STAT3 signaling controls satellite cell expansion and skeletal muscle repair

Transcription

1 SUPPLEMENTARY INFORMATION STAT3 signaling controls satellite cell expansion and skeletal muscle repair Matthew Timothy Tierney 1 *, Tufan Aydogdu 2,3 *, David Sala 2, Barbora Malecova 2, Sole Gatto 2, Pier Lorenzo Puri 2,4, Lucia Latella 4,5 and Alessandra Sacco 2 1 Graduate School of Biomedical Sciences, Sanford-Burnham Medical Research Institute, North Torrey Pines Road, La Jolla, CA Development, Aging and Regeneration Program (DARe), Sanford-Burnham Medical Research Institute, North Torrey Pines Rd, La Jolla, CA 92037, USA 3 Life Sciences Solutions, Thermo Fisher Scientific, 5781 Van Allen Way, Carlsbad, CA 92008, USA 4 Epigenetics and Regenerative Medicine, IRCCS Fondazione Santa Lucia, Via del Fosso di Fiorano 64, Rome, Italy 5 Institute of Translational Pharmacology, National Research Council of Italy, Via Fosso del Cavaliere 100, Rome, Italy * These authors equally contributed to this work. Contents: Supplementary Figures 1-8 Supplementary Figure Legends Supplementary Table 1 Supplementary Methods Supplementary References

2 Supplementary Figure 1. STAT3 is transiently activated in SC during skeletal muscle regeneration. Representative images of uninjured and injured (notexin, NTX) tibialis anterior muscles of male, 2 mth C57BL/6 mice at 5 and 10 d after injury (green = Pax7, red = pstat3, white = Laminin, blue = Hoechst). Arrow indicates sublaminar Pax7 + pstat3 + SC, white arrowhead indicates a Pax7 pstat3 + SC. Scale bar, 20 µm. 2

3 Supplementary Figure 2. Stat3 promotes SC myogenic lineage progression. (a) Stat3 and Myod1 mrna levels in SC isolated from male, 2 mth C57BL/6 mice and infected with sh-stat3 or shcontrol and cultured in growth media for 72 h (n = 4). (b) Percentage of Pax7 + SC infected with sh- Stat3 or sh-control and cultured in growth media for 72 h (n = 2). (c) Representative images of TUNEL performed in SC infected with sh-stat3 or sh-control and cultured in growth media for 72 h (left). Quantification of the percentage of apoptotic TUNEL + nuclei upon sh-stat3 infection (n = 3, right). (d) Stat3 mrna levels in non-infected SC or infected with sh-stat3 or sh-control lentivirus were maintained in culture in growth media either in the absence or in the presence of recombinant Interleukin-6 (IL6) (100ng ml 1 ) for 96 h (n = 4). Data are represented as average ± s.e.m. Student s t test was used for all statistical analyses (***P < 0.001, **P < 0.01, *P < 0.05) except (d), where Oneway ANOVA with Tukey s post test was used. 3

4 Supplementary Figure 3. Stat3 regulates MyoD transcription. (a). Schematic representation of the Myod1-Luc reporter plasmid (top). Myod1 reporter plasmid transfected into 293 cells either alone or together with sh-stat3 (or sh-control) and Myod1 expression plasmids. Cells were cultured for 48 h in growth media after transfection before collection and analysis. Quantification of Firefly Luciferase activity normalized to Renilla luciferase (n = 7). (b) Chromatin ImmunoPrecipitation (ChIP) of H3K27Ac acetylation or IgG control in primary mouse myoblasts isolated from male, 2 mth C57BL/6 mice in the indicated regulatory regions: 590bp Myod1, +59bp Socs3, 1bp Oct4, +524bp Pdx1 and +1526bp IgH enhancer (n = 3). Graphs show H3K27Ac enrichment expressed as percentage of input DNA. (c) Quantification of Stat3 and Myod1 mrna levels in C2C12 myoblasts 96 h after infection with a lentivirus expressing sh-stat3 or sh-control (n = 3). (d) Western blotting of C2C12 cell extracts with the indicated antibodies after infection with a lentivirus expressing sh-stat3 or sh-control. Data 4

5 are represented as average ± s.e.m. Student s t test was used for all statistical analyses (***P < 0.001, **P < 0.01, *P < 0.05). 5

6 Supplementary Figure 4. Stat3 gene ablation does not break SC quiescence in healthy muscles. (a) Schematic representation of tamoxifen (tmx) treatment in male and female, 2-3 mth Pax7-CreER;STAT3 f/f and Pax7-CreER;STAT3 WT mice. EdU was administered daily for 5 d before harvesting. (b) Quantification of the percentage of Pax7 + SC isolated from uninjured skeletal muscles after 2 h in culture (n = 3). (c) Quantification of total SC number isolated from uninjured skeletal muscle of tmx-treated Pax7-CreER;STAT3 f/f and Pax7-CreER;STAT3 WT mice following culture in growth media for 96 h (n = 3). (d) Quantification of Pax7 + SC per mm 2 upon tmx treatment at either 2 or 3 mth of age (n = 3). (e) Representative images of uninjured skeletal muscle of tmx-treated Pax7- CreER;STAT3 f/f and Pax7-CreER;STAT3 WT mice (white = laminin). Scale bar, 100 µm (left). Quantification of average myofiber cross-sectional area (center) or their distribution (n = 3, right). 6

