Journal: Nature Medicine

Size: px
Start display at page:

Download "Journal: Nature Medicine"

Transcription

1 Journal: Nature Medicine Article Title: Authors Corresponding Author: PAI-1 mediates the anti-angiogenic and pro-fibrinolytic effects of 16K prolactin Khalid Bajou, Stephanie Herkenne, Victor L. Thijssen, Salvino D'Amico, Ngoc-Quynh-Nhu Nguyen, Ann Bouché, Sébastien Tabruyn, Mohammed Srahna, Jean-Yves Carabin, Olivier Nivelles, Cécile Paques, Ivo Cornelissen, Michelle Lion, Agnès Noel, Ann Gils, Stefan Vinckier, Paul J. Declerck, Arjan W. Griffioen, Mieke Dewerchin, Joseph A. Martial, Peter Carmeliet and Ingrid Struman Ingrid Struman Supplementary Item & Number (add rows as necessary) Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary Figure 4 Supplementary Figure 5 Supplementary Figure 6 Title or Caption PAI-1 is required for 16K PRL to impair neovascularization Schematic outline of the PLA strategy for upa and 16K PRL. 16K PRL binds PAI-1, upar and upa PAI-1 and upar sirna reduces PAI-1 expression in HUVECs Inhibition of B16F10 tumor growth by 16K PRL is upa dependent 16K PRL inhibits PAI-1 s antiproteolytic activity in the presence of vitronectin. Supplementary Figure 7 Supplementary Table 1 16K PRL has no effect on clot lysis in the absence of PAI-1 and inhibits thromboplastin-induced pulmonary embolism PRL decreases reperfusion time and improves blood flow recovery in the carotid injury model.

2 FIGURE S1 FIGURE S1: (a-c) PAI-1 is required for 16K PRL to impair neovascularization. (a) Immunostaining for collagen type IV (red) and the proliferation marker Ki67 (green) of B16F10 tumors grown for 18 days in WT mice treated with CTL-Ad1. Nuclei are visualized by DAPI (blue). Arrows denote proliferative tumor cells; arrowheads proliferative ECs. Scale bar, 100 µm. (b,c) Percentage of Ki67 + tumor cells (b) or tumor endothelial cells (c) in subcutaneously implanted B16F10 tumors in WT or PAI-1 -/- mice treated with 16K PRL adenovirus (16K-Ad1) or control virus (CTL-Ad1) (mean±sem; N=7; *P=0.038). (d) INHIBITION OF 4T1 TUMOR GROWTH BY 16K PRL IS PAI-1 DEPENDENT Tumor weight of murine 4T1 breast carcinoma cells at 15 days after orthotopic implantation in Rag-1 -/- WT or Rag-1 -/- PAI-1 -/- mice. The mice were treated with CTL- Ad1 or 16K-Ad1 2 days prior and 6 days after tumor injection. The numbers between parentheses indicate the engraftment rate at the end of the experiment. (mean±sem; N=6-7; *P=0.049). (e) PAI-1 -/- MICE SHOW REDUCED NEOVASCULAR INGROWTH IN MATRIGEL PLUGS. Hemoglobin content in Matrigel plugs, 15 days after implantation into WT or PAI- 1 -/- mice treated with CTL-Ad1 (mean±sd; N=13-14; *P<0.001).

3 FIGURE S2 PAI-1 upar 16K upa FIGURE S2: Schematic outline of the PLA strategy for upa and 16K PRL. Proposed model of upar/upa/pai-1 and 16K PRL (16K) complex on the cell surface is shown. Primary antibodies for upa and 16K PRL raised in different species are used in the PLA assay (left), enabling juxtaposition of secondary, oligonucleotide-ligated antibodies (middle). Hybridization and ligation of connector oligos (middle) allows a rolling circle amplification detected by a cy3-probe (right).

4 FIGURE S3 FIGURE S3: 16K PRL binds PAI-1, upar and upa. (a,b) Western blotting (WB) for 16K PRL after immunoprecipitation (IP) of PAI-1 (a) or upar (b) from extracts of HUVECs incubated without (lanes 1 and 3) or with recombinant 16K PRL (lanes 2 and 4). Lane 5 shows recombinant 16K PRL loaded as positive control; lanes 1 and 2 show negative controls using mouse IgG as the IP control antibody. (c) Western blotting (WB) for upar after immunoprecipitation (IP) of 16K PRL from extracts of tumors grown in PAI-1 WT mice treated with 16K PRL adenovirus (16K-Ad1) or control virus (CTL-Ad1). (d,e) 16K PRL BINDS PAI-1/UPA COMPLEX. (d) Representative dose-response surface plasmon resonance sensorgrams of binding of PAI-1/uPA complex (250 nm - 2 µm, equimolar ratio) to immobilized 16K PRL. PAI-1/uPA complexes were incubated at equimolar ratio for 10 min at 37 C prior to loading onto a CM5 sensor chip (BIAcore). (e) Representative sensorgrams of binding of 500 nm of PAI-1 or 500 nm PAI-1 and upa to immobilized 16K PRL.

