De Novo Assembly (Pseudomonas aeruginosa MAPO1 ) Sample to Insight
|
|
- Eric Davidson
- 5 years ago
- Views:
Transcription
1 De Novo Assembly (Pseudomonas aeruginosa MAPO1 ) Sample to Insight 1
2 Workflow Import NGS raw data QC on reads De novo assembly Trim reads Finding Genes BLAST Sample to Insight
3 Case Study Pseudomonas aeruginosa MAPO1 variant re-sequencing Olivas AD et al., PLoS One, 2012 SRP SRX / SRR Single reads SRX / SRR mate-pair (distance: ) SRX114600/ SRR paired-end (distance: ) Sample to Insight
4 Demo Dataset Please unzip the file after you download from CLC Bio website Sample to Insight
5 Import NGS raw data Import Single Reads File 1. Select Single_read.fastq file 2. Uncheck all items in the General options 3. Confirm the quality score is NCBI/Sanger or Illumina pipeline 1.8 Sample to Insight
6 Import Mate-Paired Data Select Mate_pair_1.fastq and Mate_pair_2.fastq files Check-on Paired reads in general option Select Mate-pair in Paired reads information Set Max distance = 3800 Set Min distance = 2000 Sample to Insight
7
8
9 Select the location to save the mate-pair reads Press Finish
10 Import Paired-end Data Check-on Paired reads in general option Select Paired-end in Paired reads information Set Max distance = 350 Set Min distance = 150 Select 2 files: Sample to Insight
11 Please create a new folder and organize your data list
12 QC on reads NGS Core Tools Create Sequencing QC Report Sample to Insight
13 About QC on reads Please confirm uncheck discard quality score when you import reads Process analysis file by file (you can use batch function) The quality score in CLC GWB is transformed to PHRED score Sample to Insight
14
15 Create report
16 Check-on items, save result
17
18
19 Please repeat the procedure to get the reads QC report for mate-paired reads and paired-end reads Sample to Insight
20 Trim reads NGS Core Tools Trim Sequences Sample to Insight
21
22 Set p value = 0.05 (default) Next Set discard reads below length = 15 N Sample to Insight
23 Check on Save broken pairs Save the result Next
24
25
26 De novo assembly De Novo Sequencing De Novo Assembly Sample to Insight
27 Uncheck Automatic word size, set word size = 45 Uncheck Automatic Bubble size, set bubble size = 9 Set min contig length = 1000 Sample to Insight
28 De Brujin Grpah for De novo Assembly *Word size = k-mer size e.g k=16 Sample to Insight
29
30
31 Bubble or sequencing systematic error
32
33
34
35 Scaffolding
36 Deployment for De Novo Assembly Fast mode : De novo contig sequences only Slow Mode : Take de novo assembled contigs as reference template, then use all reads to process reference mapping (re-mapping) + update contigs Sample to Insight
37
38 Check-on Create report, save the result Next Assign the location to save contigs Sample to Insight
39 BLAST For BLAST Extract consensus sequence of contigs Process BLAST Sample to Insight
40 Extract consensus sequences Open de novo contig table Sample to Insight
41 Select all contigs, press Extract Contigs
42 Process BLAST
43 Select the consensus sequence Next
44 Select query for Bacteria
45 Save the result, assign the location Press Finish
46 BLAST result Sample to Insight
47 Finding Genes Classical Sequence Analysis Nucleotide analysis find Ope Sample to Insight
48 Select extracted de novo contigs
49 Set minimum length of OR Assign start codon: AUG, C Sample to Insight
50 Create annotated sequence and save the result
51 Assign path to save the ORF finding result
52
53 Extract ORF sequence Go to Plug-ins Download Plug-ins Select Extract Annotations Press Download and Install Press close and restart the software Sample to Insight
54 Classical Sequence Analysis General Sequence Analysis Sample to Insight
55 Select annotated ORF sequences
56 Select Type as ORF
57 Assign saving path Finish
58
59 For more information Please welcome to Sample to Insight
Tutorial. Whole Metagenome Functional Analysis (beta) Sample to Insight. November 21, 2017
Whole Metagenome Functional Analysis (beta) November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com
More informationData Basics. Josef K Vogt Slides by: Simon Rasmussen Next Generation Sequencing Analysis
Data Basics Josef K Vogt Slides by: Simon Rasmussen 2017 Generalized NGS analysis Sample prep & Sequencing Data size Main data reductive steps SNPs, genes, regions Application Assembly: Compare Raw Pre-
More informationDe Novo Assembly of High-throughput Short Read Sequences
De Novo Assembly of High-throughput Short Read Sequences Chuming Chen Center for Bioinformatics and Computational Biology (CBCB) University of Delaware NECC Third Skate Genome Annotation Workshop May 23,
More informationDe Novo Transcript Discovery using Long and Short Reads
De Novo Transcript Discovery using Long and Short Reads December 4, 2018 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com
More informationGenome Assembly Software for Different Technology Platforms. PacBio Canu Falcon. Illumina Soap Denovo Discovar Platinus MaSuRCA.
