SUPPLEMENTARY INFORMATION

Size: px
Start display at page:

Download "SUPPLEMENTARY INFORMATION"

Transcription

1 SUPPLEMENTARY INFORMATION DOI: /ncb3575 In the format provided by the authors and unedited. Supplementary Figure 1 Validation of key reagents and assays a, top, IHC with antibody recognizing specifically Ldha (same as used in Fig 1a). bottom, IHC with antibody recognizing multiple isoforms of Ldh protein. Scale bars indicate 20 micrometers. b, the sorting strategy employed to isolate two populations of cells from the bulge. This particular sort was used to isolate the protein samples shown by western blot in Fig 1b. c, Validation of colorimetric Ldh enzyme activity assay. The highest Ldh enzyme activity was observed in HFSC bulge and in the muscle. Activity indicated by purple stain; pink color is nuclear fast red counterstain. In absence of substrate lactate there was no detectable activity (purple stain). right, Additional validation of colorimetric Ldh enzyme activity assay. Enzyme activity inhibited by treating skin with HCl before addition of staining solution with substrate lactate. No Ldh activity (purple stain) detected. Skin in which enzyme activity is not inhibited by Hydrochloric Acid (HCl) shows highest Ldh enzyme activity in HFSC bulge and in the muscle. Scale bars indicate 50 micrometers. 1

2 S U P P L E M E N TA R Y I N F O R M AT I O N Supplementary Figure 2 Validation of hair cycle stage a, Analysis of RNAseq data to validate that HFSCs in telogen-anagen transition were in fact in such a transition. The telogen-anagen transition is known to be driven by Shh (Gli factors are targets) and Wnt (Lef1, Axin, Ccnd1 are targets) signaling, and correlate with increased proliferation (Ki67 and Pcna). In addition, Sox4 was previously identified as a regulator of the telogen-anagen transition. n=3 mice per timepoint. Shown as mean ± SEM. Paired t-test was performed, p < b, staining for Ki-67 marks dividing cells during various stages of the hair cycle. Brackets indicate the HFSC niche. Scale bars indicate 100 micrometers. 2

3 S U P P L E M E N TA R Y I N F O R M AT I O N Supplementary Figure 3 Long term deletion of Ldha in HFSCs a, K15CrePR;Ldhafl/fl animals treated with Mifepristone during telogen (day 50) were allowed to develop for 6 months. None of the K15CrePR;Ldhafl/ fl mice showed complete hair regrowth, compared to control animals that all grew their hair coats back completely. Images are representative of at least 12 animals per genotype. b, Histological examination of the long term K15CrePR;Ldhafl/fl mice showed that Ldha-null HFSCs remained in telogen while WT HFSCs went through anagen and then returned to telogen. This is apparent from thick sections (50 micron, right) that show an increased number of club hairs in the WT relative to Ldha-null follicles. Scale bars indicate 100 micrometers (left), and 20 micrometers (middle and right). c, IHC for HFSC marker Sox9 showed that deletion of Ldha from HFSCs does not affect their presence in the bulge even after 6 months. In addition, IHC and Ldh activity assay demonstrate that the deletion of Ldha was sustained. Because of the mosaicism of the deletion, in some portions of K15CrePR;Ldhafl/fl skin Ldha was not deleted. Shown on the bottom row is tissue from hair bearing skin in the K15CrePR;Ldhafl/fl mice where Ldha was still expressed, showing that new hair growth in K15CrePR;Ldhafl/fl mice was due to lack of deletion of Ldha caused by the mosaic approach used to mediate Cre recombination. Scale bars indicate 20 micrometers. d, To determine how various signaling pathways previously linked to the hair cycle are affected by loss of Ldha in HFSCs, we performed IHC for markers that indicate activity of these pathways in telogen and telogen-anagen transition. Note that pstat5 appears to be suppressed in normal telogen-anagen transition, and this does not seem to occur in Ldha-null HFSCs. pstat1 and pstat3 did not seem to be affected by loss of Ldha. Expression of Gli3, a target of Shh signaling, is typically induced in an activated hair germ derived from HFSCs, but Ldha-null HFSCs do not make an active hair germ. Activation of the Wnt pathway is indicated by nuclear localization of β-catenin, and very little nuclear β-catenin was detected in Ldha-null HFSCs. Scale bars indicate 6 micrometers. 3

