Lgr5 marks cycling, yet long-lived, hair follicle stem cells.

Size: px
Start display at page:

Download "Lgr5 marks cycling, yet long-lived, hair follicle stem cells."

Transcription

1 Lgr5 marks cycling, yet long-lived, hair follicle stem cells. Viljar Jaks 1,2,*, Nick Barker 3,*, Maria Kasper 1,*, Johan H. van Es 3, Hugo J. Snippert 3, Hans Clevers 3 and Rune Toftgård 1 1 Karolinska Institutet, Department of Biosciences and Nutrition, Novum, SE , Huddinge, Sweden 2 University of Tartu, Institute of Molecular and Cell Biology and Estonian Biocentre, Riia 23, 51010, Tartu, Estonia 3 Hubrecht Institute, Uppsalalaan 8, 3584CT Utrecht, the Netherlands * These authors contributed equally to this work

2 Supplementary Figure 1. The localization pattern and cell cycle distribution of Lgr5+ cells. The expression of Lgr5 can be first detected at E18.5 in the ORS of the growing HFs (a) as detected by X-gal staining of a skin sample obtained from an Lgr5 +/LacZ embryo. In vibrissae Lgr5 expression is limited to the lower part of the ORS (b) and outer cell layer of the vibrissae bulb (c). A similar Lgr5 vibrissae expression pattern is observed in an Lgr5-EGFP-Ires-CreERT2 mouse (d EGFP, e nuclear stain, f overlay). (g) Cell cycle analysis of keratinocytes isolated from telogen skin. Keratinocytes isolated from 8wk-old Lgr5 +/LacZ mice were stained with FDG for β-galactosidase activity, anti CD34-Alexa647 antibody and Vybrant DyeCycle Violet DNA-stain followed by flow cytometric analysis as shown in Fig. 2m. In deep telogen the majority of the cells in the CD34 + as well as in the Lgr5 high cell population reside in the G1 phase.

3 Supplementary Figure 2. Cre recombinase activity in the Lgr5-EGFP-Ires-CreERT2 skin is tightly controlled in spatial and temporal manner. (a) Serial sections of an Lgr5-EGFP-Ires-CreERT2/Rosa26R mouse skin sample at telogen. Mice were injected with 3mg of tamoxifen at P21 and skin samples were harvested 6 days later. Panels 1-6 represent serial sections of the same sample. Note that the labeled (blue) cells reside in the lower bulge and secondary germ. Panel 2 is identical to Fig. 4b. (b-d) Absence of Cre activity in Lgr5-EGFP-IresCreERT2 mice not treated with tamoxifen. X-gal stained dorsal skin samples obtained from a 280-day old Lgr5-EGFP-IresCreERT2/ROSA26-LacZ mouse not treated with tamoxifen revealed no spontaneous activation of the Cre recombinase. (b,c) - longitudinal and cross sections of anagen HFs, (d) - longitudinal section showing telogen HFs. (e) Serial sections of a Lgr5-EGFP-Ires-CreERT2/Rosa26-LacZ mouse skin sample at anagen. Mice were injected with 2mg of tamoxifen at P14 and skin samples were harvested 2 days post injection. Panels 1-3 represent serial sections of the same sample. Note that the labeled (blue) cells reside in the ORS but not in the bulge area at the upper part of the HF close to the sebaceous gland. Panel 1 is identical to Fig. 4p. (f) Serial sections of a dorsal skin sample from the low-dose tamoxifen injected Lgr5-EGFP-Ires-CreERT2/Rosa26-LacZ mice. Mice were injected with 0,5 mg of tamoxifen at P21 and skin samples were harvested 4 days post injection. Panels 1-6 represent serial sections of the same representative sample. Only one single labeled cell in the hair follicle was observed. Panel 3 is identical to Fig. 5a. Forty-four percent of the hair follicles contained labeled cells (n=64).

4 Supplementary Figure 3. Serial sections of a dorsal skin sample from the low-dose tamoxifen injected Lgr5- EGFP-Ires-CreERT2/Rosa26-LacZ mice traced for 6 days. Mice were injected with 0,5 mg of tamoxifen at P21 and skin samples were harvested 6 days post injection. Panels 1-24 represent serial sections of the same skin area. Note that the hair follicles contain either 1 or none labeled cell. Forty percent of the hair follicles contained labeled cell(s) (n=18). Note that the LacZ staining at the openings of the sebaceous glands is unspecific.

5 Supplementary Figure 4. The progeny of Lgr5+ cells can contribute to various compartments of anagen and telogen hair follicle. (a) Serial sections of a dorsal skin sample from the low-dose tamoxifen (0,5 mg) injected Lgr5- EGFP-Ires-CreERT2/Rosa26-LacZ mice traced for 8 days. Panels 1-12 represent serial sections of the same skin area. Labeled cells have formed single clones in the ORS and lower matrix of the 2 labeled anagen hair follicles shown. (b,c) The progeny of Lgr5 + keratinocytes repopulates the MTS24-expressing HF compartment. Samples were obtained from 7wk-old Lgr5-EGFP-Ires-CreERT2/ROSA26-LacZ mice injected with tamoxifen at P21. X-Gal and MTS24 doublepositive areas are indicated with brackets. Sections from skin areas containing catagen (b) and telogen (c) HFs are shown. (d,e) Hair follicles formed after transplantation of Lgr5 + cells contain sebocytes and sebaceous glands. (d) Eosin stained section showing a transplant hair follicle including an incompletely formed sebaceous gland (SG). (e) Haematoxylin-eosin stained transplant HF surrounded by sebocytes.