7 Data are represented as average ± s.e.m. Student s t test was used for all statistical analyses (***P < 0.001, **P < 0.01, *P < 0.05). 7

8 Supplementary Figure 5. Stat3 inhibitor treatment transiently increases the number of Pax7+ SC in the tissue, but does not affect mature myofibers. (a) Stat3, Myod1 and Socs3 mrna levels in SC isolated from male, 2 mth C57BL/6 mice and cultured for 96 h in the presence of vehicle (PBS) or 50 µm Stat3 inhibitor (n = 3). (b) Quantification of total SC number after culture in growth conditions for 96 h in the presence of vehicle (PBS) or Stat3 inhibitor (n = 10). (c) Schematic 8

9 representation of Stat3 inhibitor treatment and skeletal muscle injury in male, 2 mth wild-type mice for SC analysis at 5 d post-injury. (d) Representative images of Pax7 + SC in regenerating muscles, treated with Stat3 inhibitor or vehicle (PBS), 5 d post-injury (green = Pax7, white = Laminin, blue = nuclei). Scale bar, 20 µm (left). Quantification of Pax7 + SC per mm 2 (n = 3, right). (e) Schematic representation of Stat3 inhibitor treatment in uninjured muscles. (f) Representative images of hematoxylin and eosin staining of skeletal muscles 4 d after treatment. Scale bar, 50 µm (left). Quantification of average myofiber cross-sectional area (center) or their distribution (n = 3, right). Data are represented as average ± s.e.m. Student s t test was used for all statistical analyses (***P < 0.001, *P < 0.05). 9

10 Supplementary Figure 6. Stat3 transient inhibition enhances skeletal muscle tissue repair in aged muscles. (a) Quantification of myofiber cross sectional area distribution from male, 2 mth and 24 mth wild-type mice 5 d post-injury and treated with the Stat3 inhibitor or vehicle (PBS) (n = 3). (b) Representative images of hematoxylin and eosin staining of skeletal muscles from 2 mth and 24 mth wild-type mice 25 d post-injury, treated with the Stat3 inhibitor or vehicle (PBS). Scale bar, 50µm. (c) 10

11 Quantification of average myofiber cross-sectional area from male, 2 mth and 24 mth wild-type mice 25 d post-injury treated with the Stat3 inhibitor or vehicle (PBS) (n = 3). (d) Quantification of myofiber cross-sectional area distribution from male, 2 mth and 24 mth wild-type mice 25 d post-injury, treated with the Stat3 inhibitor or vehicle (PBS) (n = 3). Data are represented as average ± s.e.m. Student s t test was used for all statistical analyses (**P < 0.01, *P < 0.05). 11

12 Supplementary Figure 7. Stat3 inhibition enhances skeletal muscle tissue repair in dystrophic muscles. Quantification of myofiber cross-sectional area distribution from male, 2 mth mx/mtr G2 mice at 28 d, treated with the Stat3 inhibitor or vehicle (PBS) (n = 3). Data are represented as average ± s.e.m. Student s t test was used for all statistical analyses (*P < 0.05). 12

13 Supplementary Figure 8. The effects of STAT3 inhibitor treatment is conserved in human muscle cells. (a) Representative immunofluorescence images of pstat3 in human myoblasts isolated from the quadriceps of patients yr of age and treated with the Stat3 inhibitor or vehicle for 72 h (blue = pstat3, white = nuclei). (b) Representative immunofluorescence images of TUNEL in human myoblasts treated with the Stat3 inhibitor or vehicle for 72 h (red = TUNEL, white = nuclei). (c) Representative immunofluorescence images of differentiated cultures of human myoblasts treated with the Stat3 inhibitor or vehicle in both growth and differentiation media (GM, then DM), or only in growth media and then switched to differentiation in the absence of Stat3 inhibitor (GM only) (red = myosin heavy chain, green = EdU, white = nuclei). Scale bar, 200 µm (left). Quantification of differentiation index in the three experimental conditions (n = 4). Data are represented as average±s.e.m. Student s t test was used for all statistical analyses. Student s t test was used for all statistical analyses (P > 0.05). 13

14 Supplementary Table 1. Primer sequences for RNA qpcr analysis and ChIP experiments. Myod1 fwd ggctacgacaccgcctacta rev cgactctggtggtgcatctg Socs3 fwd tgcaggagagcggattctac rev tgacgctcaacgtgaagaag Stat3 fwd tgaaggtggtggagaacctc rev gctgctgcatcttctgtctg Gapdh fwd tgcaccaccaactgcttag rev ggatgcagggatgatgttc Myod1 590bp ChIP fwd acagcgctggggttctaagc rev agcaagcctggcacaaatga Socs3 +59bp ChIP fwd cgcgcacagcctttcagtg rev tttacccggccagtacgcc Oct4 +1bp ChIP fwd agaggtgaaaccgtcccta rev gtgagaaggcgaagtctgaa Pdx1 +524bp ChIP fwd ctggctctttctccctttctc rev cgggtttcagaggaacttgt IgH +1526bp ChIP fwd aaccacagctacaagtttacc rev aaccagaacacctgcagcagc 14