4 SUPPLEMENTARY INFORMATION Supplementary Figure 4 Long term deletion of Mpc1 in HFSCs a, Six months after initiation of deletion of Mpc1 in HFSCs (K15CrePR;Mpc1fl/ fl), mice lacking Mpc1 show no deleterious effects as measured by the hair cycle (left), pathology (middle, H and E), or staining for HFSCs (right, Sox9). Scale bars indicate 100 micrometers in middle panel, and 50 micrometers in right panel. Images are representative of at least 12 animals per genotype. b, To demonstrate that the deletion of Mpc1 promotes proliferation specifically in HFSCs, we used K15CrePR;Ldha fl/fl mice bearing a lox-stoplox-tomato allele to look at K15+ HFSCs and proliferation with and without Mpc1 deletion (left). In addition, we took advantage of the ires-gfp within the Lgr5CreER allele to stain for Ki-67 and GFP and look for co-localization with and without Mpc1 deletion (right). White brackets denote bulge area. Scale bars represent 20 micrometers. c, Deletion of Mpc1 in mice bearing the Lgr6CreER allele shows no premature induction of the hair cycle. d, Ldh activity assay on sorted HFSCs from either control or Lgr6CreER mediated Mpc1 deletion mice showed increased activity in cells lacking Mpc1. n=6 mice per genotype pooled from 2 independent experiments. Shown as mean ± SEM. Paired t-test was performed, p <

5 SUPPLEMENTARY INFORMATION Supplementary Figure 5 Stimulation of Jak-Stat signaling and the hair cycle. RCGD423 was applied topically to shaved mice at day hours after treatment, the skin was harvested and prepared for IHC. IHC with the indicated antibodies demonstrates relative activity of Stat signaling in vehicle vs RCGD423 treated skin. Scale bars indicate 20 micrometers. 5

6 S U P P L E M E N TA R Y I N F O R M AT I O N Fig1 Fig 4 Fig 6 Supplementary Figure 6 Unprocessed Blots. Unprocessed scans of the blots shown in Figures 1, 4, 6 are shown. 6

7 SUPPLEMENTARY INFORMATION Supplementary Table Legend Supplementary Table 1 Presented is an inventory of mice that are described in Figures 1-6 (and Supplementary Figures 1-5), including age, sex, and genotype. 7

8 Life Sciences Reporting Summary Corresponding Author: Date: William Lowry Heather Christofk Nature Research wishes to improve the reproducibility of the work we publish. This form is published with all life science papers and is intended to promote consistency and transparency in reporting. All life sciences submissions use this form; while some list items might not apply to an individual manuscript, all fields must be completed for clarity. For further information on the points included in this form, see Reporting Life Sciences Research. For further information on Nature Research policies, including our data availability policy, see Authors & Referees and the Editorial Policy Checklist. Experimental design 1. Sample size Describe how sample size was determined. 2. Data exclusions Describe any data exclusions. 3. Replication Describe whether the experimental findings were reliably reproduced. 4. Randomization Describe how samples/organisms/participants were allocated into experimental groups. 5. Blinding Describe whether the investigators were blinded to group allocation during data collection and/or analysis. no a priori power analysis was performed. We performed at least three biologically independent experiments for all data presented, and each experiments included multiple technical replicates. no data were excluded all data presented reflect findings that were highly reproducible There was no justification for randomization into experimental groups. Blinding was not necessary because each experiment was performed with unbiased methods, measured by instruments. There were no subjective measurements made. Note: all studies involving animals and/or human research participants must disclose whether blinding and randomization were used. 6. Statistical parameters n/a For all figures and tables that use statistical methods, confirm that the following items are present in relevant figure legends (or the Methods section if additional space is needed). Confirmed The exact sample size (n) for each experimental group/condition, given as a discrete number and unit of measurement (animals, litters, cultures, etc.) A description of how samples were collected, noting whether measurements were taken from distinct samples or whether the same sample was measured repeatedly. A statement indicating how many times each experiment was replicated The statistical test(s) used and whether they are one- or two-sided (note: only common tests should be described solely by name; more complex techniques should be described in the Methods section) A description of any assumptions or corrections, such as an adjustment for multiple comparisons The test results (e.g. p values) given as exact values whenever possible and with confidence intervals noted A summary of the descriptive statistics, including central tendency (e.g. median, mean) and variation (e.g. standard deviation, interquartile range) Clearly defined error bars See the web collection on statistics for biologists for further resources and guidance. nature research life sciences reporting summary June