6 Supplementary Figure 5. Lineage tracing of Lgr5 + cells during telogen. Eight weeks-old Lgr5-EGFP- Ires-CreERT2/ROSA26-LacZ mice were injected with 2x 5 mg of tamoxifen. The initial labeling 6 days after tamoxifen injection was detected mainly in the lower part of the bulge or in the secondary germ area (a,b). Eight days later labeled cells were still predominantly detected in the lower bulge and secondary germ (c-e). A quantitation of representative skin areas of the HF labeling efficiency is given in Supplementary table 2a online.

7 Supplementary Table 1. Quantification of label retaining cells (LRCs) in telogen HFs of the Lgr5 +/LacZ mice and in the lineage traced Lgr5-EGFP-Ires- CreERT2/Rosa26-LacZ mice. Lgr5 +/LacZ mice were injected with BrdU at the indicated time intervals and skin tissue analyzed as shown in Fig. 2n-p. The number of LRCs and X-gal-positive cells in telogen HFs was counted and data collected from 3 independent experiments each including 2-3 mice. For lineage tracing Lgr5-EGFP- Ires-CreERT2/Rosa26-LacZ mice were injected with tamoxifen at P21 and for labeling of LRCs with BrdU at P3-5. Only HFs, which contained LRCs, were analyzed. The average values are given and the standard deviation is shown within brackets. Tamoxifen - - P21 BrdU P10-12 P3-5 P3-5 % of LRC in Lgr5 + cells 5,5 (3.9) 11 (5,8) 12,3 (5,8) % of Lgr5 + cells in LRC population 13,0 (4,9) 21 (1,6) 20,4 (6,7) HFs analyzed

8 Supplementary Table 2. Analysis of hair follicle labeling efficiency in skin samples taken from Lgr5-EGFP-Ires-CreERT2/Rosa26-LacZ mice. 2a: Lgr5-EGFP- Ires-CreERT2/Rosa26-LacZ mice were injected with tamoxifen at the age of 8 weeks. Skin samples were obtained 6 and 14 days post injection. Five serial sections of 5 different skin areas per sample were analyzed. Cells which could be identified in several serial sections were counted as one. Only those hair follicles, which had a visible bulge area and/or secondary germ were evaluated. The microphotographs of representative samples are shown in Supplementary Fig. 5 online. There is a slight increase in the labeling frequency of the hair follicles between days 6 and 14 potentially due to a longer time needed to reach detectable LacZ levels in telogen but no repopulation of compartments other than the lower bulge or secondary germ could be detected. 2b: Lgr5-EGFP-Ires-CreERT2/Rosa26-LacZ mice were injected with a low dose of tamoxifen (0,5 mg) at P21. A similar labeling efficiency is observed at all time points indicating that all labeled HFs were revealed 4 days after tamoxifen injection. The number of labeled cells per hair follicle increases slightly between days 4 and 6 after tamoxifen injection most likely due to cell proliferation occurring at the onset of anagen. In anagen HFs (Table 2b, 12 days post tamoxifen) the labeled cells formed larger clones due to the active proliferation, hence the number of labeled cells was not determined (N/A, not available). Table 2a Table 2b Days post tamoxifen Counted HFs Labeled cells/hf % of HFs % of HFs % of HFs % of HFs % of HFs N/A N/A N/A N/A N/A N/A N/A N/A Total labeled HFs (%)

9 Supplementary Table 3. Primer sequences used for qrt-pcr. Gene/oligo Sequence 5`- 3` Amplicon Length bp marbp f TGCACTCTCGCTTTCTGGAGGGTGT 193 marbp r AATGCAGATGGATCAGCCAGGAAGG mgapdh f GGTGTGAACGGATTTGGCCGTATTG 155 mgapdh r CCGTTGAATTTGCCGTGAGTGGAGT mhprt1 f CAACGGGGGACATAAAAGTTATTGGTGGA 158 mhprt1 r TGCAACCTTAACCATTTTGGGGCTGT mgli1 f CCCATAGGGTCTCGGGGTCTCAAAC 150 mgli1 r GGAGGACCTGCGGCTGACTGTGTAA mgli2 f TGAGGAGAGTGTGGAGGCCAGTAGCA 105 mgli2 r CCGGGGCTGGACTGACAAAGC msmo f GAGGAGCCATATTGCCCCAGGATGT 129 msmo r TCCGGCCCAAACGCTTCTCTAACTC msufu f GGAGCCCTCATCCCTCTCTGCCTAA 140 msufu r TACGGGTGTTCCTCAGTGGCAAAGG mptch1 f TGCTGTGCCTGTGGTCATCCTGATT 121 mptch1 r CAGAGCGAGCATAGCCCTGTGGTTC mlgr5 f CCAATGGAATAAAGACGACGGCAACA 128 mlgr5 r GGGCCTTCAGGTCTTCCTCAAAGTCA mklf5 f GGACTCATACGGGCGAGAAGCCCTAC 98 mklf5 r GTGCTTCCTGTAGTGGCGGGTCAG mtcf4 f CTACGGAGGGATGCTGGGCAATTCT 116 mtcf4 r TGGAGTTGATGTCTGCCGAGGAGTG mtcf3 f CTCAGCAGCAAATCCAAGAGGCAGAG 109 mtcf3 r TGGGAAGACGCAGGGCTATCACAAG mlhx2 f CCTACTACAACGGCGTGGGCACTGT 137 mlhx2 r GTCACGATCCAGGTGTTCAGCATCG msfrp1 f GCAAGCGAGTTTGCACTGAGGATGA 101 msfrp1 r GGCCCCAGCTTCAAGGGTTTCTTCT maxin2 f CAGGAGGATGCTGAAGGCTCAAAGC 127 maxin2 r CTCAAAAACTGCTCCGCAGGCAAAT mcd34 f CCTGATGAACCGTCGCAGTTGGAG 140 mcd34 r GGGTCACATTGGCCTTTCCCTGAGT mkrt15 f TGGACATCAAGACTCGGCTGGAACA 107 mkrt15 r ACCGCTGCTTCCTTCTCTGACACCA msca1 f TGCCCCTACCCTGATGGAGTCTGTG 104 msca1 r GGAGGGCAGATGGGTAAGCAAAGATTG

