 U rg U Val codon anti-codon From gene to DN transcription mrn translation ribosome ransfer RN structure lover leaf structure anticodon on clover leaf end amino acid attached on 3 end nucleus cytoplasm Loading trn minoacyl trn synthetase enzyme which bonds amino acid to trn bond requires energy P MP energy stored in trn-amino acid bond unstable so it can release amino acid at ribosome easily activating enzyme trn rp rp =O rp =O rp OH H 2 O OH O O anticodon tryptophan attached to trn rp U =O mrn trn rp binds to U condon of mrn Ribosomes Facilitate coupling of trn anticodon to mrn codon organelle or enzyme? Structure ribosomal RN (rrn) & s 2 s large small E P PDF reated with deskpdf PDF Writer - rial :: 7
8 Division ve. High School Ribosomes site (aminoacyl-trn site) holds trn carrying next amino acid to be added to chain P site (peptidyl-trn site) holds trn carrying growing polypeptide chain E site (exit site) empty trn leaves ribosome from exit site E U U P Building a polypeptide Initiation brings together mrn, ribosome s, initiator trn Elongation adding amino acids based on codon sequence ermination end codon Leu trn Leu Leu Leu U U U U U U U mrn UU U U U E P U U U U Val Ser la rp UU release factor Protein targeting Signal peptide address label start of a secretory pathway Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc an you tell the story? DN pre-mrn large ribosomal exon mature mrn poly tail RN polymerase cap intron polypeptide amino acids trn aminoacyl trn synthetase small ribosomal E P trn ribosome ot Questions? an I translate that for you? Substitute Slides for Student Print version PDF reated with deskpdf PDF Writer - rial :: 8
9 Division ve. High School an you tell the story? Extra Slides (used some years & not others) ranslation odons blocks of 3 nucleotides decoded into the sequence of amino acids Building Proteins Organelles involved nucleus ribosomes endoplasmic reticulum (ER) olgi apparatus vesicles he Protein ssembly Line nucleus ribosome ER olgi apparatus vesicles From nucleus to cytoplasm Where are the genes? genes are on chromosomes in nucleus Where are s synthesized? s made in cytoplasm by ribosomes How does the information get from DN in nucleus to cytoplasm? messenger RN lternative splicing lternative mrns produced from same gene when is an intron not an intron different segments treated as exons Starting to get hard to define a gene! nucleus PDF reated with deskpdf PDF Writer - rial :: 9
10 Division ve. High School Domains Modular architecture of many s exons may represent functional units of easier to mix and match in the production of new s? So What is a gene? One gene one enzyme? but not all s are enzymes but all s are coded by genes One gene one? but many s are composed of several polypeptides but each polypeptide has its own gene One gene one polypeptide? but many genes only code for RN (trn, rrn ) One gene one product? but many genes code for more than one product So Where does that leave us?! Defining a gene gene gene Defining a gene is problematic because one gene can code for several products, some genes code only for RN, two genes can overlap, and there are many other complications. RN polypeptide 1 polypeptide 2 polypeptide 3 Elizabeth Pennisi, Science 2003 It s hard to hunt for wabbits, if you don t know what a wabbit looks like. human genome Y 3.2 billion bases he ranscriptional unit (gene?) enhancer b 20-30b RN polymerase DN promoter UR translation start transcription start exons transcriptional unit introns translation stop UR transcription stop DN ny Questions?? What color would a smurf turn if he held his breath? pre-mrn P mature mrn PDF reated with deskpdf PDF Writer - rial :: 10
11 Division ve. High School he ranscriptional unit Discovery of Split genes enhancer b 20-30b exons RN polymerase transcriptional unit DN introns Richard Roberts SHL Philip Sharp MI adenovirus common cold beta-thalassemia Splicing must be accurate No room for mistakes! splicing must be exactly accurate a single base added or lost throws off the reading frame U U U U U U U U U U U U rg Ser sp Lys ly His U U U U U U U U U U U U rg Val rg SOP Splicing enzymes snrnps small nuclear RN s Spliceosome exon several snrnps recognize splice site sequence cut & paste No, not smurfs! snurps snrn intron snrnps exon exon mature mrn Whoa! I think we just broke a biological rule! exon spliceosome lariat excised intron Ribozyme RN as ribozyme some mrn can even splice itself RN as enzyme Sidney ltman Yale homas ech U of olorado PDF reated with deskpdf PDF Writer - rial :: 11