5 FIGURE S4 FIGURE S4: PAI-1 and upar sirna reduces PAI-1 expression in HUVECs. (a,b) qrt- PCR (a) and Western blot analysis (b) of PAI1 expression in HUVECs 48 hours (a) or 96 hours (b) after transfection with non-silencing sirna (CTL sirna) or with PAI-1 sirna. Ratio values in b represent the densitometric quantification of uparimmunoreactive bands normalized to the b-tubulin internal control and expressed as % of CTL sirna. (c) Western blotting for upar in HUVECs at 72 hours after transfection with control sirna (CTL sirna) or with upar sirna. The upper band corresponds to the glycosylated form. Ratio values represent the densitometric quantification of upar immunoreactive bands normalized to GAPDH internal control and expressed in % of CTL sirna). Data are mean±sd expressed relative to control; N=3; *P<0.05.

6 FIGURE S5 a b upar 16K PRL PAI-1 upa L R P FIGURE S5: (a) Inhibition of B16F10 tumor growth by 16K PRL is upa dependent. Growth curve of subcutaneously implanted B16F10 tumors in upa -/- mice treated with 16K PRL adenovirus (16K-Ad1) or control virus (CTL-Ad1) (mean±sem; N=5; P=NS). (b) Schematic representation of the 16K PRL complex with PAI-1,uPA, upar in interaction with LRP, proposed to mediate the anti-angiogenic activity of to 16K PRL CTL Ad1

7 16K PAI-1 PAI-1/16K PAI-1 PAI-1/Vn LPAI-1 LPAI-1/Vn FIGURE S6 a 16K PRL + IP: PAI-1, WB: 16K PRL b c FIGURE S6: 16K PRL inhibits PAI-1 s antiproteolytic activity in the presence of vitronectin. (a) Western blotting (WB) for 16K PRL after immunoprecipitation (IP) of wild type PAI-1 (PAI-1) or inactive latent PAI-1 (LPAI-1) from mixtures incubated in the presence or absence of vitronectin (Vn). Left panel: IP controls with only the indicated proteins. (b) Colorimetric determination of the proteolytic activity of upa on plasminogen (Plg) in the presence or absence of PAI-1, 16K PRL and vitronectin (Vn). Plasminogen activation was determined 4 hours after addition of a chromogenic substrate (mean±sd; N=3; *P=0.0016, **P=0.0001; a representative experiment of 3 repeat experiments is shown). (c) Representative dose-response surface plasmon resonance sensorgrams of binding of latent PAI-1 (250 nm - 2 µm) to immobilized 16K PRL.

8 FIGURE S7

9 FIGURE S7 FIGURE S7: 16K PRL has no effect on clot lysis in the absence of PAI-1 and inhibits thromboplastin-induced pulmonary embolism. (a) Lysis of human plasma clots by tpa (240 pm) in the absence of PAI-1, showing comparable clot lysis in the presence or absence of 16K PRL or buffer (CTL buffer). Plasma clots were prepared from pooled plasma collected from 6 healthy individuals. A representative experiment of 3 repeat experiments is shown. (b,c) Survival of BALB/c mice 15 min after thromboplastin injection to induce pulmonary embolism. Prior to embolism induction, the mice were treated with vehicle or recombinant 16K PRL (16K) for 5 min (b), or with control adenovirus (CTL-Ad1) or 16K PRL adenovirus (16K-Ad1) for 5 days (c). A contingency table listing the number and percentage of animals in each treatment/survival case is shown under the graphs.(d) Representative hematoxylin and eosin (H&E) staining of lungs from mice with induced thromboembolism, pretreated with CTL-Ad1 or 16K-Ad1. Thrombi are indicated by arrows. Scale bar, 200 µm. Quantification of emboli in lung sections is shown below (mean±sem; N=15; *p=0.001). (e) Survival of mice 15 min after thromboplastin injection in PAI- 1 WT or PAI-1 -/- mice. Prior to embolism induction, the mice were treated with CTL-Ad1 or 16K- Ad1 adenovirus for 5 days. A contingency is shown under the graph (f) Western blotting (WB) for 16K PRL after immunoprecipitation (IP) of endogenous PAI-1 from plasma of mice treated with recombinant 16K PRL or vehicle (left) or with 16K-Ad1 or CTL-Ad1 (right). (b,c,e) Fisher s exact test was performed to determine statistical differences between groups.