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature05574 SUPPLEMENTARY INFORMATION Supplementary Results Additional Materials and Methods Analysis of epidermal wholemounts and sections: Tail epidermis. The patterned organisation of tail

More information

Supplementary Figure 1. Wnt10a mutation causes aberrant molar tooth development and formation of an ectopic M4 molar. (a,b) Smaller molar teeth with

Supplementary Figure 1. Wnt10a mutation causes aberrant molar tooth development and formation of an ectopic M4 molar. (a,b) Smaller molar teeth with Supplementary Figure 1. Wnt10a mutation causes aberrant molar tooth development and formation of an ectopic M4 molar. (a,b) Smaller molar teeth with blunted cusp formation, and presence of an ectopic molar

More information

Very Long-term Self-renewal of Small Intestine, Colon, and Hair Follicles from Cycling Lgr5 +ve Stem Cells

Very Long-term Self-renewal of Small Intestine, Colon, and Hair Follicles from Cycling Lgr5 +ve Stem Cells Very Long-term Self-renewal of Small Intestine, Colon, and Hair Follicles from Cycling Lgr5 +ve Stem Cells N. BARKER,* J.H. VAN ES,* V. JAKS, M. KASPER, H. SNIPPERT,* R. TOFTGÅRD, AND H. CLEVERS* *Hubrecht

More information

Adult Stem Cells & Homeostasis

Adult Stem Cells & Homeostasis Adult Stem Cells & Homeostasis Developmental Biology 曾艺生化与细胞所 2014-4-28 Outline Stem cell and niche Tissue models for studying adult stem cells Experimental assays Adult stem cell & Cancer Adult stem cell

More information

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm

More information

Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene

Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene Developmental Cell, Volume 25 Supplemental Information Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, Wei Li, Ching Shang, Richard M. Chen,

More information

The non-muscle-myosin-ii heavy chain Myh9 mediates colitis-induced epithelium injury by restricting Lgr5+ stem cells

The non-muscle-myosin-ii heavy chain Myh9 mediates colitis-induced epithelium injury by restricting Lgr5+ stem cells Supplementary Information The non-muscle-myosin-ii heavy chain Myh9 mediates colitis-induced epithelium injury by restricting Lgr5+ stem cells Bing Zhao 1,3, Zhen Qi 1,3, Yehua Li 1,3, Chongkai Wang 2,

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/1/9/e1500973/dc1 Supplementary Materials for Pharmacologic inhibition of JAK-STAT signaling promotes hair growth Sivan Harel, Claire A. Higgins, Jane E. Cerise,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3575 In the format provided by the authors and unedited. Supplementary Figure 1 Validation of key reagents and assays a, top, IHC with antibody recognizing specifically

More information

Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like

Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like morphology in co-culture with mouse embryonic feeder fibroblasts

More information

Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM

Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM of Cx3cr1 GFP/+ mice related to Fig. 1a. MDP was defined

More information

Galactosidase staining of the skin of heterozygous (ColI-Cre x RBP-J loxp/wt ) (+/-) (A) and

Galactosidase staining of the skin of heterozygous (ColI-Cre x RBP-J loxp/wt ) (+/-) (A) and Suppl. Figure 1. ColI-Cre transgene activity in RBP-Jk loxp x R26R mice. (A and B) - Galactosidase staining of the skin of heterozygous (ColI-Cre x RBP-J loxp/wt ) (+/-) (A) and homozygous (ColI-Cre x

More information

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated

More information

Hopx expression defines a subset of multipotent hair follicle stem cells and a progenitor population primed to give rise to K6 + niche cells

Hopx expression defines a subset of multipotent hair follicle stem cells and a progenitor population primed to give rise to K6 + niche cells AND STEM CELLS RESEARCH ARTICLE 1655 Development 140, 1655-1664 (2013) doi:10.1242/dev.093005 2013. Published by The Company of Biologists Ltd Hopx expression defines a subset of multipotent hair follicle

More information

Supplementary Figure 1. Antigens generated for mab development (a) K9M1P1-mIgG and hgh-k9m1p1 antigen (~37 kda) expression verified by western blot

Supplementary Figure 1. Antigens generated for mab development (a) K9M1P1-mIgG and hgh-k9m1p1 antigen (~37 kda) expression verified by western blot Supplementary Figure 1. Antigens generated for mab development (a) K9M1P1-mIgG and hgh-k9m1p1 antigen (~37 kda) expression verified by western blot (vector: ~25 kda). (b) Silver staining was used to assess

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Fig. S1. Specificity of perilipin antibody in SAT compared to various organs. (A) Images of SAT at E18.5 stained with perilipin and CD31 antibody. Scale bars: 100 μm. SAT stained

More information

Supplemental Information Inventory

Supplemental Information Inventory Cell Stem Cell, Volume 6 Supplemental Information Distinct Hematopoietic Stem Cell Subtypes Are Differentially Regulated by TGF-β1 Grant A. Challen, Nathan C. Boles, Stuart M. Chambers, and Margaret A.

