De Novo Assembly (Pseudomonas aeruginosa MAPO1 ) Sample to Insight

Size: px
Start display at page:

Download "De Novo Assembly (Pseudomonas aeruginosa MAPO1 ) Sample to Insight"

Transcription

1 De Novo Assembly (Pseudomonas aeruginosa MAPO1 ) Sample to Insight 1

2 Workflow Import NGS raw data QC on reads De novo assembly Trim reads Finding Genes BLAST Sample to Insight

3 Case Study Pseudomonas aeruginosa MAPO1 variant re-sequencing Olivas AD et al., PLoS One, 2012 SRP SRX / SRR Single reads SRX / SRR mate-pair (distance: ) SRX114600/ SRR paired-end (distance: ) Sample to Insight

4 Demo Dataset Please unzip the file after you download from CLC Bio website Sample to Insight

5 Import NGS raw data Import Single Reads File 1. Select Single_read.fastq file 2. Uncheck all items in the General options 3. Confirm the quality score is NCBI/Sanger or Illumina pipeline 1.8 Sample to Insight

6 Import Mate-Paired Data Select Mate_pair_1.fastq and Mate_pair_2.fastq files Check-on Paired reads in general option Select Mate-pair in Paired reads information Set Max distance = 3800 Set Min distance = 2000 Sample to Insight

7

8

9 Select the location to save the mate-pair reads Press Finish

10 Import Paired-end Data Check-on Paired reads in general option Select Paired-end in Paired reads information Set Max distance = 350 Set Min distance = 150 Select 2 files: Sample to Insight

11 Please create a new folder and organize your data list

12 QC on reads NGS Core Tools Create Sequencing QC Report Sample to Insight

13 About QC on reads Please confirm uncheck discard quality score when you import reads Process analysis file by file (you can use batch function) The quality score in CLC GWB is transformed to PHRED score Sample to Insight

14

15 Create report

16 Check-on items, save result

17

18

19 Please repeat the procedure to get the reads QC report for mate-paired reads and paired-end reads Sample to Insight

20 Trim reads NGS Core Tools Trim Sequences Sample to Insight

21

22 Set p value = 0.05 (default) Next Set discard reads below length = 15 N Sample to Insight

23 Check on Save broken pairs Save the result Next

24

25

26 De novo assembly De Novo Sequencing De Novo Assembly Sample to Insight

27 Uncheck Automatic word size, set word size = 45 Uncheck Automatic Bubble size, set bubble size = 9 Set min contig length = 1000 Sample to Insight

28 De Brujin Grpah for De novo Assembly *Word size = k-mer size e.g k=16 Sample to Insight

29

30

31 Bubble or sequencing systematic error

32

33

34

35 Scaffolding

36 Deployment for De Novo Assembly Fast mode : De novo contig sequences only Slow Mode : Take de novo assembled contigs as reference template, then use all reads to process reference mapping (re-mapping) + update contigs Sample to Insight

37

38 Check-on Create report, save the result Next Assign the location to save contigs Sample to Insight

39 BLAST For BLAST Extract consensus sequence of contigs Process BLAST Sample to Insight

40 Extract consensus sequences Open de novo contig table Sample to Insight

41 Select all contigs, press Extract Contigs

42 Process BLAST

43 Select the consensus sequence Next

44 Select query for Bacteria

45 Save the result, assign the location Press Finish

46 BLAST result Sample to Insight

47 Finding Genes Classical Sequence Analysis Nucleotide analysis find Ope Sample to Insight

48 Select extracted de novo contigs

49 Set minimum length of OR Assign start codon: AUG, C Sample to Insight

50 Create annotated sequence and save the result

51 Assign path to save the ORF finding result

52

53 Extract ORF sequence Go to Plug-ins Download Plug-ins Select Extract Annotations Press Download and Install Press close and restart the software Sample to Insight

54 Classical Sequence Analysis General Sequence Analysis Sample to Insight

55 Select annotated ORF sequences

56 Select Type as ORF

57 Assign saving path Finish

58

59 For more information Please welcome to Sample to Insight

Tutorial. Whole Metagenome Functional Analysis (beta) Sample to Insight. November 21, 2017

Tutorial. Whole Metagenome Functional Analysis (beta) Sample to Insight. November 21, 2017 Whole Metagenome Functional Analysis (beta) November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com

More information

Data Basics. Josef K Vogt Slides by: Simon Rasmussen Next Generation Sequencing Analysis

Data Basics. Josef K Vogt Slides by: Simon Rasmussen Next Generation Sequencing Analysis Data Basics Josef K Vogt Slides by: Simon Rasmussen 2017 Generalized NGS analysis Sample prep & Sequencing Data size Main data reductive steps SNPs, genes, regions Application Assembly: Compare Raw Pre-