10 Table S1 Table S1. 16K PRL decreases reperfusion time and improves blood flow recovery in the carotid injury model. Five minutes before carotid injury, vehicle or 16K PRL (1.5 mg kg -1 ) was administered. Ten minutes after FeCl 3 injury-mediated occlusion, a bolus of unfractionated porcine heparin (200 U Kg -1 ) was administered followed by a continuous heparin infusion (70 U Kg -1 h -1 ). Ten minutes later, a continuous tpa infusion (100 µg kg -1 min -1 ) was started. Reperfusion time calculated as the time interval between tpa administration and blood flow restoration (return of carotid flow to 50% of baseline). A time value of 90 min was used for the conditions where no restoration of blood flow was observed (no lysis). Values per individual mouse are reported in the table along with overall flow recovery capacity (N=6; * P= vs vehicle in WT by Fisher s exact test).

Supplementary Figure 1 (A), (B), and (C) Docking of a physiologic ligand of integrin αvβ3, the tenth type III RGD domain of wild-type fibronectin

Supplementary Figure 1 (A), (B), and (C) Docking of a physiologic ligand of integrin αvβ3, the tenth type III RGD domain of wild-type fibronectin Supplementary Figure 1 (A), (B), and (C) Docking of a physiologic ligand of integrin αvβ3, the tenth type III RGD domain of wild-type fibronectin (A), D1-CD2 (B), and the D1-CD2 variant 3 (C) to Adomain

More information

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time

More information

Supplemental material

Supplemental material Supplemental material THE JOURNAL OF CELL BIOLOGY Gillespie et al., http://www.jcb.org/cgi/content/full/jcb.200907037/dc1 repressor complex induced by p38- Gillespie et al. Figure S1. Reduced fiber size

More information

Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated

Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated Supplementary Figure Legends Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated with either vehicle (left; n=3) or CCl 4 (right; n=3) were co-immunostained for NRP-1 (green)

More information

Single cell resolution in vivo imaging of DNA damage following PARP inhibition. Supplementary Data

Single cell resolution in vivo imaging of DNA damage following PARP inhibition. Supplementary Data Single cell resolution in vivo imaging of DNA damage following PARP inhibition Katherine S. Yang, Rainer H. Kohler, Matthieu Landon, Randy Giedt, and Ralph Weissleder Supplementary Data Supplementary Figures

More information

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). 1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well

More information

hnrnp D/AUF1 Rabbit IgG hnrnp M

hnrnp D/AUF1 Rabbit IgG hnrnp M Mouse IgG Goat IgG Rabbit IgG Mouse IgG hnrnp F Goat IgG Mouse IgG Kb 6 4 3 2 15 5 Supplementary Figure S1. In vivo binding of TERRA-bound RBPs to target RNAs. Immunoprecipitation (IP) assay using 3 mg

More information

Supplementary Figure 1 a. d 0.8 CON LPS PAN. 2nd ab nephrin podocin CON LPS PAN. upar. -tubulin. upar. upar / -tubulin CON LPS PAN

Supplementary Figure 1 a. d 0.8 CON LPS PAN. 2nd ab nephrin podocin CON LPS PAN. upar. -tubulin. upar. upar / -tubulin CON LPS PAN Supplementary Figure 1 a Efferent arteriole Podocytes Afferent arteriole FP Endothelium GBM Glomerular filtration barrier b 188kD HEK + GFP HEK + GFP-Nphs1 Differentiated Podocytes HEK + GFP HEK + GFP-Nphs2

More information

SUPPLEMENTAL MATERIAL. Supplemental Methods:

SUPPLEMENTAL MATERIAL. Supplemental Methods: SUPPLEMENTAL MATERIAL Supplemental Methods: Immunoprecipitation- As we described but with some modifications [22]. As part of another ongoing project, lysate from human umbilical vein endothelial cells

More information

Supplement Figure 1. Characterization of the moab. (A) A series of moabs that are anti-hαiib-specific were tested for their ability to bind to

Supplement Figure 1. Characterization of the moab. (A) A series of moabs that are anti-hαiib-specific were tested for their ability to bind to Supplement Figure 1. Characterization of the 312.8 moab. (A) A series of moabs that are anti-hαiib-specific were tested for their ability to bind to platelets. The black line represents the 312.8 moab

More information

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm

More information

a KYSE270-CON KYSE270-Id1

a KYSE270-CON KYSE270-Id1 a KYSE27-CON KYSE27- shcon shcon sh b Human Mouse CD31 Relative MVD 3.5 3 2.5 2 1.5 1.5 *** *** c KYSE15 KYSE27 sirna (nm) 5 1 Id2 Id2 sirna 5 1 sirna (nm) 5 1 Id2 sirna 5 1 Id2 [h] (pg per ml) d 3 2 1