Genome Assembly Software for Different Technology Platforms PacBio Canu Falcon 10x SuperNova Illumina Soap Denovo Discovar Platinus MaSuRCA Experimental design using Illumina Platform Estimate genome size:
More informationIntroduction to RNA sequencing
Introduction to RNA sequencing Bioinformatics perspective Olga Dethlefsen NBIS, National Bioinformatics Infrastructure Sweden November 2017 Olga (NBIS) RNA-seq November 2017 1 / 49 Outline Why sequence
More informationNGS developments in tomato genome sequencing
NGS developments in tomato genome sequencing 16-02-2012, Sandra Smit TATGTTTTGGAAAACATTGCATGCGGAATTGGGTACTAGGTTGGACCTTAGTACC GCGTTCCATCCTCAGACCGATGGTCAGTCTGAGAGAACGATTCAAGTGTTGGAAG ATATGCTTCGTGCATGTGTGATAGAGTTTGGTGGCCATTGGGATAGCTTCTTACC
More informationExperimental Design. Sequencing. Data Quality Control. Read mapping. Differential Expression analysis
-Seq Analysis Quality Control checks Reproducibility Reliability -seq vs Microarray Higher sensitivity and dynamic range Lower technical variation Available for all species Novel transcript identification
More informationQIAseq Targeted Panel Analysis Plugin USER MANUAL
QIAseq Targeted Panel Analysis Plugin USER MANUAL User manual for QIAseq Targeted Panel Analysis 1.1 Windows, macos and Linux June 18, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej
More informationWorkflow of de novo assembly
Workflow of de novo assembly Experimental Design Clean sequencing data (trim adapter and low quality sequences) Run assembly software for contiging and scaffolding Evaluation of assembly Several iterations:
More informationOutline. The types of Illumina data Methods of assembly Repeats Selecting k-mer size Assembly Tools Assembly Diagnostics Assembly Polishing
Illumina Assembly 1 Outline The types of Illumina data Methods of assembly Repeats Selecting k-mer size Assembly Tools Assembly Diagnostics Assembly Polishing 2 Illumina Sequencing Paired end Illumina
More informationGenomics AGRY Michael Gribskov Hock 331
Genomics AGRY 60000 Michael Gribskov gribskov@purdue.edu Hock 331 Computing Essentials Resources In this course we will assemble and annotate both genomic and transcriptomic sequence assemblies We will
More informationSequence Assembly and Alignment. Jim Noonan Department of Genetics
Sequence Assembly and Alignment Jim Noonan Department of Genetics james.noonan@yale.edu www.yale.edu/noonanlab The assembly problem >>10 9 sequencing reads 36 bp - 1 kb 3 Gb Outline Basic concepts in genome
More informationCGE Pipeline. Content 1. The Batch Upload 2. The Pipeline 3. The User System 4. The List Tool 5. The Map Tool 6. Exercises
CGE Pipeline Content 1. The Batch Upload 2. The Pipeline 3. The User System 4. The List Tool 5. The Map Tool 6. Exercises Jose Luis Bellod Cisneros PhD. Student Content 1. The Batch Upload 2. The Pipeline
More informationSanger vs Next-Gen Sequencing
Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics
More informationCGE Pipeline. Content 1. The User System 2. The Batch Upload 3. The Pipeline 4. The List Tool 5. The Map Tool 6. FuturePlans 7.