More information

De Novo Assembly of High-throughput Short Read Sequences

De Novo Assembly of High-throughput Short Read Sequences De Novo Assembly of High-throughput Short Read Sequences Chuming Chen Center for Bioinformatics and Computational Biology (CBCB) University of Delaware NECC Third Skate Genome Annotation Workshop May 23,

More information

De Novo Transcript Discovery using Long and Short Reads

De Novo Transcript Discovery using Long and Short Reads De Novo Transcript Discovery using Long and Short Reads December 4, 2018 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com

More information

Genome Assembly Software for Different Technology Platforms. PacBio Canu Falcon. Illumina Soap Denovo Discovar Platinus MaSuRCA.

Genome Assembly Software for Different Technology Platforms. PacBio Canu Falcon. Illumina Soap Denovo Discovar Platinus MaSuRCA. Genome Assembly Software for Different Technology Platforms PacBio Canu Falcon 10x SuperNova Illumina Soap Denovo Discovar Platinus MaSuRCA Experimental design using Illumina Platform Estimate genome size:

More information

Introduction to RNA sequencing

Introduction to RNA sequencing Introduction to RNA sequencing Bioinformatics perspective Olga Dethlefsen NBIS, National Bioinformatics Infrastructure Sweden November 2017 Olga (NBIS) RNA-seq November 2017 1 / 49 Outline Why sequence

More information

NGS developments in tomato genome sequencing

NGS developments in tomato genome sequencing NGS developments in tomato genome sequencing 16-02-2012, Sandra Smit TATGTTTTGGAAAACATTGCATGCGGAATTGGGTACTAGGTTGGACCTTAGTACC GCGTTCCATCCTCAGACCGATGGTCAGTCTGAGAGAACGATTCAAGTGTTGGAAG ATATGCTTCGTGCATGTGTGATAGAGTTTGGTGGCCATTGGGATAGCTTCTTACC

More information

Experimental Design. Sequencing. Data Quality Control. Read mapping. Differential Expression analysis

Experimental Design. Sequencing. Data Quality Control. Read mapping. Differential Expression analysis -Seq Analysis Quality Control checks Reproducibility Reliability -seq vs Microarray Higher sensitivity and dynamic range Lower technical variation Available for all species Novel transcript identification

More information

QIAseq Targeted Panel Analysis Plugin USER MANUAL

QIAseq Targeted Panel Analysis Plugin USER MANUAL QIAseq Targeted Panel Analysis Plugin USER MANUAL User manual for QIAseq Targeted Panel Analysis 1.1 Windows, macos and Linux June 18, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej

More information

Workflow of de novo assembly

Workflow of de novo assembly Workflow of de novo assembly Experimental Design Clean sequencing data (trim adapter and low quality sequences) Run assembly software for contiging and scaffolding Evaluation of assembly Several iterations:

More information

Outline. The types of Illumina data Methods of assembly Repeats Selecting k-mer size Assembly Tools Assembly Diagnostics Assembly Polishing

Outline. The types of Illumina data Methods of assembly Repeats Selecting k-mer size Assembly Tools Assembly Diagnostics Assembly Polishing Illumina Assembly 1 Outline The types of Illumina data Methods of assembly Repeats Selecting k-mer size Assembly Tools Assembly Diagnostics Assembly Polishing 2 Illumina Sequencing Paired end Illumina

More information

Genomics AGRY Michael Gribskov Hock 331

Genomics AGRY Michael Gribskov Hock 331 Genomics AGRY 60000 Michael Gribskov gribskov@purdue.edu Hock 331 Computing Essentials Resources In this course we will assemble and annotate both genomic and transcriptomic sequence assemblies We will

More information

Sequence Assembly and Alignment. Jim Noonan Department of Genetics

Sequence Assembly and Alignment. Jim Noonan Department of Genetics Sequence Assembly and Alignment Jim Noonan Department of Genetics james.noonan@yale.edu www.yale.edu/noonanlab The assembly problem >>10 9 sequencing reads 36 bp - 1 kb 3 Gb Outline Basic concepts in genome

More information

CGE Pipeline. Content 1. The Batch Upload 2. The Pipeline 3. The User System 4. The List Tool 5. The Map Tool 6. Exercises

CGE Pipeline. Content 1. The Batch Upload 2. The Pipeline 3. The User System 4. The List Tool 5. The Map Tool 6. Exercises CGE Pipeline Content 1. The Batch Upload 2. The Pipeline 3. The User System 4. The List Tool 5. The Map Tool 6. Exercises Jose Luis Bellod Cisneros PhD. Student Content 1. The Batch Upload 2. The Pipeline

More information

Sanger vs Next-Gen Sequencing

Sanger vs Next-Gen Sequencing Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics

More information

CGE Pipeline. Content 1. The User System 2. The Batch Upload 3. The Pipeline 4. The List Tool 5. The Map Tool 6. FuturePlans 7.