More information

Theoretical cloning project

Theoretical cloning project Theoretical cloning project Needed to get credits Make it up yourself, don't copy Possible to do in groups of 2-4 students If you need help or an idea, ask! If you have no idea what to clone, I can give

More information

Supplementary Figure 1. Isolation of GFPHigh cells.

Supplementary Figure 1. Isolation of GFPHigh cells. Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding

More information

Supplementary Figure 1. Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings.

Supplementary Figure 1. Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings. Supplementary Figure 1 Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings. (left) Representative bright-field images of wild type (wt), heterozygous (het)

More information

Nature Medicine doi: /nm.2548

Nature Medicine doi: /nm.2548 Supplementary Table 1: Genotypes of offspring and embryos from matings of Pmm2 WT/F118L mice with Pmm2 WT/R137H mice total events Pmm2 WT/WT Pmm2 WT/R137H Pmm2 WT/F118L Pmm2 R137H/F118L offspring 117 (100%)

More information

Myofibroblasts in kidney fibrosis. LeBleu et al.

Myofibroblasts in kidney fibrosis. LeBleu et al. Origin and Function of Myofibroblasts in Kidney Fibrosis Valerie S. LeBleu, Gangadhar Taduri, Joyce O Connell, Yingqi Teng, Vesselina G. Cooke, Craig Woda, Hikaru Sugimoto and Raghu Kalluri Supplementary

More information

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). 1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well

More information

Multiple layers of B cell memory with different effector functions. Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos,

Multiple layers of B cell memory with different effector functions. Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos, Multiple layers of B cell memory with different effector functions Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos, Jérome Mégret, Sébastien Storck, Claude-Agnès Reynaud & Jean-Claude

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3164 Supplementary Figure 1 Validation of effective Gnas deletion and epithelial thickness. a, Representative genotyping in mice treated or not with tamoxifen to show Gnas deletion. To

More information

Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse

Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse tail DNA. Primers were designed to detect Gna13-WT/f (~400bp/470bp)

More information

Hair follicle renewal: authentic morphogenesis that depends on a complex progression of stem cell lineages

Hair follicle renewal: authentic morphogenesis that depends on a complex progression of stem cell lineages RESEARCH ARTICLE 569 Development 137, 569-577 (2010) doi:10.1242/dev.044123 2010. Published by The Company of Biologists Ltd Hair follicle renewal: authentic morphogenesis that depends on a complex progression

More information

Transgenesis. Stable integration of foreign DNA into host genome Foreign DNA is passed to progeny germline transmission

Transgenesis. Stable integration of foreign DNA into host genome Foreign DNA is passed to progeny germline transmission Transgenic Mice Transgenesis Stable integration of foreign DNA into host genome Foreign DNA is passed to progeny germline transmission integrates into all cells including sperm or egg Knockin mice DNA

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12783 Bone marrow transplantation experiments While we confirmed that CD45+ bone marrow derived cells contributed to the dermis during normal homeostasis and wound healing (Fig. E9d,

More information

Hair follicles: Our bodies are protected by a magnificent. bulging with stem cells. Hilda Amalia Pasolli

Hair follicles: Our bodies are protected by a magnificent. bulging with stem cells. Hilda Amalia Pasolli Hair follicles: bulging with stem cells Hilda Amalia Pasolli Our bodies are protected by a magnificent cover, the epidermis. Despite being only micrometers thick, it is a formidable seal of our body surface,

More information

TISSUE-SPECIFIC STEM CELLS

TISSUE-SPECIFIC STEM CELLS TISSUE-SPECIFIC STEM CELLS Wnt7b Is an Important Intrinsic Regulator of Hair Follicle Stem Cell Homeostasis and Hair Follicle Cycling EVE KANDYBA, a,b KRZYSZTOF KOBIELAK a,b Key Words. Hair follicle stem

More information

F4/80, CD11b, Gr-1, NK1.1, CD3, CD4, CD8 and CD19. A-antigen was detected with FITCconjugated

F4/80, CD11b, Gr-1, NK1.1, CD3, CD4, CD8 and CD19. A-antigen was detected with FITCconjugated SDC MATERIALS AND METHODS Flow Cytometric Detection of A-Antigen Expression Single cell suspensions were prepared from bone marrow, lymph node and spleen. Peripheral blood was obtained and erythrocytes

More information

Redefining the structure of the hair follicle by 3D clonal analysis

Redefining the structure of the hair follicle by 3D clonal analysis AND STEM CELLS RESEARCH ARTICLE 3741 Development 139, 3741-3751 (2012) doi:10.1242/dev.081091 2012. Published by The Company of Biologists Ltd Redefining the structure of the hair follicle by 3D clonal

More information

Lgr5 + Gastric Stem Cells Divide Symmetrically to Effect Epithelial Homeostasis in the Pylorus