CGE Pipeline Content 1. The User System 2. The Batch Upload 3. The Pipeline 4. The List Tool 5. The Map Tool 6. FuturePlans 7. Q&A Jose Luis Bellod Cisneros PhD. Student Content 1. The Batch Upload 2.
More informationIntroduction to metagenome assembly. Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014
Introduction to metagenome assembly Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014 Sequencing specs* Method Read length Accuracy Million reads Time Cost per M 454
More informationQuality assessment and control of sequence data. Naiara Rodríguez-Ezpeleta
Quality assessment and control of sequence data Naiara Rodríguez-Ezpeleta Workshop on Genomics 2014 Quality control is important Some of the artefacts/problems that can be detected with QC Sequencing Sequence
More informationFrom Infection to Genbank
From Infection to Genbank How a pathogenic bacterium gets its genome to NCBI Torsten Seemann VLSCI - Life Sciences Computation Centre - Genomics Theme - Lab Meeting - Friday 27 April 2012 The steps 1.
More informationDe novo whole genome assembly
De novo whole genome assembly Qi Sun Bioinformatics Facility Cornell University Sequencing platforms Short reads: o Illumina (150 bp, up to 300 bp) Long reads (>10kb): o PacBio SMRT; o Oxford Nanopore
More informationHigh throughput sequencing technologies
High throughput sequencing technologies and NGS applications Mei-yeh Lu 呂美曄 High Throughput Sequencing Core Manager g g p q g g Academia Sinica 6/30/2011 Outlines Evolution of sequencing technologies Sanger
More informationRNA-Seq Module 2 From QC to differential gene expression.
RNA-Seq Module 2 From QC to differential gene expression. Ying Zhang Ph.D, Informatics Analyst Research Informatics Support System (RISS) MSI Apr. 24, 2012 RNA-Seq Tutorials Tutorial 1: Introductory (Mar.
More informationIntroduction to CGE tools
Introduction to CGE tools Pimlapas Leekitcharoenphon (Shinny) Research Group of Genomic Epidemiology, DTU-Food. WHO Collaborating Centre for Antimicrobial Resistance in Foodborne Pathogens and Genomics.