9 Software Policy information about availability of computer code 7. Software Describe the software used to analyze the data in this study. no new code were generated in this study. software used for analyses are standard such as excel. For all studies, we encourage code deposition in a community repository (e.g. GitHub). Authors must make computer code available to editors and reviewers upon request. The Nature Methods guidance for providing algorithms and software for publication may be useful for any submission. Materials and reagents Policy information about availability of materials 8. Materials availability Indicate whether there are restrictions on availability of unique materials or if these materials are only available for distribution by a for-profit company. 9. Antibodies Describe the antibodies used and how they were validated for use in the system under study (i.e. assay and species). 10. Eukaryotic cell lines a. State the source of each eukaryotic cell line used. no cell lines were used in this study b. Describe the method of cell line authentication used. no cell lines were used in this study c. Report whether the cell lines were tested for mycoplasma contamination. d. If any of the cell lines used in the paper are listed in the database of commonly misidentified cell lines maintained by ICLAC, provide a scientific rationale for their use. All transgenic animals described in the study will be made available upon request. All but Mpc1-flox and Ldha-flox are available from Jackson Labs. CD34 Monoclonal Antibody (RAM34), FITC, ebioscience (Catalog #: ) and CD49d (Integrin alpha 4) Monoclonal Antibody (R1-2), PE, ebioscience (Catalog #: ). β-actin (Abcam ab8227; 1:1000), β-actin (Santa Cruz sc-47778; 1:1000), C-Myc (Abcam ab32072; 1:1000), N- Myc (Santa Cruz sc-53993; 1:200), H3K27Ac (Abcam ab177178; 1:200), Mpc1(Sigma HPA045119). Ki67 (Abcam ab16667, 1:50), p-s6 (Cell Signaling CST2215, 1:50), Sox9 (Abcam ab185230, 1:1000), Ldha (Abcam ab47010, 1:100), Ldh (Abcam ab125683, 1:100), p-stat3 (Abcam ab68153, 1:200), p-stat1 (Abcam ab109461, 1:200), p-stat5 (Abcam ab32364; 1:50), Gli3 (Abcam ab6050; 1:100), β-catenin (Abcam ab32572; 1:500). no cell lines were used in this study no cell lines were used in this study nature research life sciences reporting summary June

10 Animals and human research participants Policy information about studies involving animals; when reporting animal research, follow the ARRIVE guidelines 11. Description of research animals Provide details on animals and/or animal-derived materials used in the study. Policy information about studies involving human research participants 12. Description of human research participants Describe the covariate-relevant population characteristics of the human research participants. K15-Cre-PR strain: C57bl6 The mice express Cre-ER recombinase under control of the Keratin 15 promoter and thus strictly in the stem cells of the epidermis. The Cre-ER transgene efficiently recognizes and cleaves DNA between recognition sites known as LoxP sites. When these mice are crossed to generate homozygous floxed animals with the Cre-ER transgene, the gene flanked by LoxP sites is deleted upon treatment with progesterone, allowing for an inducible conditional ablation of the gene over any kind of timecourse. In this case we can eliminate a gene of interest specifically in the stem cells of the epidermis. Floxed Ldha STrain: C57Bl6 These mice harbor genetically modified alleles of the Ldha gene. These mice are normal, but any offspring that also express an allele of Cre recombinase will have the floxed allele of Ldha deleted. We are using these mice to study the effect of deleting this metabolic gene in stem and transit-amplifying cells of the epidermis. Floxed MPC1 STrain: C57Bl6 These mice harbor genetically modified alleles of the MPC1 gene. These mice are normal, but any offspring that also express an allele of Cre recombinase will have the floxed allele of MPC1 deleted. We are using these mice to study the effect of deleting this gene in stem and transitamplifying cells of the epidermis. Lgr5-CreER-IresGFP These mice are transgenic for a knockin allele of CreER-IresGFP into the Lgr5 locus. Lgr5 is only expressed in Hair follicle stem cells, so this transgenic mouse allows for inducible Cre activity to be delivered just to the stem cells. We use these mice to induce or delete genes specifically in the stem cells. Lgr6-CreER-IresGFP These mice are transgenic for a knockin allele of CreER-IresGFP into the Lgr6 locus. Lgr6 is only expressed in Hair follicle cells of the infundibulum, so this transgenic mouse allows for inducible Cre activity to be delivered just to the infundibulum of the follice. We use these mice to induce or delete genes specifically in the infundibular cells. A full inventory of the animals used, including age, sex and genotype, can be found in Supplementary Table 1. this study did not involve human subjects nature research life sciences reporting summary June

Supplementary Figure 1. Isolation of GFPHigh cells.

Supplementary Figure 1. Isolation of GFPHigh cells. Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.

Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting. Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice

More information

The Use of Genetically-Modified Mouse Models to Study the Actin Cytoskeleton

The Use of Genetically-Modified Mouse Models to Study the Actin Cytoskeleton The Use of Genetically-Modified Mouse Models to Study the Actin Cytoskeleton Anthony Kee (PhD) Cellular and Genetic Medicine Unit School of Medical Sciences (a.kee@unsw.edu.au) 2017 Structure of the Prac

More information

Supplemental Information Inventory

Supplemental Information Inventory Cell Stem Cell, Volume 6 Supplemental Information Distinct Hematopoietic Stem Cell Subtypes Are Differentially Regulated by TGF-β1 Grant A. Challen, Nathan C. Boles, Stuart M. Chambers, and Margaret A.

