Towards deep mechanistic neural networks for multi-omits modeling. Ameen Eetemadi Tagkopoulos Lab, UC Davis

Size: px
Start display at page:

Download "Towards deep mechanistic neural networks for multi-omits modeling. Ameen Eetemadi Tagkopoulos Lab, UC Davis"

Transcription

1 Towards deep mechanistic neural networks for multi-omits modeling. Ameen Eetemadi Tagkopoulos Lab, UC Davis

2 Outline Introduction Motivation Recent work Method (TRNN) Approach Architecture Optimization Results Conclusion

3 Movivation GOAL: Predict cellular state and behavior from environmental settings and genetic background of the cell. Genome-scale model Image credit: Erik Jacobsen, Covert Lab

4 Movivation GOAL: Predict cellular state and behavior from environmental settings and genetic background of the cell. Synthetic biology Genome-scale model Metabolic engineering Test gene circuit in host cell without experiment Image credit: Erik Jacobsen, Covert Lab

5 Movivation GOAL: Predict cellular state and behavior from environmental settings and genetic background of the cell. Synthetic biology Genome-scale model Metabolic engineering Test gene circuit in host cell without experiment Find environment that maximizes engineered products Image credit: Erik Jacobsen, Covert Lab

6 Movivation GOAL: Predict cellular state and behavior from environmental settings and genetic background of the cell. Synthetic biology Genome-scale model Metabolic engineering Test gene circuit in host cell without experiment Find environment that maximizes engineered products Image credit: Erik Jacobsen, Covert Lab Predictive medicine Optimization of antibiotic effect from ~100 existing antibiotics

7 Movivation GOAL: Predict cellular state and behavior from environmental settings and genetic background of the cell. Synthetic biology Genome-scale model Metabolic engineering Test gene circuit in host cell without experiment Find environment that maximizes engineered products Image credit: Erik Jacobsen, Covert Lab Predictive medicine Guided experimentation Optimization of antibiotic effect from ~100 existing antibiotics Find the conditions with highest uncertainty

8 Recent work (ECOMICS) - Data Most comprehensive compendium for an organism M. Kim, N. Rai, V. Zorraquino, and I. Tagkopoulos, Multi-omics integration accurately predicts cellular state in unexplored conditions for Escherichia coli, Nature communications (2016)

9 Recent work (ECOMICS) Predictive Model M. Kim, N. Rai, V. Zorraquino, and I. Tagkopoulos, Multi-omics integration accurately predicts cellular state in unexplored conditions for Escherichia coli, Nature communications (2016)

10 Recent work (ECOMICS) Predictive Model M. Kim, N. Rai, V. Zorraquino, and I. Tagkopoulos, Multi-omics integration accurately predicts cellular state in unexplored conditions for Escherichia coli, Nature communications (2016)

11 Outline Introduction Motivation Recent work Method (TRNN) Approach Architecture Training Results Conclusion

12 Approach Transcription Regulatory Neural Network (TRNN) How to Integrate: 1) Transcription regulatory network 2) Transcription Thermodynamics 3) Transcription profiles

13 Approach Transcription Regulatory Neural Network (TRNN) How to Integrate: 1) Transcription regulatory network 2) Transcription Thermodynamics 3) Transcription profiles

14 Approach Transcription Regulatory Neural Network (TRNN) How to Integrate: 1) Transcription regulatory network 2) Transcription Thermodynamics 3) Transcription profiles Understanding Sentences Words Alphabet

15 Architecture TRNN Activation Function (Alphabet) 1 Concentration of TFs 2 Computational Unit 3 mrna concentration (initial prediction) # $ 1 # ' 2!(# $,, # ' ) ) *(+,,), 4 4 Perturbation 5 Decision Unit 6 mrna concentration (adjusted prediction) Example:! # $, # - # $ + = h $ = h *(+,,) $ + z =, + # $6: : h - = h - (a), {0, 1} )