More informationNext Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
More informationI AM NOT A METAGENOMIC EXPERT. I am merely the MESSENGER. Blaise T.F. Alako, PhD EBI Ambassador
I AM NOT A METAGENOMIC EXPERT I am merely the MESSENGER Blaise T.F. Alako, PhD EBI Ambassador blaise@ebi.ac.uk Hubert Denise Alex Mitchell Peter Sterk Sarah Hunter http://www.ebi.ac.uk/metagenomics Blaise
More informationGenomics and Transcriptomics of Spirodela polyrhiza
Genomics and Transcriptomics of Spirodela polyrhiza Doug Bryant Bioinformatics Core Facility & Todd Mockler Group, Donald Danforth Plant Science Center Desired Outcomes High-quality genomic reference sequence
More informationNext Generation Sequences & Chloroplast Assembly. 8 June, 2012 Jongsun Park
Next Generation Sequences & Chloroplast Assembly 8 June, 2012 Jongsun Park Table of Contents 1 History of Sequencing Technologies 2 Genome Assembly Processes With NGS Sequences 3 How to Assembly Chloroplast
More informationDe Novo and Hybrid Assembly
On the PacBio RS Introduction The PacBio RS utilizes SMRT technology to generate both Continuous Long Read ( CLR ) and Circular Consensus Read ( CCS ) data. In this document, we describe sequencing the
More informationAssemblytics: a web analytics tool for the detection of assembly-based variants Maria Nattestad and Michael C. Schatz
Assemblytics: a web analytics tool for the detection of assembly-based variants Maria Nattestad and Michael C. Schatz Table of Contents Supplementary Note 1: Unique Anchor Filtering Supplementary Figure
More informationGenScale Scalable, Optimized and Parallel Algorithms for Genomics. Dominique LAVENIER
GenScale Scalable, Optimized and Parallel Algorithms for Genomics Dominique LAVENIER Context New Sequencing Technologies - NGS Exponential growth of genomic data Drastic decreasing of costs Emergence of
More informationThe Basics of Understanding Whole Genome Next Generation Sequence Data
The Basics of Understanding Whole Genome Next Generation Sequence Data Heather Carleton-Romer, MPH, Ph.D. ASM-CDC Infectious Disease and Public Health Microbiology Postdoctoral Fellow PulseNet USA Next
More informationDe novo meta-assembly of ultra-deep sequencing data
De novo meta-assembly of ultra-deep sequencing data Hamid Mirebrahim 1, Timothy J. Close 2 and Stefano Lonardi 1 1 Department of Computer Science and Engineering 2 Department of Botany and Plant Sciences
More informationCourse Presentation. Ignacio Medina Presentation
Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital
More informationIntroduction to DNA-Sequencing
informatics.sydney.edu.au sih.info@sydney.edu.au The Sydney Informatics Hub provides support, training, and advice on research data, analyses and computing. Talk to us about your computing infrastructure,
More informationDNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.
DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private
More informationBioinformatics Course AA 2017/2018 Tutorial 2
UNIVERSITÀ DEGLI STUDI DI PAVIA - FACOLTÀ DI SCIENZE MM.FF.NN. - LM MOLECULAR BIOLOGY AND GENETICS Bioinformatics Course AA 2017/2018 Tutorial 2 Anna Maria Floriano annamaria.floriano01@universitadipavia.it
More informationZika infected human samples
Lecture 16 RNA-seq Zika infected human samples Experimental design ZIKV-infected hnpcs 56 hours after ZIKA and mock infection in parallel cultures were used for global transcriptome analysis. RNA-seq libraries
More informationDe novo assembly in RNA-seq analysis.
De novo assembly in RNA-seq analysis. Joachim Bargsten Wageningen UR/PRI/Plant Breeding October 2012 Motivation Transcriptome sequencing (RNA-seq) Gene expression / differential expression Reconstruct
More informationDATA FORMATS AND QUALITY CONTROL
HTS Summer School 12-16th September 2016 DATA FORMATS AND QUALITY CONTROL Romina Petersen, University of Cambridge (rp520@medschl.cam.ac.uk) Luigi Grassi, University of Cambridge (lg490@medschl.cam.ac.uk)