CGE Pipeline. Content 1. The User System 2. The Batch Upload 3. The Pipeline 4. The List Tool 5. The Map Tool 6. FuturePlans 7. CGE Pipeline Content 1. The User System 2. The Batch Upload 3. The Pipeline 4. The List Tool 5. The Map Tool 6. FuturePlans 7. Q&A Jose Luis Bellod Cisneros PhD. Student Content 1. The Batch Upload 2.

More information

Introduction to metagenome assembly. Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014

Introduction to metagenome assembly. Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014 Introduction to metagenome assembly Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014 Sequencing specs* Method Read length Accuracy Million reads Time Cost per M 454

More information

Quality assessment and control of sequence data. Naiara Rodríguez-Ezpeleta

Quality assessment and control of sequence data. Naiara Rodríguez-Ezpeleta Quality assessment and control of sequence data Naiara Rodríguez-Ezpeleta Workshop on Genomics 2014 Quality control is important Some of the artefacts/problems that can be detected with QC Sequencing Sequence

More information

From Infection to Genbank

From Infection to Genbank From Infection to Genbank How a pathogenic bacterium gets its genome to NCBI Torsten Seemann VLSCI - Life Sciences Computation Centre - Genomics Theme - Lab Meeting - Friday 27 April 2012 The steps 1.

More information

De novo whole genome assembly

De novo whole genome assembly De novo whole genome assembly Qi Sun Bioinformatics Facility Cornell University Sequencing platforms Short reads: o Illumina (150 bp, up to 300 bp) Long reads (>10kb): o PacBio SMRT; o Oxford Nanopore

More information

High throughput sequencing technologies

High throughput sequencing technologies High throughput sequencing technologies and NGS applications Mei-yeh Lu 呂美曄 High Throughput Sequencing Core Manager g g p q g g Academia Sinica 6/30/2011 Outlines Evolution of sequencing technologies Sanger

More information

RNA-Seq Module 2 From QC to differential gene expression.

RNA-Seq Module 2 From QC to differential gene expression. RNA-Seq Module 2 From QC to differential gene expression. Ying Zhang Ph.D, Informatics Analyst Research Informatics Support System (RISS) MSI Apr. 24, 2012 RNA-Seq Tutorials Tutorial 1: Introductory (Mar.

More information

Introduction to CGE tools

Introduction to CGE tools Introduction to CGE tools Pimlapas Leekitcharoenphon (Shinny) Research Group of Genomic Epidemiology, DTU-Food. WHO Collaborating Centre for Antimicrobial Resistance in Foodborne Pathogens and Genomics.

More information

Next Gen Sequencing. Expansion of sequencing technology. Contents

Next Gen Sequencing. Expansion of sequencing technology. Contents Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND

More information

I AM NOT A METAGENOMIC EXPERT. I am merely the MESSENGER. Blaise T.F. Alako, PhD EBI Ambassador

I AM NOT A METAGENOMIC EXPERT. I am merely the MESSENGER. Blaise T.F. Alako, PhD EBI Ambassador I AM NOT A METAGENOMIC EXPERT I am merely the MESSENGER Blaise T.F. Alako, PhD EBI Ambassador blaise@ebi.ac.uk Hubert Denise Alex Mitchell Peter Sterk Sarah Hunter http://www.ebi.ac.uk/metagenomics Blaise

More information

Genomics and Transcriptomics of Spirodela polyrhiza

Genomics and Transcriptomics of Spirodela polyrhiza Genomics and Transcriptomics of Spirodela polyrhiza Doug Bryant Bioinformatics Core Facility & Todd Mockler Group, Donald Danforth Plant Science Center Desired Outcomes High-quality genomic reference sequence

More information

Next Generation Sequences & Chloroplast Assembly. 8 June, 2012 Jongsun Park

Next Generation Sequences & Chloroplast Assembly. 8 June, 2012 Jongsun Park Next Generation Sequences & Chloroplast Assembly 8 June, 2012 Jongsun Park Table of Contents 1 History of Sequencing Technologies 2 Genome Assembly Processes With NGS Sequences 3 How to Assembly Chloroplast

More information

De Novo and Hybrid Assembly

De Novo and Hybrid Assembly On the PacBio RS Introduction The PacBio RS utilizes SMRT technology to generate both Continuous Long Read ( CLR ) and Circular Consensus Read ( CCS ) data. In this document, we describe sequencing the