16 Architecture TRNN Gene Module (Word) Words + + +!(#) B C B $ #!(#) + # $ # -!(# $, # - ) B -

17 Architecture TRNN Gene Circuit (Sentence) Sentences (a) # ) B $ B $ + (b) # B $ B - + ) # $ ) $ # B - (c) B $ ) - (d) B C B $ ) $ ) E B $ ) - # D B $

18 Training Strategy Issue: backpropagation is very sensitive to initial values Strategy: Step1: train individual modules separately through a customized LP based method Step2: train full network together Use full-batch, conjugate gradient

19 Training Individual Modules Algorithm 1: Fit f, given C Input : C = {x 1, x 2, y} Output: = {t 0,t 1,t 2,b 1,b 2,p 1,p 2} 1 initialize p =[p 1,p 2]; 2 while loss (C) is not converged do 3 w ArgMin A.w y 1 1, s.t. b i 0; w i 4 hw p ; 5 for j 1:2do 6 j loss (C) ; 7 p j p j. p j ; 8 end i 9 hw p ; 10 end 11 return mx loss (C) = [f ( x i 1, x i 2 ) i= i i 4 5 x 1, i h 1 = e p 1 h 2 = e p 2 i x i y] apple A = i i 1 h 1 ( h 1 y) h2 ( h 2 y) : entry-wise vector multiplication,

20 Outline Introduction Motivation Recent work Method (TRNN) Approach Architecture Training Results Datasets Comparison Conclusion

21 Dataset 46 different datasets: Multiple candidate networks extracted from DREAM4 challenge Number of genes for each network range from 3 to 9. Synthetic data generated thermodynamic simulation Gene Knockouts Parameter perturbations (e.g. transcription rate, binding affinity of TFs, etc.) Different noise levels Validation Mean Squared Error 5-Fold cross validation Comparison with common ANN architectures

22 Results Overall MSE Comparison TRNN 0.03 MLP MLP MLP Average difference of MSE from best performing method in each dataset

23 Outline Introduction Motivation Recent work Method Approach Architecture Training Results Datasets Comparison Conclusion

24 Conclusion TRNN, is a deep learning based framework for prediction of steady state mrna concentration levels under perturbation. TRNN, requires specialized training due to it s architecture. Evaluation of TRNN on real data is key next step. For scaling up TRNN to genome scale modelling, we will make use of highly parallel computation provided by the cluster.

CS 5984: Topics and Schedule

CS 5984: Topics and Schedule CS 5984: and Schedule T. M. Murali January 19, 2006 T. M. Murali January 19, 2006 CS 5984: and Schedule Continuum of Models in Systems Biology From Building with a scaffold: emerging strategies for high-

More information

Identifying Signaling Pathways. BMI/CS 776 Spring 2016 Anthony Gitter

Identifying Signaling Pathways. BMI/CS 776  Spring 2016 Anthony Gitter Identifying Signaling Pathways BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2016 Anthony Gitter gitter@biostat.wisc.edu Goals for lecture Challenges of integrating high-throughput assays Connecting relevant

More information

Inference in Metabolic Network Models using Flux Balance Analysis

Inference in Metabolic Network Models using Flux Balance Analysis Inference in Metabolic Network Models using Flux Balance Analysis BMI/CS 776 www.biostat.wisc.edu/bmi776/ Mark Craven craven@biostat.wisc.edu Spring 2011 Goals for Lecture the key concepts to understand

More information

CS273B: Deep learning for Genomics and Biomedicine

CS273B: Deep learning for Genomics and Biomedicine CS273B: Deep learning for Genomics and Biomedicine Lecture 2: Convolutional neural networks and applications to functional genomics 09/28/2016 Anshul Kundaje, James Zou, Serafim Batzoglou Outline Anatomy