Lgr5 + Gastric Stem Cells Divide Symmetrically to Effect Epithelial Homeostasis in the Pylorus Cell Reports Report Lgr5 + Gastric Stem Cells Divide Symmetrically to Effect Epithelial Homeostasis in the Pylorus Marc Leushacke, 1 Annie Ng, 1 Joerg Galle, 2 Markus Loeffler, 3 and Nick Barker 1,4,5,

More information

Supplementary Figure 1 A green: cytokeratin 8

Supplementary Figure 1 A green: cytokeratin 8 Supplementary Figure 1 A green: cytokeratin 8 green: α-sma red: α-sma blue: DAPI blue: DAPI Panc-1 Panc-1 Panc-1+hPSC Panc-1+hPSC monoculture coculture B Suppl. Figure 1: A, Immunofluorescence staining

More information

88.7 <GFP-A>: EGFP GFP. Null. % of Cells! <APC-A> B220!

88.7 <GFP-A>: EGFP GFP. Null. % of Cells! <APC-A> B220! B. C. 1 Cell Number (X18) A. % of Cells % of Max 8 Con 6 4 88.7 1 13 14 : EGFP 4 6 4 1 WT 8 % of% ofcells Max 6 6 4 G. 1 13 B Hdac3-/- 14 15 1 13 14 15 Ter119 Ly6C Wild type WT 4

More information

Title. Author(s)Tomita, Y.; Akiyama, M.; Shimizu, H. CitationJournal of Dermatological Science, 43(2): Issue Date Doc URL.

Title. Author(s)Tomita, Y.; Akiyama, M.; Shimizu, H. CitationJournal of Dermatological Science, 43(2): Issue Date Doc URL. Title PDGF isoforms induce and maintain anagen phase of mu Author(s)Tomita, Y.; Akiyama, M.; Shimizu, H. CitationJournal of Dermatological Science, 43(2): 105-115 Issue Date 2006-08 Doc URL http://hdl.handle.net/2115/14708

More information

Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information

Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information 1. Supplementary Figure S1-S10: Pages 2-11 2. Supplementary References:

More information

Hair Follicle Dermal Stem Cells Regenerate the Dermal Sheath, Repopulate the Dermal Papilla, and Modulate Hair Type

Hair Follicle Dermal Stem Cells Regenerate the Dermal Sheath, Repopulate the Dermal Papilla, and Modulate Hair Type Article Hair Follicle Dermal Stem Cells Regenerate the Dermal Sheath, Repopulate the Dermal Papilla, and Modulate Hair Type Waleed Rahmani, 1 Sepideh Abbasi, 1 Andrew Hagner, 1 Eko Raharjo, 1 Ranjan Kumar,

More information

Supplementary Figure S1: (A) Schematic representation of the Jarid2 Flox/Flox

Supplementary Figure S1: (A) Schematic representation of the Jarid2 Flox/Flox Supplementary Figure S1: (A) Schematic representation of the Flox/Flox locus and the strategy used to visualize the wt and the Flox/Flox mrna by PCR from cdna. An example of the genotyping strategy is

More information

Supplementary Data. Flvcr1a TCTAAGGCCCAGTAGGACCC GGCCTCAACTGCCTGGGAGC AGAGGGCAACCTCGGTGTCC

Supplementary Data. Flvcr1a TCTAAGGCCCAGTAGGACCC GGCCTCAACTGCCTGGGAGC AGAGGGCAACCTCGGTGTCC Supplementary Data Supplementary Materials and Methods Measurement of reactive oxygen species accumulation in fresh intestinal rings Accumulation of reactive oxygen species in fresh intestinal rings was

More information

Percent survival. Supplementary fig. S3 A.

Percent survival. Supplementary fig. S3 A. Supplementary fig. S3 A. B. 100 Percent survival 80 60 40 20 Ml 0 0 100 C. Fig. S3 Comparison of leukaemia incidence rate in the triple targeted chimaeric mice and germline-transmission translocator mice

More information

DRG Pituitary Cerebral Cortex

DRG Pituitary Cerebral Cortex Liver Spinal cord Pons Atg5 -/- Atg5 +/+ DRG Pituitary Cerebral Cortex WT KO Supplementary Figure S1 Ubiquitin-positive IBs accumulate in Atg5 -/- tissues. Atg5 -/- neonatal tissues were fixed and decalcified.

More information

Supplementary Figure 1. Western analysis of p-smad1/5/8 of differentiated hescs.

Supplementary Figure 1. Western analysis of p-smad1/5/8 of differentiated hescs. kda 65 45 45 35 Supplementary Figure 1. Western analysis of p-smad1/5/8 of differentiated hescs. H9 hescs were differentiated with or without BMP4+BMP8A and cell lysates were collected for Western analysis

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed

More information

Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).

Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences). Mice C57BL/6-Ly5.1 or -Ly5.2 congenic mice were used for LSK transduction and competitive repopulation assays. Animal care was in accordance with the guidelines of Keio University for animal and recombinant

More information

Nature Biotechnology: doi: /nbt.4166

Nature Biotechnology: doi: /nbt.4166 Supplementary Figure 1 Validation of correct targeting at targeted locus. (a) by immunofluorescence staining of 2C-HR-CRISPR microinjected embryos cultured to the blastocyst stage. Embryos were stained

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figures Supplementary Figure 1. qrt-pcr analysis of the expression of candidate factors including SOX2, MITF, PAX3, DLX5, FOXD3, LEF1, MSX1, PAX6, SOX2 and SOX9

More information

Supplemental Figures Supplemental Figure 1

Supplemental Figures Supplemental Figure 1 Supplemental Figures Supplemental Figure 1 The de novo and salvage purine synthesis pathways are shown converging on GMP synthesis (A). Enzymes and intermediates not involved in MPA action and/or guanosine

More information

(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower

(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that

More information

A Survey of Genetic Methods

A Survey of Genetic Methods IBS 8102 Cell, Molecular, and Developmental Biology A Survey of Genetic Methods January 24, 2008 DNA RNA Hybridization ** * radioactive probe reverse transcriptase polymerase chain reaction RT PCR DNA

More information

Supporting Information

Supporting Information Supporting Information Ren et al. 10.1073/pnas.1409064111 SI Materials and Methods Lineage Tracing. Lgr6-EGFP-ires-CreERT2 mice were crossed with Rosa26-tdTomato mice to generate Lgr6 +/ ; Rosa-tdTomato

More information

Morphogenesis and Renewal of Hair Follicles from Adult Multipotent Stem Cells

Morphogenesis and Renewal of Hair Follicles from Adult Multipotent Stem Cells Cell, Vol. 104, 233 245, January 26, 2001, Copyright 2001 by Cell Press Morphogenesis and Renewal of Hair Follicles from Adult Multipotent Stem Cells Hideo Oshima,* Ariane Rochat,* Cécile Kedzia,* Koji

More information

A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity

A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity Peng Li 1,2, Fang Du 1, Larra W. Yuelling 1, Tiffany Lin 3, Renata E. Muradimova 1, Rossella Tricarico

More information

Supplemental Table/Figure Legends

Supplemental Table/Figure Legends MiR-26a is required for skeletal muscle differentiation and regeneration in mice Bijan K. Dey, Jeffrey Gagan, Zhen Yan #, Anindya Dutta Supplemental Table/Figure Legends Suppl. Table 1: Effect of overexpression

More information

Quiescent Tissue Stem Cells Evade Immune Surveillance

Quiescent Tissue Stem Cells Evade Immune Surveillance Article Quiescent Tissue Stem Cells Evade Immune Surveillance Graphical Abstract Gut Intestinal crypts MHC-I + epitope T cell Authors Judith Agudo, Eun Sook Park, Samuel A. Rose,..., Alessia Baccarini,

More information

Dynamics of Hair Follicle Morphogenesis and Skin Homeostasis. Arlee L. Mesler

Dynamics of Hair Follicle Morphogenesis and Skin Homeostasis. Arlee L. Mesler Dynamics of Hair Follicle Morphogenesis and Skin Homeostasis by Arlee L. Mesler A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Cellular and

More information

SUPPLEMENTAL MATERIAL

SUPPLEMENTAL MATERIAL SUPPLEMENTAL MATERIAL MATERIALS AND METHODS Generation of TSPOΔ/Δ murine embryonic fibroblasts Embryos were harvested from 13.5-day pregnant TSPOfl/fl mice. After dissection to eviscerate and remove the

More information

Stem cell: a cell capable of 1) tissue plasticity - make different cell types 2) infinite self renewal through asymmetric division

Stem cell: a cell capable of 1) tissue plasticity - make different cell types 2) infinite self renewal through asymmetric division Stem cell: a cell capable of 1) tissue plasticity - make different cell types 2) infinite self renewal through asymmetric division stem cell stem cell skin muscle nerve Properties of STEM cells Plasticity

More information

Mid-term review. Recitation5 03/31/2014. Stem Cell Biology and Function W4193 1

Mid-term review. Recitation5 03/31/2014. Stem Cell Biology and Function W4193 1 Mid-term review Recitation5 03/31/2014 Stem Cell Biology and Function W4193 1 What to expect in the midterm2 It will be all so far but mainly whatever was NOT covered by the previous mid-term- not a huge

More information

Development 142: doi: /dev : Supplementary Material

Development 142: doi: /dev : Supplementary Material Development 142: doi:1.42/dev.11687: Supplementary Material Figure S1 - Relative expression of lineage markers in single ES cell and cardiomyocyte by real-time quantitative PCR analysis. Single ES cell

More information

Figure S1. Schematic of myeloid lineage reporter mouse model used in this study.

Figure S1. Schematic of myeloid lineage reporter mouse model used in this study. Supplementary Figure Legends Figure S1. Schematic of myeloid lineage reporter mouse model used in this study. (A) The Lyzs-Cre mouse was crossed with Gt(ROSA)26Sor tm1(eyfp)cos/ J mice to label cells expressing

More information

TISSUE-SPECIFIC STEM CELLS

TISSUE-SPECIFIC STEM CELLS TISSUE-SPECIFIC STEM CELLS Cell Cycle Heterogeneity in the Small Intestinal Crypt and Maintenance of Genome Integrity STEVEN C. PRUITT, AMY FREELAND, ANGELA KUDLA Department of Molecular and Cellular Biology,

More information

Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl

Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl, loxp sites flanking exons 3-6 (red arrowheads) were introduced into

More information

Six-week-old male mice were allowed to adapt to their new environment for 1 week and were

Six-week-old male mice were allowed to adapt to their new environment for 1 week and were Supplemental Materials & Methods In vivo experimentation Six-week-old male mice were allowed to adapt to their new environment for 1 week and were used to confirm the synergistic effect of PTD-DBM and

More information

Revised: RG-RV2 by Fukuhara et al.