More information

Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and

Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic

More information

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome. Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated

More information

Color-Switch CRE recombinase stable cell line

Color-Switch CRE recombinase stable cell line Color-Switch CRE recombinase stable cell line Catalog Number Product Name / Description Amount SC018-Bsd CRE reporter cell line (Bsd): HEK293-loxP-GFP- RFP (Bsd). RFP" cassette with blasticidin antibiotic

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10163 Supplementary Table 1 Efficiency of vector construction. Process wells recovered efficiency (%) Recombineering* 480 461 96 Intermediate plasmids 461 381 83 Recombineering efficiency

More information

SUPPLEMENTARY INFORMATION. Integrin alpha 11 in regulation of myofibroblasts phenotype: Implication for fibrotic diseases

SUPPLEMENTARY INFORMATION. Integrin alpha 11 in regulation of myofibroblasts phenotype: Implication for fibrotic diseases SUPPLEMENTARY INFORMATION Integrin alpha 11 in regulation of myofibroblasts phenotype: Implication for fibrotic diseases Ruchi Bansal 1, Shigeki Nakagawa 2, Saleh Yazdani 1, Joop van Baarlen 3, Anu Venkatesh

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin

More information

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin

More information

GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts

GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts Current Biology, Volume 24 Supplemental Information GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts Wei Zhou, Jin Chang, Xin Wang, Masha G. Savelieff, Yinyin Zhao, Shanshan

More information

CRISPR/Cas9 Mouse Production

CRISPR/Cas9 Mouse Production CRISPR/Cas9 Mouse Production Emory Transgenic and Gene Targeting Core http://cores.emory.edu/tmc Tamara Caspary, Ph.D. Scientific Director Teresa Quackenbush --- Lab Operations and Communications Coordinator

More information

CytoSelect LDH Cytotoxicity Assay Kit

CytoSelect LDH Cytotoxicity Assay Kit Product Manual CytoSelect LDH Cytotoxicity Assay Kit Catalog Number CBA- 241 960 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction The measurement and monitoring of cell cytotoxicity

More information

SUPPLEMENTAL INFORMATION

SUPPLEMENTAL INFORMATION UTX/KDM6A demethylase activity is required for satellite cell-mediated muscle regeneration Hervé Faralli 1,2, Chaochen Wang 3, Kiran Nakka 1,2, Soji Sebastian 1,, Aissa Benyoucef 1,2, Lenan Zhuang 3, Alphonse

More information

Quantitative Genetics

Quantitative Genetics Quantitative Genetics Polygenic traits Quantitative Genetics 1. Controlled by several to many genes 2. Continuous variation more variation not as easily characterized into classes; individuals fall into

More information

Int. J. Mol. Sci. 2016, 17, 1259; doi: /ijms

Int. J. Mol. Sci. 2016, 17, 1259; doi: /ijms S1 of S5 Supplementary Materials: Fibroblast-Derived Extracellular Matrix Induces Chondrogenic Differentiation in Human Adipose-Derived Mesenchymal Stromal/Stem Cells in Vitro Kevin Dzobo, Taegyn Turnley,

More information

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross?

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross? Problem Set 5 answers 1. Whether or not the shanks of chickens contains feathers is due to two independently assorting genes. Individuals have unfeathered shanks when they are homozygous for recessive

More information

Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis

Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis CORRECTION Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis Tokameh Mahmoudi, Sylvia F. Boj, Pantelis Hatzis, Vivian S. W. Li,

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. ZBTB20 expression in the developing DRG. ZBTB20 expression in the developing DRG was detected by immunohistochemistry using anti-zbtb20 antibody 9A10 on

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Ex2 promotor region Cre IRES cherry pa Ex4 Ex5 Ex1 untranslated Ex3 Ex5 untranslated EYFP pa Rosa26 STOP loxp loxp Cre recombinase EYFP pa Rosa26 loxp 1 kb Interleukin-9 fate reporter

More information

Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans

Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Supplemental Materials Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Madhusudhan Budatha, Shayzreen Roshanravan, Qian Zheng, Cecilia Weislander, Shelby L. Chapman,

More information

Cellular Heterogeneity in the Mouse Esophagus Implicates the Presence of a Nonquiescent Epithelial Stem Cell Population

Cellular Heterogeneity in the Mouse Esophagus Implicates the Presence of a Nonquiescent Epithelial Stem Cell Population Article Cellular Heterogeneity in the Mouse Esophagus Implicates the Presence of a Nonquiescent Epithelial Stem Cell Population Graphical Abstract Authors Aaron D. DeWard, Julie Cramer, Eric Lagasse Correspondence

More information

Use of Gene Editing Technologies in Rodents. Carlisle P. Landel, Ph.D.

Use of Gene Editing Technologies in Rodents. Carlisle P. Landel, Ph.D. Use of Gene Editing Technologies in Rodents Carlisle P. Landel, Ph.D. The Mouse as A Model Mammal Small, easy to maintain, fecund Well understood genetics Similarity to humans >90% Availability of inbred

More information

Microarray Gene Expression Analysis at CNIO

Microarray Gene Expression Analysis at CNIO Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples

More information

! Allele Interactions

! Allele Interactions Chapter 4!Extensions to Mendelian Genetics! Allele Interactions 1 INTRODUCTION Mendelian inheritance describes inheritance patterns that obey two laws Law of segregation Law of independent assortment Simple

More information

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6

More information

A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish

A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish Developmental Cell Supplemental Information A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish Julien Ablain, Ellen M. Durand, Song Yang, Yi Zhou, and Leonard I. Zon % larvae