More informationHigh-Throughput Bioinformatics: Re-sequencing and de novo assembly. Elena Czeizler
High-Throughput Bioinformatics: Re-sequencing and de novo assembly Elena Czeizler 13.11.2015 Sequencing data Current sequencing technologies produce large amounts of data: short reads The outputted sequences
More informationSupplementary Figure 1. Design of the control microarray. a, Genomic DNA from the
Supplementary Information Supplementary Figures Supplementary Figure 1. Design of the control microarray. a, Genomic DNA from the strain M8 of S. ruber and a fosmid containing the S. ruber M8 virus M8CR4
More informationTutorial. Bisulfite Sequencing. Sample to Insight. September 15, 2016
Bisulfite Sequencing September 15, 2016 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com Bisulfite
More informationFaction 2: Genome Assembly Lab and Preliminary Data
Faction 2: Genome Assembly Lab and Preliminary Data [Computational Genomics 2017] Christian Colon, Erisa Sula, David Lu, Tian Jin, Lijiang Long, Rohini Mopuri, Bowen Yang, Saminda Wijeratne, Harrison Kim
More informationshort read genome assembly Sorin Istrail CSCI1820 Short-read genome assembly algorithms 3/6/2014
1 short read genome assembly Sorin Istrail CSCI1820 Short-read genome assembly algorithms 3/6/2014 2 Genomathica Assembler Mathematica notebook for genome assembly simulation Assembler can be found at:
More informationQuality assessment and control of sequence data
Quality assessment and control of sequence data Naiara Rodríguez-Ezpeleta Workshop on Genomics 2015 Cesky Krumlov fastq format fasta Most basic file format to represent nucleotide or amino-acid sequences
More informationNEXT GENERATION SEQUENCING. Farhat Habib
NEXT GENERATION SEQUENCING HISTORY HISTORY Sanger Dominant for last ~30 years 1000bp longest read Based on primers so not good for repetitive or SNPs sites HISTORY Sanger Dominant for last ~30 years 1000bp
More informationGenome Assembly With Next Generation Sequencers
Genome Assembly With Next Generation Sequencers Personal Genomics Institute 3 May, 2011 Jongsun Park Table of Contents 1 Central Dogma and Omics Studies 2 History of Sequencing Technologies 3 Genome Assembly
More informationIllumina Sequencing Error Profiles and Quality Control
Illumina Sequencing Error Profiles and Quality Control RNA-seq Workflow Biological samples/library preparation Sequence reads FASTQC Adapter Trimming (Optional) Splice-aware mapping to genome Counting
More informationBioinformatics small variants Data Analysis. Guidelines. genomescan.nl
Next Generation Sequencing Bioinformatics small variants Data Analysis Guidelines genomescan.nl GenomeScan s Guidelines for Small Variant Analysis on NGS Data Using our own proprietary data analysis pipelines
More informationData Retrieval from GenBank
Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing
More informationAnalytics Behind Genomic Testing
A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical
More informationNGS sequence preprocessing. José Carbonell Caballero
NGS sequence preprocessing José Carbonell Caballero jcarbonell@cipf.es Contents Data Format Quality Control Sequence capture Fasta and fastq formats Sequence quality encoding Evaluation of sequence quality
More informationCSE182-L16. LW statistics/assembly
CSE182-L16 LW statistics/assembly Silly Quiz Who are these people, and what is the occasion? Genome Sequencing and Assembly Sequencing A break at T is shown here. Measuring the lengths using electrophoresis
More informationAnalysis Report. Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly
Analysis Report Institution : Macrogen Japan Name : Macrogen Japan Order Number : 1501APB-0004 Sample Name : 8380 Type of Analysis : De novo assembly 1 Table of Contents 1. Result of Whole Genome Assembly
More informationWhat will be covered?