More information

SUPPLEMENTAL FIGURES/TABLES:

SUPPLEMENTAL FIGURES/TABLES: SUPPLEMENTAL FIGURES/TABLES: Journal: Nature Biotechnology Article Title: Correction of the coagulation defect in hemophilia using a factor Xa variant with novel engineered protease function. Authors:

More information

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated

More information

Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in

Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in mouse NOD/SCID/Jak3 null mice were transplanted with human CD34 + hematopoietic stem cells. (Top) Four weeks after the transplantation

More information

* ** ** * IB: p-p90rsk. p90rsk (Ser380) (arbitrary units) (Ser380) p90rsk. IB: p90rsk. Tubulin. IB: Tubulin. Ang II (200 nm) Ang II (200 nm)

* ** ** * IB: p-p90rsk. p90rsk (Ser380) (arbitrary units) (Ser380) p90rsk. IB: p90rsk. Tubulin. IB: Tubulin. Ang II (200 nm) Ang II (200 nm) I: p-p9rsk I: p9rsk I: C I: p-p9rsk I: p9rsk 5 (ka) 5 5 (min) Ang II ( nm) p-p9rsk (Ser8) p9rsk p-p9rsk (Ser8) p9rsk (h) Mannitol 5 mm -Glucose 5 mm p9rsk (Ser8) (arbitrary units) p-p9rsk (Ser8) (arbitrary

More information

Supplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates

Supplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates Supplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates vascular calcification (VC). (a) Von Kossa staining shows that TSA potentiated the Pi-induced VC. Scale bar, 100

More information

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA

More information

Nature Medicine: doi: /nm.4169

Nature Medicine: doi: /nm.4169 Supplementary Fig.1. EC-specific deletion of Ccm3 by Cdh5-CreERT2. a. mt/mg reporter mice were bred with Cdh5CreERT2 deleter mice followed by tamoxifen feeding from P1 to P3. mg expression was specifically

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION (Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).

More information

Supplementary information. Supplementary Figures

Supplementary information. Supplementary Figures Supplementary information Supplementary Figures Supplementary Figure 1. A. i. HA-JMY expressing U2OS cells were treated with SAHA (6h). DAPI was used to visualise nuclei. ii. U2OS cells stably expressing

More information

J. Cell Sci. 128: doi: /jcs : Supplementary Material. Supplemental Figures. Journal of Cell Science Supplementary Material

J. Cell Sci. 128: doi: /jcs : Supplementary Material. Supplemental Figures. Journal of Cell Science Supplementary Material Supplemental Figures Figure S1. Trio controls endothelial barrier function. (A) TagRFP-shTrio constructs were expressed in ECs. Western blot shows efficient Trio knockdown in TagRFP-expressing ECs. (B)

More information

Supplementary Information Supplementary Figure 1

Supplementary Information Supplementary Figure 1 Supplementary Information Supplementary Figure 1 skeletal muscle lung (5 µg) Marker (KDa) +/+ +/+ -/- -/- -/- 17 13 7 55 MG53 4 35 25 Marker (KDa) 17 13 35 7 55 25 4 Supplementary Figure 1. The full scale

More information

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration /, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing

More information

Hossain_Supplemental Figure 1

Hossain_Supplemental Figure 1 Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Nakajima and Tanoue, http://www.jcb.org/cgi/content/full/jcb.201104118/dc1 Figure S1. DLD-1 cells exhibit the characteristic morphology

More information

0.9 5 H M L E R -C tr l in T w is t1 C M

0.9 5 H M L E R -C tr l in T w is t1 C M a. b. c. d. e. f. g. h. 2.5 C elltiter-g lo A ssay 1.1 5 M T S a s s a y Lum inescence (A.U.) 2.0 1.5 1.0 0.5 n s H M L E R -C tr l in C tr l C M H M L E R -C tr l in S n a il1 C M A bsorbance (@ 490nm

More information

Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy

Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy of various tumor type TRCs, including H22 (murine hepatocarcinoma) and CT26 (murine colon cancer). Bar, 50 µm. b, B16 cells

More information

AIP1 functions as an endogenous inhibitor of VEGFR2-mediated signaling and inflammatory angiogenesis

AIP1 functions as an endogenous inhibitor of VEGFR2-mediated signaling and inflammatory angiogenesis SUPPLEMENTAL MATERIALS functions as an endogenous inhibitor of VEGFR2-mediated signaling and inflammatory angiogenesis Haifeng Zhang 1*, Yun He 1*, Shengchuan Dai 1*, Zhe Xu 2*, Yan Luo 2, Ting Wan 2,