More information

Supplemental Material for

Supplemental Material for Supplemental Material for TXI TELNGIECTSI MUTTED (TM)-MEDITED DN DMGE RESPONSE IN OXIDTIVE STRESS-INDUCED VSCULR ENDOTHELIL CELL SENESCENCE Hong Zhan 1, Toru Suzuki 1,2, Kenichi izawa 1, Kiyoshi Miyagawa,

More information

Sox2 Cooperates with Lkb1 Loss in a Mouse Model of Squamous Cell Lung Cancer

Sox2 Cooperates with Lkb1 Loss in a Mouse Model of Squamous Cell Lung Cancer Cell Reports, Volume 7 Supplemental Information Sox2 Cooperates with Lkb1 Loss in a Mouse Model of Squamous Cell Lung Cancer Anandaroop Mukhopadhyay, Kristofer C. Berrett, Ushma Kc, Phillip M. Clair, Stelian

More information

Biology Genetics Practice Quiz

Biology Genetics Practice Quiz Biology Genetics Practice Quiz Multiple Choice Identify the choice that best completes the statement or answers the question. 1. The table above shows information related to blood types. What genotype(s)

More information

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline

More information

Cell autonomous vs. cell non-autonomous gene function

Cell autonomous vs. cell non-autonomous gene function Cell autonomous vs. cell non-autonomous gene function In multicellular organisms, it is important to know in what cell(s) the activity of a gene is required. - while RNA expression can be highly informative,

More information

Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation

Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Shu Liu 1, Zhongwen Xie 2, Qingwei Zhao 2, Huan Pang

More information

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab. / 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG

More information

Purification of Lactate Dehydrogenase

Purification of Lactate Dehydrogenase Dominican University of California Dominican Scholar Scholarly & Creative Works Conference 2018 Scholarly and Creative Works Conference 2016 Apr 15th, 1:30 PM - 2:00 PM Purification of Lactate Dehydrogenase

More information

Gen e e n t e i t c c V a V ri r abi b li l ty Biolo l gy g Lec e tur u e e 9 : 9 Gen e et e ic I n I her e itan a ce

Gen e e n t e i t c c V a V ri r abi b li l ty Biolo l gy g Lec e tur u e e 9 : 9 Gen e et e ic I n I her e itan a ce Genetic Variability Biology 102 Lecture 9: Genetic Inheritance Asexual reproduction = daughter cells genetically identical to parent (clones) Sexual reproduction = offspring are genetic hybrids Tendency

More information

Observing Patterns in Inherited Traits. Chapter 11

Observing Patterns in Inherited Traits. Chapter 11 Observing Patterns in Inherited Traits Chapter 11 Impacts, Issues: The Color of Skin Like most human traits, skin color has a genetic basis; more than 100 gene products affect the synthesis and deposition

More information

Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin

Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Carla Tripisciano 1, René Weiss 1, Tanja Eichhorn 1,

More information

Supplementary Figure and Table Legends

Supplementary Figure and Table Legends 1 Supplementary Figure and Table Legends Figure S1: Whole-animal metabolic analysis. 12 week old WT and Dvl1 / were singly housed in CLAMS cages (Comprehensive Laboratory Animals Monitoring System) for

More information

7.014 Quiz III 4/22/05. Write your name on this page and your initials on all the other pages in the space provided.

7.014 Quiz III 4/22/05. Write your name on this page and your initials on all the other pages in the space provided. 7.014 Quiz III 4/22/05 Your Name: TA's Name: Write your name on this page and your initials on all the other pages in the space provided. This exam has 10 pages including this coversheet. Check that you

More information

ab Hypoxic Response Human Flow Cytometry Kit

ab Hypoxic Response Human Flow Cytometry Kit ab126585 Hypoxic Response Human Flow Cytometry Kit Instructions for Use For measuring protein levels by flow cytometry: hypoxia-inducible factor 1-alpha (HIF1A) and BCL2/adenovirus E1B 19 kda proteininteracting

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information

JS 190- Population Genetics- Assessing the Strength of the Evidence Pre class activities

JS 190- Population Genetics- Assessing the Strength of the Evidence Pre class activities JS 190- Population Genetics- Assessing the Strength of the Evidence I. Pre class activities a. Quiz then Review Assignments and Schedule II. Learning Objectives a. Overview of Validation Developmental

More information

Title: Combination of a third generation bisphosphonate and replication-competent adenoviruses augments the cytotoxicity on mesothelioma

Title: Combination of a third generation bisphosphonate and replication-competent adenoviruses augments the cytotoxicity on mesothelioma Author s response to reviews Title: Combination of a third generation bisphosphonate and replication-competent adenoviruses augments the cytotoxicity on mesothelioma Authors: Masatoshi Tagawa (mtagawa@chiba-cc.jp)