What will be covered? 1. Annotation overview 2. Using the RAST family for genome annotation: Optimizing RAST for phages Command line/ Batch options 3. Introducing PATRIC and resources in development Therapeutic
More informationAssembling a Cassava Transcriptome using Galaxy on a High Performance Computing Cluster
Assembling a Cassava Transcriptome using Galaxy on a High Performance Computing Cluster Aobakwe Matshidiso Supervisor: Prof Chrissie Rey Co-Supervisor: Prof Scott Hazelhurst Next Generation Sequencing
More informationde novo metagenome assembly
1 de novo metagenome assembly Rayan Chikhi CNRS Univ. Lille 1 Formation metagenomique de novo metagenomics 2 de novo metagenomics Goal: biological sense out of sequencing data Techniques: 1. de novo assembly
More informationTranscriptome Assembly, Functional Annotation (and a few other related thoughts)
Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 23, 2017 Differential Gene Expression Generalized Workflow File Types
More informationFrancisco García Quality Control for NGS Raw Data
Contents Data formats Sequence capture Fasta and fastq formats Sequence quality encoding Quality Control Evaluation of sequence quality Quality control tools Identification of artifacts & filtering Practical
More informationIntroduction to NGS Analysis Tools
National Center for Emerging and Zoonotic Infectious Diseases Introduction to NGS Analysis Tools Heather Carleton, PhD, MPH Team Lead, Enteric Diseases Bioinformatics, Enteric Diseases Laboratory Branch,
More informationDetermining presence/absence threshold for your dataset
Determining presence/absence threshold for your dataset In PanCGHweb there are two ways to determine the presence/absence calling threshold. One is based on Receiver Operating Curves (ROC) generated for
More informationWorkflows and Pipelines for NGS analysis: Lessons from proteomics
Workflows and Pipelines for NGS analysis: Lessons from proteomics Conference on Applying NGS in Basic research Health care and Agriculture 11 th Sep 2014 Debasis Dash Where are the protein coding genes
More informationThe Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica
The Ensembl Database Dott.ssa Inga Prokopenko Corso di Genomica 1 www.ensembl.org Lecture 7.1 2 What is Ensembl? Public annotation of mammalian and other genomes Open source software Relational database
More informationIntroduction to the MiSeq
Introduction to the MiSeq 2011 Illumina, Inc. All rights reserved. Illumina, illuminadx, BeadArray, BeadXpress, cbot, CSPro, DASL, Eco, Genetic Energy, GAIIx, Genome Analyzer, GenomeStudio, GoldenGate,
More informationCDC s Advanced Molecular Detection (AMD) Sequence Data Analysis and Management
CDC s Advanced Molecular Detection (AMD) Sequence Data Analysis and Management Scott Sammons Technology Officer Office of Advanced Molecular Detection National Center for Emerging and Zoonotic Infectious
More informationMapping strategies for sequence reads
Mapping strategies for sequence reads Ernest Turro University of Cambridge 21 Oct 2013 Quantification A basic aim in genomics is working out the contents of a biological sample. 1. What distinct elements
More informationC3BI. VARIANTS CALLING November Pierre Lechat Stéphane Descorps-Declère
C3BI VARIANTS CALLING November 2016 Pierre Lechat Stéphane Descorps-Declère General Workflow (GATK) software websites software bwa picard samtools GATK IGV tablet vcftools website http://bio-bwa.sourceforge.net/
More informationMapping Next Generation Sequence Reads. Bingbing Yuan Dec. 2, 2010
Mapping Next Generation Sequence Reads Bingbing Yuan Dec. 2, 2010 1 What happen if reads are not mapped properly? Some data won t be used, thus fewer reads would be aligned. Reads are mapped to the wrong
More informationBioinformatics? Assembly, annotation, comparative genomics and a bit of phylogeny.