Revised: RG-RV2 by Fukuhara et al. Supplemental Figure 1 The generation of Spns2 conditional knockout mice. (A) Schematic representation of the wild type Spns2 locus (Spns2 + ), the targeted allele, the floxed allele (Spns2 f ) and the

More information

bronchial epithelial cells (I). Bronchi are outlined with dashed line. Scale bars = 25 µm, if not

bronchial epithelial cells (I). Bronchi are outlined with dashed line. Scale bars = 25 µm, if not Supplemental Figure S1: ronchial epithelial cell polarity and integrity is maintained in bronchi. (A-E) Staining for selected markers of bronchial cell differentiation and intracellular compartments is

More information

DB3230 Midterm 1 11/15/2013 Name:

DB3230 Midterm 1 11/15/2013 Name: 1. (15 pts) Nuclear cloning by John Gurdon was rarely successful in producing fertile adults. Why not? Explain why serial transplantation improves the success rate. What else could you do to improve the

More information

Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail

Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail were stained with propidium iodide (PI), anti-cd45 (FITC),

More information

Supplementary Information. Conversion of vascular endothelial cells into multipotent stem-like cells

Supplementary Information. Conversion of vascular endothelial cells into multipotent stem-like cells Supplementary Information Conversion of vascular endothelial cells into multipotent stem-like cells Damian Medici 1, Eileen M. Shore 2,3,4, Vitali Y. Lounev 2,4, Frederick S. Kaplan 2,4,5, Raghu Kalluri

More information

WT Day 90 after injections

WT Day 90 after injections Supplementary Figure 1 a Day 1 after injections Day 9 after injections Klf5 +/- Day 1 after injections Klf5 +/- Day 9 after injections BLM PBS b Day 1 after injections Dermal thickness (μm) 3 1 Day 9 after

More information

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA

More information

SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES

SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Generation of inducible BICD2 knock-out mice. A) The mouse BICD2 locus and gene targeting constructs. To generate an inducible Bicd2

More information

The Epidermis Comprises Autonomous Compartments Maintained by Distinct Stem Cell Populations

The Epidermis Comprises Autonomous Compartments Maintained by Distinct Stem Cell Populations Article The Epidermis Comprises Autonomous Compartments Maintained by Distinct Stem Cell Populations Mahalia E. Page, 1,2 Patrick Lombard, 1,3 Felicia Ng, 1,3 Berthold Göttgens, 1,3 and Kim B. Jensen 1,2,4,

More information

Supplementary Figure S1. Hoechst. cells/field. Myogenin. % of Myogenin+ cells. 0 h chase CONTROL. BrdU. 72 h chase. CONTROL BrdU CONTROL BrdU

Supplementary Figure S1. Hoechst. cells/field. Myogenin. % of Myogenin+ cells. 0 h chase CONTROL. BrdU. 72 h chase. CONTROL BrdU CONTROL BrdU Hoechst Myogenin amyhc 24 h 48 h 72 h b cells/field 50 40 30 20 10 0 24h 48h 72h h after plating (4 days growth+ t) c e CONTROL 0 h chase % of Myogenin+ cells h after plating (4 days growth+ t) CONTROL

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION a before amputation regeneration regenerated limb DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS developmental origin: lateral plate mesoderm presomitic mesoderm

More information

TISSUE-SPECIFIC STEM CELLS

TISSUE-SPECIFIC STEM CELLS TISSUE-SPECIFIC STEM CELLS Expression Analysis of the Stem Cell Marker Pw1/Peg3 Reveals a CD34 Negative Progenitor Population in the Hair Follicle VANESSA BESSON, a SERGIY KYRYACHENKO, a PEGGY JANICH,

More information

Mouse Engineering Technology. Musculoskeletal Research Center 2016 Summer Educational Series David M. Ornitz Department of Developmental Biology

Mouse Engineering Technology. Musculoskeletal Research Center 2016 Summer Educational Series David M. Ornitz Department of Developmental Biology Mouse Engineering Technology Musculoskeletal Research Center 2016 Summer Educational Series David M. Ornitz Department of Developmental Biology Core service and new technologies Mouse ES core Discussions

More information

MLN8237 induces proliferation arrest, expression of differentiation markers and

MLN8237 induces proliferation arrest, expression of differentiation markers and Supplementary Figure Legends Supplementary Figure 1 827 induces proliferation arrest, expression of differentiation markers and polyploidization of a human erythroleukemia cell line with the activating

More information

Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer

Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer SUPPLEMENTAL METHODS Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer For Celigo experiments, 0.1 ml containing 5 x 10 4 cells was seeded into 96 well plates for 30 min

More information

Ex Vivo Imaging and Genetic Manipulation of Mouse Hair Follicle Bulge Stem Cells

Ex Vivo Imaging and Genetic Manipulation of Mouse Hair Follicle Bulge Stem Cells Methods in Molecular Biology DOI 10.1007/7651_2018_136 Springer Science+Business Media New York 2018 Ex Vivo Imaging and Genetic Manipulation of Mouse Hair Follicle Bulge Stem Cells Daniel Haensel, Melissa