More information

Using Synthetic Biology to Identify a Human Papillomavirus Infection

Using Synthetic Biology to Identify a Human Papillomavirus Infection Using Synthetic Biology to Identify a Human Papillomavirus Infection Lactoguard Byron Alexander Jacobs Computational and Applied Mathematics Honours, School of Computational and Applied Mathematics, University

More information

Gene Signature Lab: Exploring integrative LINCS (ilincs) Data and Signatures Analysis Portal & Other LINCS Resources

Gene Signature Lab: Exploring integrative LINCS (ilincs) Data and Signatures Analysis Portal & Other LINCS Resources Gene Signature Lab: Exploring integrative LINCS (ilincs) Data and Signatures Analysis Portal & Other LINCS Resources Jarek Meller, PhD BD2K-LINCS Data Coordination and Integration Center University of

More information

The Integrated Biomedical Sciences Graduate Program

The Integrated Biomedical Sciences Graduate Program The Integrated Biomedical Sciences Graduate Program at the university of notre dame Cutting-edge biomedical research and training that transcends traditional departmental and disciplinary boundaries to

More information

BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis

BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology Lecture 2: Microarray analysis Genome wide measurement of gene transcription using DNA microarray Bruce Alberts, et al., Molecular Biology

More information

Technical University of Denmark

Technical University of Denmark 1 of 13 Technical University of Denmark Written exam, 15 December 2007 Course name: Introduction to Systems Biology Course no. 27041 Aids allowed: Open Book Exam Provide your answers and calculations on

More information

Inferring Gene-Gene Interactions and Functional Modules Beyond Standard Models

Inferring Gene-Gene Interactions and Functional Modules Beyond Standard Models Inferring Gene-Gene Interactions and Functional Modules Beyond Standard Models Haiyan Huang Department of Statistics, UC Berkeley Feb 7, 2018 Background Background High dimensionality (p >> n) often results

More information

BIOLOGY 101. CHAPTER 18: Gene Expression: Turning genes on and off

BIOLOGY 101. CHAPTER 18: Gene Expression: Turning genes on and off BIOLOGY 101 CHAPTER 18: Gene Expression: Turning genes on and off BACTERIAL TRANSFORMATION: Bacteria have the ability to pick up DNA from their surroundings and transcribe it as if it was their own. When

More information

Our website:

Our website: Biomedical Informatics Summer Internship Program (BMI SIP) The Department of Biomedical Informatics hosts an annual internship program each summer which provides high school, undergraduate, and graduate

More information

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

BIOT 107: BIOTECHNOLOGY: TRANSFORMING SOCIETY THROUGH BIOLOGY

BIOT 107: BIOTECHNOLOGY: TRANSFORMING SOCIETY THROUGH BIOLOGY BIOT 107: Biotechnology: Transforming Society Through Biology 1 BIOT 107: BIOTECHNOLOGY: TRANSFORMING SOCIETY THROUGH BIOLOGY Discipline BIOT - Biotechnology Course Number 107 Course Title Biotechnology:

More information

BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM)

BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) PROGRAM TITLE DEGREE TITLE Master of Science Program in Bioinformatics and System Biology (International Program) Master of Science (Bioinformatics

More information

Era with Computational Biology/Toxicology

Era with Computational Biology/Toxicology USM Seminar 1/22/2010 Embracing the Post-Omics Era with Computational Biology/Toxicology Ping Gong Environmental Genomics and Genetics (EGG) Team @ Environmental Laboratory Outline Introduction Bioinformatics

More information

Neural Networks and Applications in Bioinformatics. Yuzhen Ye School of Informatics and Computing, Indiana University

Neural Networks and Applications in Bioinformatics. Yuzhen Ye School of Informatics and Computing, Indiana University Neural Networks and Applications in Bioinformatics Yuzhen Ye School of Informatics and Computing, Indiana University Contents Biological problem: promoter modeling Basics of neural networks Perceptrons