More information

Color-Switch CRE Reporter Stable Cell Line

Color-Switch CRE Reporter Stable Cell Line Color-Switch CRE Reporter Stable Cell Line Catalog Number SC018-Bsd SC018-Neo SC018-Puro Product Name / Description CRE reporter cell line (Bsd): HEK293-loxP-GFP- RFP (Bsd). Cell line expresses "LoxP-GFP-stop-

More information

Sox2 in the Dermal Papilla Niche Controls Hair Growth by Fine-Tuning BMP Signaling in Differentiating Hair Shaft Progenitors

Sox2 in the Dermal Papilla Niche Controls Hair Growth by Fine-Tuning BMP Signaling in Differentiating Hair Shaft Progenitors Article Sox2 in the Dermal Papilla Niche Controls Hair Growth by Fine-Tuning BMP Signaling in Differentiating Hair Shaft Progenitors Carlos Clavel, 1,2 Laura Grisanti, 1,2 Roland Zemla, 1,2 Amelie Rezza,

More information

Trasposable elements: Uses of P elements Problem set B at the end

Trasposable elements: Uses of P elements Problem set B at the end Trasposable elements: Uses of P elements Problem set B at the end P-elements have revolutionized the way Drosophila geneticists conduct their research. Here, we will discuss just a few of the approaches

More information

Observing Patterns In Inherited Traits

Observing Patterns In Inherited Traits Observing Patterns In Inherited Traits Ø Where Modern Genetics Started/ Gregor Mendel Ø Law of Segregation Ø Law of Independent Assortment Ø Non-Mendelian Inheritance Ø Complex Variations in Traits Genetics:

More information

Human alpha-galactosidase A / GLA ELISA Pair Set

Human alpha-galactosidase A / GLA ELISA Pair Set Human alpha-galactosidase A / GLA ELISA Pair Set Catalog Number : SEK12078 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1: Vector maps of TRMPV and TRMPVIR variants. Many derivatives of TRMPV have been generated and tested. Unless otherwise noted, experiments in this paper use

More information

For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells.

For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells. ab110216 MitoBiogenesis TM In-Cell ELISA Kit (IR) Instructions for Use For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells. This product is for research use

More information

Supplementary Figure 1 Activated B cells are subdivided into three groups

Supplementary Figure 1 Activated B cells are subdivided into three groups Supplementary Figure 1 Activated B cells are subdivided into three groups according to mitochondrial status (a) Flow cytometric analysis of mitochondrial status monitored by MitoTracker staining or differentiation

More information

Isolation, culture, and transfection of primary mammary epithelial organoids

Isolation, culture, and transfection of primary mammary epithelial organoids Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)

More information

Overview of Immunohistochemistry. (with a focus on wax-embedded sections)

Overview of Immunohistochemistry. (with a focus on wax-embedded sections) Overview of Immunohistochemistry (with a focus on wax-embedded sections) Overview of Immunohistochemistry (with a focus on wax-embedded sections) Overview of Immunohistochemistry IHC is like cooking. There

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination.

Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Seeds of Col-0 were harvested from plants grown at 16 C, stored for 2 months, imbibed for indicated

More information

LAB ACTIVITY ONE POPULATION GENETICS AND EVOLUTION 2017

LAB ACTIVITY ONE POPULATION GENETICS AND EVOLUTION 2017 OVERVIEW In this lab you will: 1. learn about the Hardy-Weinberg law of genetic equilibrium, and 2. study the relationship between evolution and changes in allele frequency by using your class to represent

More information

Title: Effects of thyroid hormone analogue and leukotrienes pathway blocker on renal ischemia/reperfusion injury in a mouse model.

Title: Effects of thyroid hormone analogue and leukotrienes pathway blocker on renal ischemia/reperfusion injury in a mouse model. Author's response to reviews Title: Effects of thyroid hormone analogue and leukotrienes pathway blocker on renal ischemia/reperfusion injury in a mouse model. Authors: Najah R hadi (drnajahhadi@yahoo.com)

More information

Gregor Mendel. Austrian Monk Worked with pea plants

Gregor Mendel. Austrian Monk Worked with pea plants Gregor Mendel Austrian Monk Worked with pea plants A. True Breeding Pea Plants Self pollinate and produce new plants genetically identical to themselves Mendel decides to cross pollinate the plants Offspring

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and

More information

Cre Stoplight with Living Colors is a faster, brighter

Cre Stoplight with Living Colors is a faster, brighter Cre Stoplight with Living Colors is a faster, brighter reporter for Cre recombinase. Drago A Guggiana-Nilo 1, Anne Marie Quinn 2,Thomas E. Hughes 1 1 Department of Cell Biology and Neuroscience, Montana

More information

Mouse ICAM-1 / CD54 ELISA Pair Set

Mouse ICAM-1 / CD54 ELISA Pair Set Mouse ICAM-1 / CD54 ELISA Pair Set Catalog Number : SEK50440 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in the General