More information

STAT3 signaling controls satellite cell expansion and skeletal muscle repair

STAT3 signaling controls satellite cell expansion and skeletal muscle repair SUPPLEMENTARY INFORMATION STAT3 signaling controls satellite cell expansion and skeletal muscle repair Matthew Timothy Tierney 1 *, Tufan Aydogdu 2,3 *, David Sala 2, Barbora Malecova 2, Sole Gatto 2,

More information

Nature Immunology: doi: /ni.3101

Nature Immunology: doi: /ni.3101 Supplementary Figure 1 Generation of Plvap / mice. (a) Schematic presentation of the targeting construct as well as the wild-type and targeted Plvap alleles]. PuroR, puromycin resistance. The location

More information

monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in

monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal

More information

supplementary information

supplementary information DOI: 10.1038/ncb2172 Figure S1 p53 regulates cellular NADPH and lipid levels via inhibition of G6PD. (a) U2OS cells stably expressing p53 shrna or a control shrna were transfected with control sirna or

More information

Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.

Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. (a) A graphic depiction of the approach to determining the stability of

More information

Supplementary Figure 1. Botrocetin induces binding of human VWF to human

Supplementary Figure 1. Botrocetin induces binding of human VWF to human Supplementary Figure 1: Supplementary Figure 1. Botrocetin induces binding of human VWF to human platelets in the absence of elevated shear and induces platelet agglutination as detected by flow cytometry.

More information

Supplemental Figure 1. HepG2 cells were transfected with GLI luciferase reporter construct

Supplemental Figure 1. HepG2 cells were transfected with GLI luciferase reporter construct Supplemental Figure 1. HepG2 cells were transfected with GLI luciferase reporter construct (pgl38xgli), EWS-FLI1 luciferase reporter construct (NROB1-Luc) with or without GLI1, EWS- FLI1 and cdnas respectively.

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rainero et al., http://www.jcb.org/cgi/content/full/jcb.201109112/dc1 Figure S1. The expression of DGK- is reduced upon transfection

More information

Stargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression

Stargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression Supplementary Information Stargazin regulates AMPA receptor trafficking through adaptor protein complexes during long term depression Shinji Matsuda, Wataru Kakegawa, Timotheus Budisantoso, Toshihiro Nomura,

More information

Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and

Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2743 Figure S1 stabilizes cellular protein level, post-transcriptionally. (a, b) and DDR1 were RNAi-depleted from HEK.293.-CBG cells. Western blots with indicated antibodies (a). RT-PCRs

More information

Gene Sequence Fragment size ΔEGFR F 5' GGGCTCTGGAGGAAAAGAAAG GT 3' 116 bp R 5' CTTCTTACACTTGCGGACGC 3'

Gene Sequence Fragment size ΔEGFR F 5' GGGCTCTGGAGGAAAAGAAAG GT 3' 116 bp R 5' CTTCTTACACTTGCGGACGC 3' Supplementary Table 1: Real-time PCR primer sequences for ΔEGFR, wtegfr, IL-6, LIF and GAPDH. Gene Sequence Fragment size ΔEGFR F 5' GGGCTCTGGAGGAAAAGAAAG GT 3' 116 bp R 5' CTTCTTACACTTGCGGACGC 3' wtegfr

More information

GFP CCD2 GFP IP:GFP

GFP CCD2 GFP IP:GFP D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant

More information

Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various

Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various GST-tagged N-terminal truncated APP fragments including GST-APP full-length (FL), APP (123-695), APP (189-695), or

More information

Supplementary Figure 1. Antigens generated for mab development (a) K9M1P1-mIgG and hgh-k9m1p1 antigen (~37 kda) expression verified by western blot

Supplementary Figure 1. Antigens generated for mab development (a) K9M1P1-mIgG and hgh-k9m1p1 antigen (~37 kda) expression verified by western blot Supplementary Figure 1. Antigens generated for mab development (a) K9M1P1-mIgG and hgh-k9m1p1 antigen (~37 kda) expression verified by western blot (vector: ~25 kda). (b) Silver staining was used to assess

More information

Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides

Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides targeting RCP (SMARTPool (RCP) or two individual oligos (RCP#1

More information

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG. Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination

More information

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1 sirna and shrna mediated depletion of ATP7A results in loss of melanosomal ATP7A staining. a-h, sirna mediated ATP7A depletion. Immunofluorescence microscopy (IFM) analysis of ATP7A

More information

Kazuki N. Sugahara, Tambet Teesalu, Priya Prakash Karmali, Venkata Ramana Kotamraju, Lilach