More information

Dlx3 is a crucial regulator of hair follicle differentiation and cycling

Dlx3 is a crucial regulator of hair follicle differentiation and cycling AND DISEASE RESEARCH ARTICLE 3149 Development 135, 3149-3159 (2008) doi:10.1242/dev.022202 Dlx3 is a crucial regulator of hair follicle differentiation and cycling Joonsung Hwang 1, Taraneh Mehrani 1,

More information

Supplementary Figure 1. Phenotype and genotype of cultured and transplanted S1 KCST (A) Brightfield and mcherry fluorescence images of the spheres

Supplementary Figure 1. Phenotype and genotype of cultured and transplanted S1 KCST (A) Brightfield and mcherry fluorescence images of the spheres Supplementary Figure 1. Phenotype and genotype of cultured and transplanted S1 KCST (A) Brightfield and mcherry fluorescence images of the spheres generated from the CD133-positive cells infected with

More information

Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells

Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Supplementary Data Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Mouse induced pluripotent stem cells (ipscs) were cultured

More information

King s Research Portal

King s Research Portal King s Research Portal DOI: 10.1038/ncb3532 Document Version Peer reviewed version Link to publication record in King's Research Portal Citation for published version (APA): Donati, G., Rognoni, E., Hiratsuka,

More information

Supplemental Material: Rev1 promotes replication through UV lesions in conjunction with DNA

Supplemental Material: Rev1 promotes replication through UV lesions in conjunction with DNA Supplemental Material: Rev1 promotes replication through UV lesions in conjunction with DNA polymerases,, and, but not with DNA polymerase Jung-Hoon Yoon, Jeseong Park, Juan Conde, Maki Wakamiya, Louise

More information

The Tortoise and the Hair: Slow-Cycling Cells in the Stem Cell Race

The Tortoise and the Hair: Slow-Cycling Cells in the Stem Cell Race Leading Edge Review The Tortoise and the Hair: Slow-Cycling Cells in the Stem Cell Race Elaine Fuchs 1, * 1 Howard Hughes Medical Institute, Laboratory of Mammalian Cell Biology and Development, The Rockefeller

More information

The cell-surface marker MTS24 identifies a novel population of follicular keratinocytes with characteristics of progenitor cells

The cell-surface marker MTS24 identifies a novel population of follicular keratinocytes with characteristics of progenitor cells AND DISEASE 3027 Development 133, 3027-3037 (2006) doi:10.1242/dev.02443 The cell-surface marker MTS24 identifies a novel population of follicular keratinocytes with characteristics of progenitor cells

More information

Supplemental Information

Supplemental Information Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure

More information

Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated

Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated Supplementary Figure Legends Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated with either vehicle (left; n=3) or CCl 4 (right; n=3) were co-immunostained for NRP-1 (green)

More information

Supplementary Materials for

Supplementary Materials for www.advances.sciencemag.org/cgi/content/full/1/7/e1500454/dc1 Supplementary Materials for CRISPR-Cas9 delivery to hard-to-transfect cells via membrane deformation Xin Han, Zongbin Liu, Myeong chan Jo,

More information

7.03 Final Exam Review 12/19/2006

7.03 Final Exam Review 12/19/2006 7.03 Final Exam Review 12/19/2006 1. You have been studying eye color mutations in Drosophila, which normally have red eyes. White eyes is a recessive mutant trait that is caused by w, a mutant allele

More information

Tcf3 and Lef1 regulate lineage differentiation of multipotent stem cells in skin

Tcf3 and Lef1 regulate lineage differentiation of multipotent stem cells in skin Tcf3 and Lef1 regulate lineage differentiation of multipotent stem cells in skin Bradley J. Merrill, 2 Uri Gat, 1,2 RamanujDasGupta, and Elaine Fuchs 3 Howard Hughes Medical Institute, Department of Molecular

More information

Supplementary material

Supplementary material Supplementary material Tracking mesenchymal stem cell contributions to regeneration in an immunocompetent cartilage regeneration model Daniela Zwolanek, María Satué, Verena Proell, Josè R. Godoy, Kathrin

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Drosophila dyskerin is required for somatic stem cell homeostasis Rosario Vicidomini 1,2*, Arianna Petrizzo 1, Annamaria di Giovanni 1, Laura Cassese 1, Antonella Anna Lombardi

More information

Outline. Growth in the ISC Field 350. Review historical literature relating to intestinal

Outline. Growth in the ISC Field 350. Review historical literature relating to intestinal The search for intestinal stem cells: lessons learned Susan J. Henning PhD Center for Gastrointestinal Biology and Disease UNC Chapel Hill NASPGHAN State of the Art lecture October 2013 Outline Review

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1: Phenotypically defined hematopoietic stem and progenitor cell populations show distinct mitochondrial activity and mass. (A) Isolation by FACS of commonly

More information

Supplementary Figure 1. Generation of B2M -/- ESCs. Nature Biotechnology: doi: /nbt.3860

Supplementary Figure 1. Generation of B2M -/- ESCs. Nature Biotechnology: doi: /nbt.3860 Supplementary Figure 1 Generation of B2M -/- ESCs. (a) Maps of the B2M alleles in cells with the indicated B2M genotypes. Probes and restriction enzymes used in Southern blots are indicated (H, Hind III;

More information

File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:

File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. dcas9-mq1 fusion protein induces de novo

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. ZBTB20 expression in the developing DRG. ZBTB20 expression in the developing DRG was detected by immunohistochemistry using anti-zbtb20 antibody 9A10 on

More information