Bioinformatics? Assembly, annotation, comparative genomics and a bit of phylogeny stefano.gaiarsa@unimi.it Case study! it s a FAKE ONE, do not run away in panic! There s an outbreak of Mycoplasma bovis
More informationHuman Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased
Human Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased exponentially since the 1990s. In 2005, with the introduction
More informationFinishing Drosophila elegans Contig DELE This project aimed to finish the contig DELE from the F element (chromosome 6)
Ji Han (Ricky) Lee 2015. 02. 27 Bio 434W Professor Elgin Finishing Drosophila elegans Contig DELE8596013 Abstract This project aimed to finish the contig DELE8596013 from the F element (chromosome 6) of
More informationSUPPLEMENTARY MATERIAL FOR THE PAPER: RASCAF: IMPROVING GENOME ASSEMBLY WITH RNA-SEQ DATA
SUPPLEMENTARY MATERIAL FOR THE PAPER: RASCAF: IMPROVING GENOME ASSEMBLY WITH RNA-SEQ DATA Authors: Li Song, Dhruv S. Shankar, Liliana Florea Table of contents: Figure S1. Methods finding contig connections
More informationFinishing of DELE Drosophila elegans has been sequenced using Roche 454 pyrosequencing and Illumina
Sarah Swiezy Dr. Elgin, Dr. Shaffer Bio 434W 27 February 2015 Finishing of DELE8596009 Abstract Drosophila elegans has been sequenced using Roche 454 pyrosequencing and Illumina technology. DELE8596009,
More informationBioinformatics Tools and Pipelines for Real-Time Pathogen Surveillance
Bioinformatics Tools and Pipelines for Real-Time Pathogen Surveillance Errol Strain, Ph.D. Chief, Biostatistics Branch FDA/OFVM/CFSAN/OAO/DPHIA 3/24/2014 Overview 1. Validation and Proficiency Testing
More informationFinishing Drosophila grimshawi Fosmid Clone DGA23F17. Kenneth Smith Biology 434W Professor Elgin February 20, 2009
Finishing Drosophila grimshawi Fosmid Clone DGA23F17 Kenneth Smith Biology 434W Professor Elgin February 20, 2009 Smith 2 Abstract: My fosmid, DGA23F17, did not present too many challenges when I finished
More informationThe New Genome Analyzer IIx Delivering more data, faster, and easier than ever before. Jeremy Preston, PhD Marketing Manager, Sequencing
The New Genome Analyzer IIx Delivering more data, faster, and easier than ever before Jeremy Preston, PhD Marketing Manager, Sequencing Illumina Genome Analyzer: a Paradigm Shift 2000x gain in efficiency
More informationBioinformatic analysis of Illumina sequencing data for comparative genomics Part I
Bioinformatic analysis of Illumina sequencing data for comparative genomics Part I Dr David Studholme. 18 th February 2014. BIO1033 theme lecture. 1 28 February 2014 @davidjstudholme 28 February 2014 @davidjstudholme
More informationIntroduction to RNA-Seq in GeneSpring NGS Software
Introduction to RNA-Seq in GeneSpring NGS Software Dipa Roy Choudhury, Ph.D. Strand Scientific Intelligence and Agilent Technologies Learn more at www.genespring.com Introduction to RNA-Seq In a few years,
More informationConsensus Ensemble Approaches Improve De Novo Transcriptome Assemblies
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Computer Science and Engineering: Theses, Dissertations, and Student Research Computer Science and Engineering, Department
More informationSMRT Analysis Barcoding Overview (v6.0.0)
SMRT Analysis Barcoding Overview (v6.0.0) Introduction This document applies to PacBio RS II and Sequel Systems using SMRT Link v6.0.0. Note: For information on earlier versions of SMRT Link, see the document
More informationTruSPAdes: analysis of variations using TruSeq Synthetic Long Reads (TSLR)
tru TruSPAdes: analysis of variations using TruSeq Synthetic Long Reads (TSLR) Anton Bankevich Center for Algorithmic Biotechnology, SPbSU Sequencing costs 1. Sequencing costs do not follow Moore s law
More informationCBC Data Therapy. Metatranscriptomics Discussion
CBC Data Therapy Metatranscriptomics Discussion Metatranscriptomics Extract RNA, subtract rrna Sequence cdna QC Gene expression, function Institute for Systems Genomics: Computational Biology Core bioinformatics.uconn.edu
More informationTranscriptome Assembly and Evaluation, using Sequencing Quality Control (SEQC) Data
Transcriptome Assembly and Evaluation, using Sequencing Quality Control (SEQC) Data Introduction The US Food and Drug Administration (FDA) has coordinated the Sequencing Quality Control project (SEQC/MAQC-III)
More informationNext-generation sequencing technologies
Next-generation sequencing technologies NGS applications Illumina sequencing workflow Overview Sequencing by ligation Short-read NGS Sequencing by synthesis Illumina NGS Single-molecule approach Long-read
More informationEcole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech
GALAXY INITIATION A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech How does Next- Gen sequencing work? DNA fragmentation Size selection and clonal amplification Massive parallel sequencing ACCGTTTGCCG
More informationBIOINFORMATICS ORIGINAL PAPER
BIOINFORMATICS ORIGINAL PAPER Vol. 27 no. 21 2011, pages 2957 2963 doi:10.1093/bioinformatics/btr507 Genome analysis Advance Access publication September 7, 2011 : fast length adjustment of short reads
More informationNext Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms
Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality
More informationAnalysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer. Project XX1001. Customer Detail
Analysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer Project XX Customer Detail Table of Contents. Bioinformatics analysis pipeline...3.. Read quality check. 3.2. Read alignment...3.3.