More information

Assemblytics: a web analytics tool for the detection of assembly-based variants Maria Nattestad and Michael C. Schatz

Assemblytics: a web analytics tool for the detection of assembly-based variants Maria Nattestad and Michael C. Schatz Assemblytics: a web analytics tool for the detection of assembly-based variants Maria Nattestad and Michael C. Schatz Table of Contents Supplementary Note 1: Unique Anchor Filtering Supplementary Figure

More information

GenScale Scalable, Optimized and Parallel Algorithms for Genomics. Dominique LAVENIER

GenScale Scalable, Optimized and Parallel Algorithms for Genomics. Dominique LAVENIER GenScale Scalable, Optimized and Parallel Algorithms for Genomics Dominique LAVENIER Context New Sequencing Technologies - NGS Exponential growth of genomic data Drastic decreasing of costs Emergence of

More information

The Basics of Understanding Whole Genome Next Generation Sequence Data

The Basics of Understanding Whole Genome Next Generation Sequence Data The Basics of Understanding Whole Genome Next Generation Sequence Data Heather Carleton-Romer, MPH, Ph.D. ASM-CDC Infectious Disease and Public Health Microbiology Postdoctoral Fellow PulseNet USA Next

More information

De novo meta-assembly of ultra-deep sequencing data

De novo meta-assembly of ultra-deep sequencing data De novo meta-assembly of ultra-deep sequencing data Hamid Mirebrahim 1, Timothy J. Close 2 and Stefano Lonardi 1 1 Department of Computer Science and Engineering 2 Department of Botany and Plant Sciences

More information

Course Presentation. Ignacio Medina Presentation

Course Presentation. Ignacio Medina Presentation Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital

More information

Introduction to DNA-Sequencing

Introduction to DNA-Sequencing informatics.sydney.edu.au sih.info@sydney.edu.au The Sydney Informatics Hub provides support, training, and advice on research data, analyses and computing. Talk to us about your computing infrastructure,

More information

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel. DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private

More information

Bioinformatics Course AA 2017/2018 Tutorial 2

Bioinformatics Course AA 2017/2018 Tutorial 2 UNIVERSITÀ DEGLI STUDI DI PAVIA - FACOLTÀ DI SCIENZE MM.FF.NN. - LM MOLECULAR BIOLOGY AND GENETICS Bioinformatics Course AA 2017/2018 Tutorial 2 Anna Maria Floriano annamaria.floriano01@universitadipavia.it

More information

Zika infected human samples

Zika infected human samples Lecture 16 RNA-seq Zika infected human samples Experimental design ZIKV-infected hnpcs 56 hours after ZIKA and mock infection in parallel cultures were used for global transcriptome analysis. RNA-seq libraries

More information

De novo assembly in RNA-seq analysis.

De novo assembly in RNA-seq analysis. De novo assembly in RNA-seq analysis. Joachim Bargsten Wageningen UR/PRI/Plant Breeding October 2012 Motivation Transcriptome sequencing (RNA-seq) Gene expression / differential expression Reconstruct

More information

DATA FORMATS AND QUALITY CONTROL

DATA FORMATS AND QUALITY CONTROL HTS Summer School 12-16th September 2016 DATA FORMATS AND QUALITY CONTROL Romina Petersen, University of Cambridge (rp520@medschl.cam.ac.uk) Luigi Grassi, University of Cambridge (lg490@medschl.cam.ac.uk)

More information

High-Throughput Bioinformatics: Re-sequencing and de novo assembly. Elena Czeizler

High-Throughput Bioinformatics: Re-sequencing and de novo assembly. Elena Czeizler High-Throughput Bioinformatics: Re-sequencing and de novo assembly Elena Czeizler 13.11.2015 Sequencing data Current sequencing technologies produce large amounts of data: short reads The outputted sequences

More information

Supplementary Figure 1. Design of the control microarray. a, Genomic DNA from the

Supplementary Figure 1. Design of the control microarray. a, Genomic DNA from the Supplementary Information Supplementary Figures Supplementary Figure 1. Design of the control microarray. a, Genomic DNA from the strain M8 of S. ruber and a fosmid containing the S. ruber M8 virus M8CR4

More information

Tutorial. Bisulfite Sequencing. Sample to Insight. September 15, 2016

Tutorial. Bisulfite Sequencing. Sample to Insight. September 15, 2016 Bisulfite Sequencing September 15, 2016 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com Bisulfite