Kazuki N. Sugahara, Tambet Teesalu, Priya Prakash Karmali, Venkata Ramana Kotamraju, Lilach Cancer Cell, Volume 16 Supplemental Data Tissue-Penetrating Delivery of Compounds and Nanoparticles into Tumors Kazuki N. Sugahara, Tambet Teesalu, Priya Prakash Karmali, Venkata Ramana Kotamraju, Lilach

More information

Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were. oligonucleotide spanning the NF-kB site (5 -GATCC-

Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were. oligonucleotide spanning the NF-kB site (5 -GATCC- SUPPLEMENTARY MATERIALS AND METHODS Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were prepared as previously described. (1) A [ 32 P] datp-labeled doublestranded oligonucleotide spanning

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice

More information

ASSAY METHODS FOR THE EXPLORATION OF FIBRINOLYSIS

ASSAY METHODS FOR THE EXPLORATION OF FIBRINOLYSIS ASSAY METHODS FOR THE EXPLORATION OF FIBRINOLYSIS Jean AMIRAL, President HYPHEN BioMed (France) Fibrinolysis Functions Neurology (brain) Fertility Cell Remodelling FIBRINOLYSIS Malignancy (metastasis)

More information

SUPPLEMENTARY MATERIALS

SUPPLEMENTARY MATERIALS SUPPLEMENTARY MATERIALS Supplementary Table S1: List of primers used for ChIP analysis and Oligo-pull-down assay. Genes Sequence mppargc1a FW 5 -GCGAGGTTTCTGCTTAGTCA-3 (-2317) RV 5 -ACAATGACTAAGCAGAAACCTCG-3

More information

Supplemental Data. Sethi et al. (2014). Plant Cell /tpc

Supplemental Data. Sethi et al. (2014). Plant Cell /tpc Supplemental Data Supplemental Figure 1. MYC2 Binds to the E-box but not the E1-box of the MPK6 Promoter. (A) E1-box and E-box (wild type) containing MPK6 promoter fragment. The region shown in red denotes

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature12138 Supplementary Figure 1. Knockdown of KRAS leads to a reduction in macropinocytosis. (a) KRAS knockdown in MIA PaCa-2 cells expressing KRASspecific shrnas

More information

Figure legends for supplement

Figure legends for supplement Figure legends for supplement Supplemental Figure 1 Characterization of purified and recombinant proteins Relevant fractions related the final stage of the purification protocol(bingham et al., 1998; Toba

More information

Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide,

Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, conjugated with either TAT or Myristic acid and biotin for

More information

HPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,

HPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, 1 HPV E oncoprotein targets histone methyltransferases for modulating specific gene transcription 3 5 Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, Cheng-Ming Chiang, Sheng-Chung

More information

Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand

Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin

More information

Supplementary Figure 1 Pfn1, but not other Pfn isoforms are expressed in

Supplementary Figure 1 Pfn1, but not other Pfn isoforms are expressed in Supplementary Figure 1 Pfn1, but not other Pfn isoforms are expressed in platelets. (a) RT-PCR of Pfn isoforms in control mouse platelets, Pfn1 -/- platelets and control heart. Expected band size for Pfn1

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figures Supplementary Figure 1. MLK1-4 phosphorylate MEK in the presence of RAF inhibitors. (a) H157 cells were transiently transfected with Flag- or HA-tagged MLK1-4

More information

Stabilization of the Transcription Factor Foxp3 by the Deubiquitinase USP7 Increases Treg-Cell-Suppressive Capacity

Stabilization of the Transcription Factor Foxp3 by the Deubiquitinase USP7 Increases Treg-Cell-Suppressive Capacity Immunity, Volume 39 Supplemental Information Stabilization of the Transcription Factor Foxp3 by the Deubiquitinase USP7 Increases Treg-Cell-Suppressive Capacity Jorg van Loosdregt, Veerle Fleskens, Juan

More information

Post-translational modification

Post-translational modification Protein expression Western blotting, is a widely used and accepted technique to detect levels of protein expression in a cell or tissue extract. This technique measures protein levels in a biological sample

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently

More information

Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with

Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with concentration of 800nM) were incubated with 1mM dgtp for the indicated

More information

SUPPLEMENTAL FIGURES AND TABLES

SUPPLEMENTAL FIGURES AND TABLES SUPPLEMENTAL FIGURES AND TABLES A B Flag-ALDH1A1 IP: α-ac HEK293T WT 91R 128R 252Q 367R 41/ 419R 435R 495R 412R C Flag-ALDH1A1 NAM IP: HEK293T + + - + D NAM - + + E Relative ALDH1A1 activity 1..8.6.4.2

More information

Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.

Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Scale bar represent 100 nm. The sizes of EVs from MDA-MB-231-D3H1 (D3H1),

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Bays et al., http://www.jcb.org/cgi/content/full/jcb.201309092/dc1 Figure S1. Specificity of the phospho-y822 antibody. (A) Total cell

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/429/ra54/dc1 Supplementary Materials for Dephosphorylation of the adaptor LAT and phospholipase C by SHP-1 inhibits natural killer cell cytotoxicity Omri Matalon,

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Antibodies Rabbit polyclonal VEGFR-1, VEGFR-2, Angiopoietin-1, Angiopoietin- 2 and GAPDH specific antibodies were from Santa Cruz Biotechnology. Rabbit polyclonal Akt1, Akt2, ps473

More information

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab. / 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG

More information

Methods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis

Methods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis Methods Western blot analysis of plg Wild-type mice first received a standardized burn wound and then were intravenously administered 2 mg of human plg (Omnio AB, Umeå, Sweden). 24 hours after wounding

More information

Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.

Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb. Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length

More information

Figure S1 is related to Figure 1B, showing more details of outer segment of

Figure S1 is related to Figure 1B, showing more details of outer segment of Supplemental Information Supplementary Figure legends and Figures Figure S1. Electron microscopic images in Sema4A +/+ and Sema4A / retinas Figure S1 is related to Figure 1B, showing more details of outer

More information

TE5 KYSE510 TE7 KYSE70 KYSE140

TE5 KYSE510 TE7 KYSE70 KYSE140 TE5 KYSE5 TT KYSE7 KYSE4 Supplementary Figure. Hockey stick plots showing input normalized, rank ordered H3K7ac signals for the candidate SE-associated lncrnas in this study. Rpm Rpm Rpm Chip-seq H3K7ac

More information

Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and

Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and SUPPLEMENTARY MATERIALS AND METHODS Chromatin Immunoprecipitation for qpcr analysis Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and IL24, all located on chromosome 1. Primer

More information

MLN8237 induces proliferation arrest, expression of differentiation markers and

MLN8237 induces proliferation arrest, expression of differentiation markers and Supplementary Figure Legends Supplementary Figure 1 827 induces proliferation arrest, expression of differentiation markers and polyploidization of a human erythroleukemia cell line with the activating

More information

Figure S6. Detection of anti-gfp antibodies in anti-dna and normal plasma without competition DNA--9

Figure S6. Detection of anti-gfp antibodies in anti-dna and normal plasma without competition DNA--9 Supplementary Information Ultrasensitive antibody detection by agglutination-pcr (ADAP) Cheng-ting Tsai 1 *, Peter V. Robinson 1 *, Carole A. Spencer 2 and Carolyn R. Bertozzi 3,4ǂ Department of 1 Chemistry,

More information

Ma, et al. Supplemental Data

Ma, et al. Supplemental Data Ma, et al Supplemental Data Title: Calpain mediates pulmonary vascular remodeling in rodent models of pulmonary hypertension and its inhibition attenuates pathologic features of disease Authors: Wanli

More information

A RRM1 H2AX DAPI. RRM1 H2AX DAPI Merge. Cont. sirna RRM1

A RRM1 H2AX DAPI. RRM1 H2AX DAPI Merge. Cont. sirna RRM1 A H2AX DAPI H2AX DAPI Merge Cont sirna Figure S1: Accumulation of RRM1 at DNA damage sites (A) HeLa cells were subjected to in situ detergent extraction without IR irradiation, and immunostained with the

More information

Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured

Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured in 90-Pa 3D fibrin gels for 5 days in the presence

More information

Coleman et al., Supplementary Figure 1

Coleman et al., Supplementary Figure 1 Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential

More information

Journal of Cell Science Supplementary Material

Journal of Cell Science Supplementary Material 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal

More information

Transcription Factor Runx3 Is Induced by Influenza A Virus and Double-Strand RNA and

Transcription Factor Runx3 Is Induced by Influenza A Virus and Double-Strand RNA and Transcription Factor Is Induced by Influenza A Virus and Double-Strand RNA and Mediates Airway Epithelial Cell Apoptosis Huachen Gan 1, Qin Hao 1, Steven Idell 1,2 & Hua Tang 1 1 Department of Cellular

More information

Nature Structural & Molecular Biology: doi: /nsmb.1583

Nature Structural & Molecular Biology: doi: /nsmb.1583 Acetylation by GCN5 regulates CDC6 phosphorylation in the S-phase of the cell cycle Roberta Paolinelli 1,2, Ramiro Mendoza-Maldonado 2, Anna Cereseto 1 and Mauro Giacca 2 1 Molecular Biology Laboratory,

More information

SUPPLEMENTAL INFROMATION

SUPPLEMENTAL INFROMATION SUPPLEMENTAL INFROMATION SUPPLEMENTAL EXPERIMENTAL PROCEDURES IP 1 accumulation - IP 1 accumulation was quantified using the HTRF IP-One kit (Cisbio Bioassys, Bedford, MA, USA) according to the manufacturer

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Nature Biotechnology: doi: /nbt Supplementary Figure 1 Supplementary Figure 1 Generation of the AARE-Gene system construct. (a) Position and sequence alignment of AAREs extracted from human Trb3, Chop or Atf3 promoters. AARE core sequences are boxed in grey.