More information

LECTURE 5: LINKAGE AND GENETIC MAPPING

LECTURE 5: LINKAGE AND GENETIC MAPPING LECTURE 5: LINKAGE AND GENETIC MAPPING Reading: Ch. 5, p. 113-131 Problems: Ch. 5, solved problems I, II; 5-2, 5-4, 5-5, 5.7 5.9, 5-12, 5-16a; 5-17 5-19, 5-21; 5-22a-e; 5-23 The dihybrid crosses that we

More information

Genetically targeted all-optical electrophysiology with a transgenic Credependent

Genetically targeted all-optical electrophysiology with a transgenic Credependent Genetically targeted all-optical electrophysiology with a transgenic Credependent Optopatch mouse Short title: Transgenic Optopatch mouse Shan Lou 1, Yoav Adam 1, Eli N. Weinstein 1,4, Erika Williams 2,

More information

Bio 121 Practice Exam 3

Bio 121 Practice Exam 3 The material covered on Exam 3 includes lecture since the last exam and text chapters 13-21. Be sure that you read chapter 19, which was not represented in the notes. 1. Which of the following is an enveloped

More information

LS50B Problem Set #7

LS50B Problem Set #7 LS50B Problem Set #7 Due Friday, March 25, 2016 at 5 PM Problem 1: Genetics warm up Answer the following questions about core concepts that will appear in more detail on the rest of the Pset. 1. For a

More information

Chp 10 Patterns of Inheritance

Chp 10 Patterns of Inheritance Chp 10 Patterns of Inheritance Dogs, one of human s longest genetic experiments Over 1,000 s of years, humans have chosen and mated dogs with specific traits. A process called -artificial selection The

More information

GENESDEV/2007/ Supplementary Figure 1 Elkabetz et al.,

GENESDEV/2007/ Supplementary Figure 1 Elkabetz et al., GENESDEV/2007/089581 Supplementary Figure 1 Elkabetz et al., GENESDEV/2007/089581 Supplementary Figure 2 Elkabetz et al., GENESDEV/2007/089581 Supplementary Figure 3 Elkabetz et al., GENESDEV/2007/089581

More information

A Level. A Level Biology. DNA Technology Questions. AQA, OCR, Edexcel. Name: Total Marks: Page 1

A Level. A Level Biology. DNA Technology Questions. AQA, OCR, Edexcel. Name: Total Marks: Page 1 AQA, OCR, Edexcel A Level A Level Biology DNA Technology Questions Name: Total Marks: Page 1 Q1.(a) (i) A mutation of a tumour suppressor gene can result in the formation of a tumour. Explain how.........(2)

More information

Green Fluorescent Protein (GFP) Purification. Hydrophobic Interaction Chromatography

Green Fluorescent Protein (GFP) Purification. Hydrophobic Interaction Chromatography Green Fluorescent Protein (GFP) Purification Hydrophobic Interaction Chromatography What is the GFP gene? GFP is a green fluorescent protein that is normally found in jellyfish. It has been engineered

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 PPAR-γ is dispensable for the development of tissue macrophages in the heart, kidneys, lamina propria and white adipose tissue. Plots show the expression of F4/80 and CD11b (a) or

More information

LINKAGE AND CHROMOSOME MAPPING IN EUKARYOTES

LINKAGE AND CHROMOSOME MAPPING IN EUKARYOTES LINKAGE AND CHROMOSOME MAPPING IN EUKARYOTES Objectives: Upon completion of this lab, the students should be able to: Understand the different stages of meiosis. Describe the events during each phase of

More information

Mendel and the Gene Idea

Mendel and the Gene Idea Chapter 4 Mendel and the Gene Idea PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan

More information

Classical (Mendelian) Genetics. Gregor Mendel

Classical (Mendelian) Genetics. Gregor Mendel Classical (Mendelian) Genetics Gregor Mendel Vocabulary Genetics: The scientific study of heredity Allele: Alternate forms of a gene/factor. Genotype: combination of alleles an organism has. Phenotype:

More information

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination

More information

His- Tag Protein ELISA Kit

His- Tag Protein ELISA Kit Revised Protocol Product Manual His- Tag Protein ELISA Kit Catalog Numbers AKR- 130 96 wells FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction A polyhistidine-tag, or His-tag, is

More information

Protein Synthesis

Protein Synthesis HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is

More information

Impact of Retinoic acid induced-1 (Rai1) on Regulators of Metabolism and Adipogenesis

Impact of Retinoic acid induced-1 (Rai1) on Regulators of Metabolism and Adipogenesis Impact of Retinoic acid induced-1 (Rai1) on Regulators of Metabolism and Adipogenesis The mammalian system undergoes ~24 hour cycles known as circadian rhythms that temporally orchestrate metabolism, behavior,

More information

AP BIOLOGY Population Genetics and Evolution Lab

AP BIOLOGY Population Genetics and Evolution Lab AP BIOLOGY Population Genetics and Evolution Lab In 1908 G.H. Hardy and W. Weinberg independently suggested a scheme whereby evolution could be viewed as changes in the frequency of alleles in a population