More information

Faction 2: Genome Assembly Lab and Preliminary Data

Faction 2: Genome Assembly Lab and Preliminary Data Faction 2: Genome Assembly Lab and Preliminary Data [Computational Genomics 2017] Christian Colon, Erisa Sula, David Lu, Tian Jin, Lijiang Long, Rohini Mopuri, Bowen Yang, Saminda Wijeratne, Harrison Kim

More information

short read genome assembly Sorin Istrail CSCI1820 Short-read genome assembly algorithms 3/6/2014

short read genome assembly Sorin Istrail CSCI1820 Short-read genome assembly algorithms 3/6/2014 1 short read genome assembly Sorin Istrail CSCI1820 Short-read genome assembly algorithms 3/6/2014 2 Genomathica Assembler Mathematica notebook for genome assembly simulation Assembler can be found at:

More information

Quality assessment and control of sequence data

Quality assessment and control of sequence data Quality assessment and control of sequence data Naiara Rodríguez-Ezpeleta Workshop on Genomics 2015 Cesky Krumlov fastq format fasta Most basic file format to represent nucleotide or amino-acid sequences

More information

NEXT GENERATION SEQUENCING. Farhat Habib

NEXT GENERATION SEQUENCING. Farhat Habib NEXT GENERATION SEQUENCING HISTORY HISTORY Sanger Dominant for last ~30 years 1000bp longest read Based on primers so not good for repetitive or SNPs sites HISTORY Sanger Dominant for last ~30 years 1000bp

More information

Genome Assembly With Next Generation Sequencers

Genome Assembly With Next Generation Sequencers Genome Assembly With Next Generation Sequencers Personal Genomics Institute 3 May, 2011 Jongsun Park Table of Contents 1 Central Dogma and Omics Studies 2 History of Sequencing Technologies 3 Genome Assembly

More information

Illumina Sequencing Error Profiles and Quality Control

Illumina Sequencing Error Profiles and Quality Control Illumina Sequencing Error Profiles and Quality Control RNA-seq Workflow Biological samples/library preparation Sequence reads FASTQC Adapter Trimming (Optional) Splice-aware mapping to genome Counting

More information

Bioinformatics small variants Data Analysis. Guidelines. genomescan.nl

Bioinformatics small variants Data Analysis. Guidelines. genomescan.nl Next Generation Sequencing Bioinformatics small variants Data Analysis Guidelines genomescan.nl GenomeScan s Guidelines for Small Variant Analysis on NGS Data Using our own proprietary data analysis pipelines

More information

Data Retrieval from GenBank

Data Retrieval from GenBank Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing

More information

Analytics Behind Genomic Testing

Analytics Behind Genomic Testing A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical

More information

NGS sequence preprocessing. José Carbonell Caballero

NGS sequence preprocessing. José Carbonell Caballero NGS sequence preprocessing José Carbonell Caballero jcarbonell@cipf.es Contents Data Format Quality Control Sequence capture Fasta and fastq formats Sequence quality encoding Evaluation of sequence quality

More information

CSE182-L16. LW statistics/assembly

CSE182-L16. LW statistics/assembly CSE182-L16 LW statistics/assembly Silly Quiz Who are these people, and what is the occasion? Genome Sequencing and Assembly Sequencing A break at T is shown here. Measuring the lengths using electrophoresis

More information

Analysis Report. Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly

Analysis Report. Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly Analysis Report Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly 1 Table of Contents 1. Result of Whole Genome Assembly

More information

What will be covered?

What will be covered? What will be covered? 1. Annotation overview 2. Using the RAST family for genome annotation: Optimizing RAST for phages Command line/ Batch options 3. Introducing PATRIC and resources in development Therapeutic

More information

Assembling a Cassava Transcriptome using Galaxy on a High Performance Computing Cluster

Assembling a Cassava Transcriptome using Galaxy on a High Performance Computing Cluster Assembling a Cassava Transcriptome using Galaxy on a High Performance Computing Cluster Aobakwe Matshidiso Supervisor: Prof Chrissie Rey Co-Supervisor: Prof Scott Hazelhurst Next Generation Sequencing

More information

de novo metagenome assembly

de novo metagenome assembly 1 de novo metagenome assembly Rayan Chikhi CNRS Univ. Lille 1 Formation metagenomique de novo metagenomics 2 de novo metagenomics Goal: biological sense out of sequencing data Techniques: 1. de novo assembly

More information

Transcriptome Assembly, Functional Annotation (and a few other related thoughts)

Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 23, 2017 Differential Gene Expression Generalized Workflow File Types

More information

Francisco García Quality Control for NGS Raw Data

Francisco García Quality Control for NGS Raw Data Contents Data formats Sequence capture Fasta and fastq formats Sequence quality encoding Quality Control Evaluation of sequence quality Quality control tools Identification of artifacts & filtering Practical