More informationBioinformatics for Microbial Biology
Bioinformatics for Microbial Biology Chaochun Wei ( 韦朝春 ) ccwei@sjtu.edu.cn http://cbb.sjtu.edu.cn/~ccwei Fall 2013 1 Outline Part I: Visualization tools for microbial genomes Tools: Gbrowser Part II:
More informationSequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro
Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro Philip Morris International R&D, Philip Morris Products S.A., Neuchatel, Switzerland Introduction Nicotiana sylvestris
More information1.1 Post Run QC Analysis
Post Run QC Analysis 100 339 200 01 1. Post Run QC Analysis 1.1 Post Run QC Analysis Welcome to Pacific Biosciences' Post Run QC Analysis Overview. This training module will describe the workflow to assess
More informationThe goal of this project was to prepare the DEUG contig which covers the
Prakash 1 Jaya Prakash Dr. Elgin, Dr. Shaffer Biology 434W 10 February 2017 Finishing of DEUG4927010 Abstract The goal of this project was to prepare the DEUG4927010 contig which covers the terminal 99,279
More informationMate-pair library data improves genome assembly
De Novo Sequencing on the Ion Torrent PGM APPLICATION NOTE Mate-pair library data improves genome assembly Highly accurate PGM data allows for de Novo Sequencing and Assembly For a draft assembly, generate
More informationLecture 7. Next-generation sequencing technologies
Lecture 7 Next-generation sequencing technologies Next-generation sequencing technologies General principles of short-read NGS Construct a library of fragments Generate clonal template populations Massively
More informationUsing New ThiNGS on Small Things. Shane Byrne
Using New ThiNGS on Small Things Shane Byrne Next Generation Sequencing New Things Small Things NGS Next Generation Sequencing = 2 nd generation of sequencing 454 GS FLX, SOLiD, GAIIx, HiSeq, MiSeq, Ion
More informationMetagenomic 3C, full length 16S amplicon sequencing on Illumina, and the diabetic skin microbiome
Also: Sunaina Melissa Gardiner UTS Catherine Burke UTS Michael Liu UTS Chris Beitel UTS, UC Davis Matt DeMaere UTS Metagenomic 3C, full length 16S amplicon sequencing on Illumina, and the diabetic skin
More informationComparative Bioinformatics. BSCI348S Fall 2003 Midterm 1
BSCI348S Fall 2003 Midterm 1 Multiple Choice: select the single best answer to the question or completion of the phrase. (5 points each) 1. The field of bioinformatics a. uses biomimetic algorithms to
More informationFinishing of DFIC This project sought to finish DFIC , the terminal 45 kb of the Drosophila
Lin 1 Kevin Lin Bio 434W Dr. Elgin 26 February 2016 Finishing of DFIC6622001 Abstract This project sought to finish DFIC6622001, the terminal 45 kb of the Drosophila ficusphila dot chromosome. The initial
More informationFrom Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with
More informationInvestigation of Genomic Variation in the Rising Era of Individual Genome Sequence: A Primer on Some Available Datasets and Structures
Investigation of Genomic Variation in the Rising Era of Individual Genome Sequence: A Primer on Some Available Datasets and Structures September 28, 2015 A 10,000 Foot View Genomics Data at NCBI Organizational
More information