AP Biology
Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)
More informationFrom Genes to Protein
From Genes to Protein Transcription and Translation Metabolism Teaches Us About Genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from
More informationChapter 17. From Gene to Protein. AP Biology
Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)
More informationFrom Gene to Protein. How Genes Work (Ch. 17)
From Gene to Protein How Genes Work (Ch. 17) What do genes code for? How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA DNA proteins cells bodies The Central
More informationFrom Genes to Protein
From Genes to Protein Transcription and Translation Metabolism Teaches Us About Genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from
More informationFrom DNA to Protein. Chapter 14
From DNA to Protein Chapter 14 What do genes code for? How does DNA code for cells & bodies? How are cells and bodies made from the instructions in DNA? DNA proteins cells bodies The Central Dogma Flow
More informationCh. 10 From DNA to Protein. AP Biology
Ch. 10 From DNA to Protein Protein Synthesis Metabolism and Gene Expression n Inheritance of metabolic diseases suggests that genes coded for enzymes n Diseases (phenotypes) caused by non-functional gene
More informationCH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
More informationFrom Gene to Protein. How Genes Work
From Gene to Protein How Genes Work 2007-2008 The Central Dogma Flow of genetic information in a cell How do we move information from DNA to proteins? DNA RNA protein replication phenotype You! Step 1:
More informationOutline. Gene Expression. One Gene One Enzyme Hypothesis. 1. Central Dogma DNA RNA Protein
ene Expression: RN and Synthesis ene Expression RN synthesis synthesis enetic ode Outline Splicing enes Introns and Exons omparison of ene Expression in Prokaryotes and Eukaryotes ene Expression 1. entral
More informationThe Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work
Genes and How They Work Chapter 15 Early ideas to explain how genes work came from studying human diseases. Archibald Garrod studied alkaptonuria, 1902 Garrod recognized that the disease is inherited via
More informationChapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
More informationRNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013
RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationTranscription & Translation notes
Transcription & Translation notes TRNSRIPTION The entral Dogma DN RN proteins Protein Synthesis The DN inherited by an organism leads to specific traits by dictating the synthesis of proteins The process
More informationThe Flow of Genetic Information
Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins
More informationMolecular Biology: DNA, gene, chromosome and genome (Learning Objectives)
Molecular Biology: DN, gene, chromosome and genome (Learning bjectives) Nucleic acid structure and composition ompare and contrast the structure of DN and RN: features they share and how do they differ?
More informationFrom Gene to Protein. Chapter 17
From Gene to Protein Chapter 17 What you need to know: The key terms: gene expression, transcription, and translation. The major events of transcription. How eukaryotic cells modify RNA after transcription.
More informationMOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1
AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS
More informationBIOLOGY. Chapter 15 Genes & Proteins
BIOLOGY Chapter 15 Genes & Proteins CMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 17 Protein Synthesis 2014 Pearson Education, Inc. Fig. 17-1 Figure 17.1a n albino racoon Condition
More informationText Reference, Campbell v.8, chapter 17 PROTEIN SYNTHESIS
AP BIOLOGY Text Reference, Campbell v.8, chapter 17 ACTIVITY 1.22 NAME DATE HOUR PROTEIN SYNTHESIS GENETIC CODE PROTEIN SYNTHESIS OVERVIEW PROTEIN SYNTHESIS TRANSCRIPTION PROTEIN SYNTHESIS TRANSLATION
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationChapter 17. From Gene to Protein
Chapter 17 From Gene to Protein Overview: The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific
More informationChapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why?