More information

Introduction to NGS Analysis Tools

Introduction to NGS Analysis Tools National Center for Emerging and Zoonotic Infectious Diseases Introduction to NGS Analysis Tools Heather Carleton, PhD, MPH Team Lead, Enteric Diseases Bioinformatics, Enteric Diseases Laboratory Branch,

More information

Determining presence/absence threshold for your dataset

Determining presence/absence threshold for your dataset Determining presence/absence threshold for your dataset In PanCGHweb there are two ways to determine the presence/absence calling threshold. One is based on Receiver Operating Curves (ROC) generated for

More information

Workflows and Pipelines for NGS analysis: Lessons from proteomics

Workflows and Pipelines for NGS analysis: Lessons from proteomics Workflows and Pipelines for NGS analysis: Lessons from proteomics Conference on Applying NGS in Basic research Health care and Agriculture 11 th Sep 2014 Debasis Dash Where are the protein coding genes

More information

The Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica

The Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica The Ensembl Database Dott.ssa Inga Prokopenko Corso di Genomica 1 www.ensembl.org Lecture 7.1 2 What is Ensembl? Public annotation of mammalian and other genomes Open source software Relational database

More information

Introduction to the MiSeq

Introduction to the MiSeq Introduction to the MiSeq 2011 Illumina, Inc. All rights reserved. Illumina, illuminadx, BeadArray, BeadXpress, cbot, CSPro, DASL, Eco, Genetic Energy, GAIIx, Genome Analyzer, GenomeStudio, GoldenGate,

More information

CDC s Advanced Molecular Detection (AMD) Sequence Data Analysis and Management

CDC s Advanced Molecular Detection (AMD) Sequence Data Analysis and Management CDC s Advanced Molecular Detection (AMD) Sequence Data Analysis and Management Scott Sammons Technology Officer Office of Advanced Molecular Detection National Center for Emerging and Zoonotic Infectious

More information

Mapping strategies for sequence reads

Mapping strategies for sequence reads Mapping strategies for sequence reads Ernest Turro University of Cambridge 21 Oct 2013 Quantification A basic aim in genomics is working out the contents of a biological sample. 1. What distinct elements

More information

C3BI. VARIANTS CALLING November Pierre Lechat Stéphane Descorps-Declère

C3BI. VARIANTS CALLING November Pierre Lechat Stéphane Descorps-Declère C3BI VARIANTS CALLING November 2016 Pierre Lechat Stéphane Descorps-Declère General Workflow (GATK) software websites software bwa picard samtools GATK IGV tablet vcftools website http://bio-bwa.sourceforge.net/

More information

Mapping Next Generation Sequence Reads. Bingbing Yuan Dec. 2, 2010

Mapping Next Generation Sequence Reads. Bingbing Yuan Dec. 2, 2010 Mapping Next Generation Sequence Reads Bingbing Yuan Dec. 2, 2010 1 What happen if reads are not mapped properly? Some data won t be used, thus fewer reads would be aligned. Reads are mapped to the wrong

More information

Bioinformatics? Assembly, annotation, comparative genomics and a bit of phylogeny.

Bioinformatics? Assembly, annotation, comparative genomics and a bit of phylogeny. Bioinformatics? Assembly, annotation, comparative genomics and a bit of phylogeny stefano.gaiarsa@unimi.it Case study! it s a FAKE ONE, do not run away in panic! There s an outbreak of Mycoplasma bovis

More information

Human Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased

Human Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased Human Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased exponentially since the 1990s. In 2005, with the introduction

More information

Finishing Drosophila elegans Contig DELE This project aimed to finish the contig DELE from the F element (chromosome 6)

Finishing Drosophila elegans Contig DELE This project aimed to finish the contig DELE from the F element (chromosome 6) Ji Han (Ricky) Lee 2015. 02. 27 Bio 434W Professor Elgin Finishing Drosophila elegans Contig DELE8596013 Abstract This project aimed to finish the contig DELE8596013 from the F element (chromosome 6) of

More information

SUPPLEMENTARY MATERIAL FOR THE PAPER: RASCAF: IMPROVING GENOME ASSEMBLY WITH RNA-SEQ DATA

SUPPLEMENTARY MATERIAL FOR THE PAPER: RASCAF: IMPROVING GENOME ASSEMBLY WITH RNA-SEQ DATA SUPPLEMENTARY MATERIAL FOR THE PAPER: RASCAF: IMPROVING GENOME ASSEMBLY WITH RNA-SEQ DATA Authors: Li Song, Dhruv S. Shankar, Liliana Florea Table of contents: Figure S1. Methods finding contig connections

More information

Finishing of DELE Drosophila elegans has been sequenced using Roche 454 pyrosequencing and Illumina