More information

Supplementary Figure Legends. Figure-S1 Molecular basis of ASS1 deficiency in myxofibrosarcoma: (A)

Supplementary Figure Legends. Figure-S1 Molecular basis of ASS1 deficiency in myxofibrosarcoma: (A) Supplementary Figure Legends Figure-S1 Molecular basis of ASS1 deficiency in myxofibrosarcoma: (A) High-resolution oligonucleotide-based array comparative genomic hybridization shows normal DNA copy number

More information

hnrnp C promotes APP translation by competing with FMRP for APP mrna recruitment to P bodies

hnrnp C promotes APP translation by competing with FMRP for APP mrna recruitment to P bodies hnrnp C promotes APP translation by competing with for APP mrna recruitment to P bodies Eun Kyung Lee 1, Hyeon Ho Kim 1, Yuki Kuwano 1, Kotb Abdelmohsen 1, Subramanya Srikantan 1, Sarah S. Subaran 2, Marc

More information

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1 Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 4.52E-18 PDK1 6.77E-18 CSRP2 4.42E-17 PFKP 1.23E-14 MSH2 3.79E-13 NARF_A 5.56E-13 ADFP 5.56E-13 FAM13A1 1.56E-12 FAM29A_A 1.22E-11 CA9 1.54E-11

More information

isolated from ctr and pictreated mice. Activation of effector CD4 +

isolated from ctr and pictreated mice. Activation of effector CD4 + Supplementary Figure 1 Bystander inflammation conditioned T reg cells have normal functional suppressive activity and ex vivo phenotype. WT Balb/c mice were treated with polyi:c (pic) or PBS (ctr) via

More information

Grb2-Mediated Alteration in the Trafficking of AβPP: Insights from Grb2-AICD Interaction

Grb2-Mediated Alteration in the Trafficking of AβPP: Insights from Grb2-AICD Interaction Journal of Alzheimer s Disease 20 (2010) 1 9 1 IOS Press Supplementary Material Grb2-Mediated Alteration in the Trafficking of AβPP: Insights from Grb2-AICD Interaction Mithu Raychaudhuri and Debashis

More information

A group A Streptococcus ADP-ribosyltransferase toxin stimulates a protective IL-1β-dependent macrophage immune response

A group A Streptococcus ADP-ribosyltransferase toxin stimulates a protective IL-1β-dependent macrophage immune response A group A Streptococcus ADP-ribosyltransferase toxin stimulates a protective IL-1β-dependent macrophage immune response Ann E. Lin, Federico C. Beasley, Nadia Keller, Andrew Hollands, Rodolfo Urbano, Emily

More information

Profibrinolytic diabody targeting PAI-1 and TAFI for treatment of acute thrombotic disorders

Profibrinolytic diabody targeting PAI-1 and TAFI for treatment of acute thrombotic disorders ProFiDIΛ Profibrinolytic diabody targeting PAI-1 and TAFI for treatment of acute thrombotic disorders THROMBOLYSIS WITH IMPROVED SAFETY A valorisation project of Unmet Medical Need = Safe Thrombolysis

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed

More information

Supplementary Figure Legend

Supplementary Figure Legend Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Analyses of ECTRs by C-circle and T-circle assays.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Analyses of ECTRs by C-circle and T-circle assays. Supplementary Figure 1 Analyses of ECTRs by C-circle and T-circle assays. (a) C-circle and (b) T-circle amplification reactions using genomic DNA from different cell lines in the presence (+) or absence

More information

Nature Medicine: doi: /nm.4356

Nature Medicine: doi: /nm.4356 SUPPLEMENTARY FIGURES Supplementary Figure 1: Characterization of IVT mrna encoding highly active bsab. (a) IVT mrna quality and purity analysis on an Agilent 2100 Bioanalyzer. Full-length mrna peaks are

More information

transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1,

transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1, Supplementary Data Supplementary Figure Legends Supplementary Figure 1 FHL-mediated TGFβ-responsive reporter transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected

More information

Supplementary Figure Legends

Supplementary Figure Legends Supplementary Figure Legends Figure S1 gene targeting strategy for disruption of chicken gene, related to Figure 1 (f)-(i). (a) The locus and the targeting constructs showing HpaI restriction sites. The

More information