Slide 1 Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationChapter 17 From Gene to Protein
Chapter 17 From Gene to Protein Question? How does DNA control a cell? By controlling Protein Synthesis. Proteins are the link between genotype and phenotype. For tests: Name(s) of experimenters Outline
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationThe Genetic Code: Translation. Pre-class reading Chapter 17: Pages
The Genetic Code: Translation Pre-class reading Chapter 17: Pages 336-348 Nomenclature needed: Translation RN (m, t, r) Signal peptide sequence Mutations Ribosomes + Polyribosomes Codon (triplet code)
More information14 Gene Expression: From Gene to Protein
CMPBELL BIOLOY IN FOCS rry Cain Wasserman Minorsky Jackson Reece 14 ene Expression: From ene to Protein Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge Overview: The Flow of enetic Information
More informationThe Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16
Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes
More informationGene function at the level of traits Gene function at the molecular level
Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationThe Structure of RNA. The Central Dogma
12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait
More informationChapter 17 From Gene to Protein
Chapter 17 From Gene to Protein The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific traits
More informationGenes and How They Work. Chapter 15
Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central
More informationChapter 17 From Gene to Protein
Chapter 17 From Gene to Protein Describe the structure of DNA. What is its elemental makeup? Name the subunit that makes up DNA. What components make up the DNA molecule? How are the two strands related
More informationBIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.
!! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More informationTranscription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
More informationFrom Gene to Protein
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
More informationGene Expression Translation U C A G A G
Why? ene Expression Translation How do cells synthesize polypeptides and convert them to functional proteins? The message in your DN of who you are and how your body works is carried out by cells through
More informationBIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
More informationDNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.
DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program
More informationChapter 3.5. Protein Synthesis
Chapter 3.5 Protein Synthesis Summary of Protein Synthesis How chemical Information is transfer during protein synthesis DNA mrna protein transcription the step from DNA to mrna occurs in the nucleus where
More informationGene Expression Transcription
Why? ene Expression Transcription How is mrn synthesized and what message does it carry? DN is often referred to as a genetic blueprint. In the same way that blueprints contain the instructions for construction
More informationMolecular Genetics. Before You Read. Read to Learn
12 Molecular Genetics section 3 DNA,, and Protein DNA codes for, which guides protein synthesis. What You ll Learn the different types of involved in transcription and translation the role of polymerase
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationDNA Structure. DNA Molecular Structure 5/29/2012. Chapter 4 Genetics and Cellular Function
5/29/202 hapter enetics and ellular Function D and R the nucleic acids D replication enes and their action D to Proteins (a) D Structure D threadlike molecule with uniform diameter, but varied length ow
More informationKey Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?
More informationChapter 14: From DNA to Protein
Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in
More informationGene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
More informationWhat do genes code for?
From ene to Protein How enes Work 2007-2008 Wht do genes code for? How does code for cells & bodies? how re cells nd bodies mde from the instructions in proteins cells bodies he entrl Dogm Flow of genetic
More informationCHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein
CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationSection A: The Connection Between Genes and Proteins
CHAPTER 17 FROM GENE TO PROTEIN Section A: The Connection Between Genes and Proteins 1. The study of metabolic defects provided evidence that genes specify proteins 2. Transcription and translation are
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationSection A: The Connection Between Genes and Proteins
CHAPTER 17 FROM GENE TO PROTEIN Section A: The Connection Between Genes and Proteins 1. The study of metabolic defects provided evidence that genes specify proteins 2. Transcription and translation are
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationGENE EXPRESSION AT THE MOLECULAR LEVEL. Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
GENE EXPRESSION AT THE MOLECULAR LEVEL Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene expression Gene function at the level of traits Gene function
More informationAnalyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated:
From Gene to Protein Beadle and Tatum Analyzed Fungi Neurospora crassa mutants Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: Precursor Ornithine
More informationBiotechnology Unit 3: DNA to Proteins. From DNA to RNA
From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of
More informationFrom Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
More informationRNA Polymerase. Initiation in eukaryotes. RNA processing in eukaryotes 10/25/18. Transcription and Translation. DNA is copied to make messenger RNA
RNSRIPION RN PROSSING RNSLION DN Pre- 10/25/18 ranscription and ranslation Finish ranscription processing Introns and exons Other types of RN he genetic code ranslation to protein Initiation longation
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationFermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
More informationGene Expression: From Gene to Protein
hapter 17 ene Expression: From ene to Protein Dr. Wendy Sera Houston ommunity ollege Biology 1406 The Flow of enetic Information The information content of genes is in the specific sequences of nucleotides
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationConcept 14.1: Genes specify proteins via. CH 14: Gene to Protein The Flow of Genetic Information. transcription and translation
H 14: ene to Protein The Flow of enetic Information The information of genes is in the sequences of nucleotides in DN DN leads to specific traits by dictating the synthesis of proteins oncept 14.1: enes
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationBig Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
More information6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA
6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationChapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
More informationProtein Synthesis Honors Biology
Protein Synthesis What do we know? Metabolism is controlled by enzymes enzymes are proteins DNA contains the genetic information to build proteins. DNA is only in the nucleus. Ribosomes are not. How then
More informationTranscription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.
Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally
More informationGene Expression: From Genes to Proteins
The Flow of Genetic Information Gene Expression: From Genes to Proteins Chapter 9 Central Dogma in Molecular Biology molecule Gene 1 Strand to be transcribed Gene 2 Gene 3 strand Codon : Polymerase transcribes
More informationTranscription and Translation
Transcription and Translation Central Dogma of Molecular The flow of information in the cell starts at DNA, which replicates to form more DNA. Information is then transcribed into RNA, and then it is translated
More informationVideos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
More informationProtein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
More informationHow to Use This Presentation
How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or
More informationChapter 17: From Gene to Protein
Name Period Chapter 17: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to
More informationHello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
More informationSection 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein?
Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Messenger RNA Carries Information for Protein Synthesis from the DNA to Ribosomes Ribosomes Consist
More informationFrom Gene to Phenotype- part 3. Lecture Outline 11/9/05. The genetic code. Translation: overview
DN mrn From ene to Phenotype- part 3 TRNSRIPTION DN 1 RN is transcribed from a DN template. 5 RN RN transcript polymerase RN PROESSIN Exon 2 In eukaryotes, the RN transcript RN transcript (premrn) is spliced
More informationThe Structure of Proteins The Structure of Proteins. How Proteins are Made: Genetic Transcription, Translation, and Regulation
How Proteins are Made: Genetic, Translation, and Regulation PLAY The Structure of Proteins 14.1 The Structure of Proteins Proteins - polymer amino acids - monomers Linked together with peptide bonds A
More informationProtein Synthesis. OpenStax College
OpenStax-CNX module: m46032 1 Protein Synthesis OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will
More informationDNA. Griffith s Transforming Principle Experiment 11/30/2006 DNA 2
DNA Griffith s Transforming Principle Experiment 11/30/2006 DNA 2 1 Avery, McCarty, & MacLeod 1944 Extended Griffith s work 16 years later Search for the transforming factor Live rough cells + Protein
More informationChapter 17: From Gene to Protein
Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master
More informationChapter 17. From Gene to Protein
Chapter 17 From Gene to Protein One Gene One Enzyme Hypothesis Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria Beadle
More informationFROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation
One Gene One Enzyme Hypothesis FROM GENE TO PROTEIN C H A P T E R 1 7 Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria
More informationChapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
More informationMolecular Genetics Quiz #1 SBI4U K T/I A C TOTAL
Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct
More informationThe Central Dogma. DNA makes RNA makes Proteins
The Central Dogma DNA makes RNA makes Proteins TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION OF
More informationLesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
More informationChapter 14: Gene Expression: From Gene to Protein
Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationBis2A 12.0 Transcription *
OpenStax-CNX module: m56068 1 Bis2A 12.0 Transcription * Mitch Singer Based on Transcription by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License
More informationChapter 14 Active Reading Guide From Gene to Protein
Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single
More information