Finishing of DELE Drosophila elegans has been sequenced using Roche 454 pyrosequencing and Illumina Sarah Swiezy Dr. Elgin, Dr. Shaffer Bio 434W 27 February 2015 Finishing of DELE8596009 Abstract Drosophila elegans has been sequenced using Roche 454 pyrosequencing and Illumina technology. DELE8596009,

More information

Bioinformatics Tools and Pipelines for Real-Time Pathogen Surveillance

Bioinformatics Tools and Pipelines for Real-Time Pathogen Surveillance Bioinformatics Tools and Pipelines for Real-Time Pathogen Surveillance Errol Strain, Ph.D. Chief, Biostatistics Branch FDA/OFVM/CFSAN/OAO/DPHIA 3/24/2014 Overview 1. Validation and Proficiency Testing

More information

Finishing Drosophila grimshawi Fosmid Clone DGA23F17. Kenneth Smith Biology 434W Professor Elgin February 20, 2009

Finishing Drosophila grimshawi Fosmid Clone DGA23F17. Kenneth Smith Biology 434W Professor Elgin February 20, 2009 Finishing Drosophila grimshawi Fosmid Clone DGA23F17 Kenneth Smith Biology 434W Professor Elgin February 20, 2009 Smith 2 Abstract: My fosmid, DGA23F17, did not present too many challenges when I finished

More information

The New Genome Analyzer IIx Delivering more data, faster, and easier than ever before. Jeremy Preston, PhD Marketing Manager, Sequencing

The New Genome Analyzer IIx Delivering more data, faster, and easier than ever before. Jeremy Preston, PhD Marketing Manager, Sequencing The New Genome Analyzer IIx Delivering more data, faster, and easier than ever before Jeremy Preston, PhD Marketing Manager, Sequencing Illumina Genome Analyzer: a Paradigm Shift 2000x gain in efficiency

More information

Bioinformatic analysis of Illumina sequencing data for comparative genomics Part I

Bioinformatic analysis of Illumina sequencing data for comparative genomics Part I Bioinformatic analysis of Illumina sequencing data for comparative genomics Part I Dr David Studholme. 18 th February 2014. BIO1033 theme lecture. 1 28 February 2014 @davidjstudholme 28 February 2014 @davidjstudholme

More information

Introduction to RNA-Seq in GeneSpring NGS Software

Introduction to RNA-Seq in GeneSpring NGS Software Introduction to RNA-Seq in GeneSpring NGS Software Dipa Roy Choudhury, Ph.D. Strand Scientific Intelligence and Agilent Technologies Learn more at www.genespring.com Introduction to RNA-Seq In a few years,

More information

Consensus Ensemble Approaches Improve De Novo Transcriptome Assemblies

Consensus Ensemble Approaches Improve De Novo Transcriptome Assemblies University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Computer Science and Engineering: Theses, Dissertations, and Student Research Computer Science and Engineering, Department

More information

SMRT Analysis Barcoding Overview (v6.0.0)

SMRT Analysis Barcoding Overview (v6.0.0) SMRT Analysis Barcoding Overview (v6.0.0) Introduction This document applies to PacBio RS II and Sequel Systems using SMRT Link v6.0.0. Note: For information on earlier versions of SMRT Link, see the document

More information

TruSPAdes: analysis of variations using TruSeq Synthetic Long Reads (TSLR)

TruSPAdes: analysis of variations using TruSeq Synthetic Long Reads (TSLR) tru TruSPAdes: analysis of variations using TruSeq Synthetic Long Reads (TSLR) Anton Bankevich Center for Algorithmic Biotechnology, SPbSU Sequencing costs 1. Sequencing costs do not follow Moore s law

More information

CBC Data Therapy. Metatranscriptomics Discussion

CBC Data Therapy. Metatranscriptomics Discussion CBC Data Therapy Metatranscriptomics Discussion Metatranscriptomics Extract RNA, subtract rrna Sequence cdna QC Gene expression, function Institute for Systems Genomics: Computational Biology Core bioinformatics.uconn.edu

More information

Transcriptome Assembly and Evaluation, using Sequencing Quality Control (SEQC) Data

Transcriptome Assembly and Evaluation, using Sequencing Quality Control (SEQC) Data Transcriptome Assembly and Evaluation, using Sequencing Quality Control (SEQC) Data Introduction The US Food and Drug Administration (FDA) has coordinated the Sequencing Quality Control project (SEQC/MAQC-III)

More information

Next-generation sequencing technologies

Next-generation sequencing technologies Next-generation sequencing technologies NGS applications Illumina sequencing workflow Overview Sequencing by ligation Short-read NGS Sequencing by synthesis Illumina NGS Single-molecule approach Long-read