More information

Introduction to Molecular Biology

Introduction to Molecular Biology Introduction to Molecular Biology Bioinformatics: Issues and Algorithms CSE 308-408 Fall 2007 Lecture 2-1- Important points to remember We will study: Problems from bioinformatics. Algorithms used to solve

More information

Supplementary Figure 1: sgrna library generation and the length of sgrnas for the functional screen. (a) A diagram of the retroviral vector for sgrna

Supplementary Figure 1: sgrna library generation and the length of sgrnas for the functional screen. (a) A diagram of the retroviral vector for sgrna Supplementary Figure 1: sgrna library generation and the length of sgrnas for the functional screen. (a) A diagram of the retroviral vector for sgrna expression. It contains a U6-promoter-driven sgrna

More information

Read and take notes on pages

Read and take notes on pages Protein Synthesis Read and take notes on pages 336-340 What is protein? Proteins Polypeptide chains of amino acids Are enzymes that catalyze biochemical reactions and are vital to metabolism. They have

More information

Cytomics in Action: Cytokine Network Cytometry

Cytomics in Action: Cytokine Network Cytometry Cytomics in Action: Cytokine Network Cytometry Jonni S. Moore, Ph.D. Director, Clinical and Research Flow Cytometry and PathBioResource Associate Professor of Pathology & Laboratory Medicine University

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Dolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system

Dolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system Application Note 03 Dolphin-Chemi plus 8/22/2007 Dolphin-Chemi Plus Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system INTRODUCTION

More information

A Discovery Laboratory Investigating Bacterial Gene Regulation

A Discovery Laboratory Investigating Bacterial Gene Regulation Chapter 8 A Discovery Laboratory Investigating Bacterial Gene Regulation Robert Moss Wofford College 429 N. Church Street Spartanburg, SC 29307 mosssre@wofford.edu Bob Moss is an Associate Professor of

More information

Section 4 - Guidelines for DNA Technology. Version October, 2017

Section 4 - Guidelines for DNA Technology. Version October, 2017 Section 4 - Guidelines for DNA Technology Section 4 DNA Technology Table of Contents Overview 1 Molecular genetics... 4 1.1 Introduction... 4 1.2 Current and potential uses of DNA technologies... 4 1.2.1

More information

Mouse TNF alpha ELISA Kit

Mouse TNF alpha ELISA Kit Mouse TNF alpha ELISA Kit Catalog No. GWB-ZZD049 Size 96 wells/kit Sandwich ELISA kit for quantitative detection of mouse TNF alpha in cell culture supernates, serum and plasma(heparin, EDTA). Typical

More information

Table S1. List of primers used in this study

Table S1. List of primers used in this study Table S1. List of primers used in this study Name KanMx-F2 KanMx-A2 FEN1-DG-S FEN1-DG-A SUR4-DG-S SUR4-DG-A CaARG4-R1130 CaARG4-F61 CaHIS1-DR CaHIS1-ter CaFEN1-US1 CaFEN1-UA1 CaFEN1-DS2 CaFEN1-DA2 CaFEN1-DG-S

More information

colorimetric sandwich ELISA kit datasheet

colorimetric sandwich ELISA kit datasheet colorimetric sandwich ELISA kit datasheet For the quantitative detection of human TGF-beta1 in serum, plasma, cell culture supernatants and Urine. general information Catalogue Number Product Name Species

More information

Rejuvenation of the muscle stem cell population restores strength to injured aged muscles

Rejuvenation of the muscle stem cell population restores strength to injured aged muscles Rejuvenation of the muscle stem cell population restores strength to injured aged muscles Benjamin D Cosgrove, Penney M Gilbert, Ermelinda Porpiglia, Foteini Mourkioti, Steven P Lee, Stephane Y Corbel,

More information

Large scale genome editing for. Senior Scientist, GenScript

Large scale genome editing for. Senior Scientist, GenScript Large scale genome editing for metabolic engineering of E. coli YifanLi Li, Ph.D PhD Senior Scientist, GenScript Metabolic engineering Cell factory Remove inhibition Substrate Overexpressing pathway genes

More information

CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016

CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene

More information

Mendel & Inheritance. SC.912.L.16.1 Use Mendel s laws of segregation and independent assortment to analyze patterns of inheritance.

Mendel & Inheritance. SC.912.L.16.1 Use Mendel s laws of segregation and independent assortment to analyze patterns of inheritance. Mendel & Inheritance SC.912.L.16.1 Use Mendel s laws of segregation and independent assortment Mendel s Law of Segregation: gene pairs separate when gametes (sex cells) are formed; each gamete as only

More information

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1 Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 4.52E-18 PDK1 6.77E-18 CSRP2 4.42E-17 PFKP 1.23E-14 MSH2 3.79E-13 NARF_A 5.56E-13 ADFP 5.56E-13 FAM13A1 1.56E-12 FAM29A_A 1.22E-11 CA9 1.54E-11

More information