More information

Ecole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech

Ecole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech GALAXY INITIATION A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech How does Next- Gen sequencing work? DNA fragmentation Size selection and clonal amplification Massive parallel sequencing ACCGTTTGCCG

More information

BIOINFORMATICS ORIGINAL PAPER

BIOINFORMATICS ORIGINAL PAPER BIOINFORMATICS ORIGINAL PAPER Vol. 27 no. 21 2011, pages 2957 2963 doi:10.1093/bioinformatics/btr507 Genome analysis Advance Access publication September 7, 2011 : fast length adjustment of short reads

More information

Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms

Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality

More information

Analysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer. Project XX1001. Customer Detail

Analysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer. Project XX1001. Customer Detail Analysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer Project XX Customer Detail Table of Contents. Bioinformatics analysis pipeline...3.. Read quality check. 3.2. Read alignment...3.3.

More information

Bioinformatics for Microbial Biology

Bioinformatics for Microbial Biology Bioinformatics for Microbial Biology Chaochun Wei ( 韦朝春 ) ccwei@sjtu.edu.cn http://cbb.sjtu.edu.cn/~ccwei Fall 2013 1 Outline Part I: Visualization tools for microbial genomes Tools: Gbrowser Part II:

More information

Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro

Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro Philip Morris International R&D, Philip Morris Products S.A., Neuchatel, Switzerland Introduction Nicotiana sylvestris

More information

1.1 Post Run QC Analysis

1.1 Post Run QC Analysis Post Run QC Analysis 100 339 200 01 1. Post Run QC Analysis 1.1 Post Run QC Analysis Welcome to Pacific Biosciences' Post Run QC Analysis Overview. This training module will describe the workflow to assess

More information

The goal of this project was to prepare the DEUG contig which covers the

The goal of this project was to prepare the DEUG contig which covers the Prakash 1 Jaya Prakash Dr. Elgin, Dr. Shaffer Biology 434W 10 February 2017 Finishing of DEUG4927010 Abstract The goal of this project was to prepare the DEUG4927010 contig which covers the terminal 99,279

More information

Mate-pair library data improves genome assembly

Mate-pair library data improves genome assembly De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate

More information

Lecture 7. Next-generation sequencing technologies

Lecture 7. Next-generation sequencing technologies Lecture 7 Next-generation sequencing technologies Next-generation sequencing technologies General principles of short-read NGS Construct a library of fragments Generate clonal template populations Massively

More information

Using New ThiNGS on Small Things. Shane Byrne

Using New ThiNGS on Small Things. Shane Byrne Using New ThiNGS on Small Things Shane Byrne Next Generation Sequencing New Things Small Things NGS Next Generation Sequencing = 2 nd generation of sequencing 454 GS FLX, SOLiD, GAIIx, HiSeq, MiSeq, Ion

More information

Metagenomic 3C, full length 16S amplicon sequencing on Illumina, and the diabetic skin microbiome

Metagenomic 3C, full length 16S amplicon sequencing on Illumina, and the diabetic skin microbiome Also: Sunaina Melissa Gardiner UTS Catherine Burke UTS Michael Liu UTS Chris Beitel UTS, UC Davis Matt DeMaere UTS Metagenomic 3C, full length 16S amplicon sequencing on Illumina, and the diabetic skin

More information

Comparative Bioinformatics. BSCI348S Fall 2003 Midterm 1

Comparative Bioinformatics. BSCI348S Fall 2003 Midterm 1 BSCI348S Fall 2003 Midterm 1 Multiple Choice: select the single best answer to the question or completion of the phrase. (5 points each) 1. The field of bioinformatics a. uses biomimetic algorithms to

More information

Finishing of DFIC This project sought to finish DFIC , the terminal 45 kb of the Drosophila

Finishing of DFIC This project sought to finish DFIC , the terminal 45 kb of the Drosophila Lin 1 Kevin Lin Bio 434W Dr. Elgin 26 February 2016 Finishing of DFIC6622001 Abstract This project sought to finish DFIC6622001, the terminal 45 kb of the Drosophila ficusphila dot chromosome. The initial

More information

From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow

From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with

More information

Investigation of Genomic Variation in the Rising Era of Individual Genome Sequence: A Primer on Some Available Datasets and Structures

Investigation of Genomic Variation in the Rising Era of Individual Genome Sequence: A Primer on Some Available Datasets and Structures Investigation of Genomic Variation in the Rising Era of Individual Genome Sequence: A Primer on Some Available Datasets and Structures September 28, 2015 A 10,000 Foot View Genomics Data at NCBI Organizational

More information