More information

Neural Networks and Applications in Bioinformatics

Neural Networks and Applications in Bioinformatics Contents Neural Networks and Applications in Bioinformatics Yuzhen Ye School of Informatics and Computing, Indiana University Biological problem: promoter modeling Basics of neural networks Perceptrons

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Gene Network Inference and Expression Prediction Using Recurrent Neural Networks and Evolutionary Algorithms

Gene Network Inference and Expression Prediction Using Recurrent Neural Networks and Evolutionary Algorithms Brigham Young University BYU ScholarsArchive All Theses and Dissertations 2010-12-10 Gene Network Inference and Expression Prediction Using Recurrent Neural Networks and Evolutionary Algorithms Heather

More information

Editorial. Current Computational Models for Prediction of the Varied Interactions Related to Non-Coding RNAs

Editorial. Current Computational Models for Prediction of the Varied Interactions Related to Non-Coding RNAs Editorial Current Computational Models for Prediction of the Varied Interactions Related to Non-Coding RNAs Xing Chen 1,*, Huiming Peng 2, Zheng Yin 3 1 School of Information and Electrical Engineering,

More information

Computational Genomics. Reconstructing signaling and dynamic regulatory networks

Computational Genomics. Reconstructing signaling and dynamic regulatory networks 02-710 Computational Genomics Reconstructing signaling and dynamic regulatory networks Input Output Hidden Markov Model Input (Static transcription factorgene interactions) Bengio and Frasconi, NIPS 1995

More information

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005 Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of

More information

Learning Bayesian Network Models of Gene Regulation

Learning Bayesian Network Models of Gene Regulation Learning Bayesian Network Models of Gene Regulation CIBM Retreat October 3, 2003 Keith Noto Mark Craven s Group University of Wisconsin-Madison CIBM Retreat 2003 Poster Session p.1/18 Abstract Our knowledge

More information

Data Mining and Applications in Genomics

Data Mining and Applications in Genomics Data Mining and Applications in Genomics Lecture Notes in Electrical Engineering Volume 25 For other titles published in this series, go to www.springer.com/series/7818 Sio-Iong Ao Data Mining and Applications

More information

An integrative, multi-scale genome-wide model reveals the phenotypic landscape of Escherichia coli

An integrative, multi-scale genome-wide model reveals the phenotypic landscape of Escherichia coli An integrative, multi-scale genome-wide model reveals the phenotypic landscape of Escherichia coli Javier Carrera, 1,4 Raissa Estrela, 2 Jing Luo, 1 Navneet Rai, 1 Athanasios Tsoukalas, 1,3 Ilias Tagkopoulos,

More information

Ingenuity Pathway Analysis (IPA )

Ingenuity Pathway Analysis (IPA ) Ingenuity Pathway Analysis (IPA ) For the analysis and interpretation of omics data IPA is a web-based software application for the analysis, integration, and interpretation of data derived from omics

More information

REPORT DOCUMENTATION PAGE

REPORT DOCUMENTATION PAGE REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704-0188 Public reporting burden for this collection of information is estimated to average 1 hour per response, including the time for reviewing instructions,

More information

Biotechnology (Chapter 20) Objectives

Biotechnology (Chapter 20) Objectives Biotechnology (Chapter 20) Objectives Understand the background science behind the technology applications Understand the tools and details of the technology Develop familiarity with performing the select

More information

Computer Aided Design of Synthetic Biological Systems Using Standardized Parts

Computer Aided Design of Synthetic Biological Systems Using Standardized Parts Computer Aided Design of Synthetic Biological Systems Using Standardized Parts Douglas Densmore* CHESS Seminar 11/18/08 *in cooperation with Prof. J. Christopher Anderson and Prof. Chris Voigt Outline

More information

Synthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design.

Synthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design. Synthetic Biology Accelerating Discoveries, Expanding Possibilities Sustainable Energy Therapeutics Industrial Enzymes Agriculture Design Build Generate Solutions to Advance Synthetic Biology Research

More information

Gene function prediction. Computational analysis of biological networks. Olga Troyanskaya, PhD

Gene function prediction. Computational analysis of biological networks. Olga Troyanskaya, PhD Gene function prediction Computational analysis of biological networks. Olga Troyanskaya, PhD Available Data Coexpression - Microarrays Cells of Interest Known DNA sequences Isolate mrna Glass slide Resulting

More information

CSC 121 Computers and Scientific Thinking

CSC 121 Computers and Scientific Thinking CSC 121 Computers and Scientific Thinking Fall 2005 Computers in Biology and Bioinformatics 1 Biology biology is roughly defined as "the study of life" it is concerned with the characteristics and behaviors

More information

3/11/10. Genetic Circuits. Edge Detection. Genetic Edge Detection Algorithm. Goal. What I cannot create I do not understand.

3/11/10. Genetic Circuits. Edge Detection. Genetic Edge Detection Algorithm. Goal. What I cannot create I do not understand. What I cannot create I do not understand. ~Richard Feynman A Synthetic Genetic Edge Detection Program Tabor JJ, Salis HM, Simpson ZB, Chevalier AA, Levskaya A, Marcotte EM, Voigt CA, Ellington AD Cell.

More information

Network System Inference

Network System Inference Network System Inference Francis J. Doyle III University of California, Santa Barbara Douglas Lauffenburger Massachusetts Institute of Technology WTEC Systems Biology Final Workshop March 11, 2005 What

More information

Positional Preference of Rho-Independent Transcriptional Terminators in E. Coli

Positional Preference of Rho-Independent Transcriptional Terminators in E. Coli Positional Preference of Rho-Independent Transcriptional Terminators in E. Coli Annie Vo Introduction Gene expression can be regulated at the transcriptional level through the activities of terminators.

More information

Identification of biological themes in microarray data from a mouse heart development time series using GeneSifter

Identification of biological themes in microarray data from a mouse heart development time series using GeneSifter Identification of biological themes in microarray data from a mouse heart development time series using GeneSifter VizX Labs, LLC Seattle, WA 98119 Abstract Oligonucleotide microarrays were used to study

More information

BIOCHEM + MOLE BIOLOGY- BC (BC)

BIOCHEM + MOLE BIOLOGY- BC (BC) Biochem + Mole Biology-BC (BC) 1 BIOCHEM + MOLE BIOLOGY- BC (BC) Courses BC 192 Biochemistry Freshman Seminar Credits: 2 (1-0-1) Introduction to curriculum and career options for biochemistry majors. Registration

More information

Gut microbial colonization in day old chicks. Henri Woelders DirkJan Schokker Mari A. Smits

Gut microbial colonization in day old chicks. Henri Woelders DirkJan Schokker Mari A. Smits Gut microbial colonization in day old chicks Henri Woelders DirkJan Schokker Mari A. Smits Trends Robustness; Resilience. Ability to keep healthy, or recover from disease (with minimal human intervention).

More information

1. Page 90: Cellular Metabolism Explain what the everyday use of the word metabolism means to you.

1. Page 90: Cellular Metabolism Explain what the everyday use of the word metabolism means to you. Biology 100 Winter 2013 North Seattle Community College Reading Guide 10 Metabolism, Enzymes, and Building a Protein Reading: 1) Chapter 5 (various pages) in Microbiology Demystified 2) Chapter 7 (various

More information

A study on the robustness of strain optimization algorithms

A study on the robustness of strain optimization algorithms A study on the robustness of strain optimization algorithms Paulo Vilaça, Paulo Maia, and Miguel Rocha Abstract In recent years, there have been considerable advances in the use of genome-scale metabolic

More information

A Simple Approach to Study Designs in Complex Biochemical Pathways

A Simple Approach to Study Designs in Complex Biochemical Pathways Symposium on Complexity & Computation in the Natural Sciences A Simple Approach to Study Designs in Complex Biochemical Pathways SOMDATTA SINHA Centre for Cellular and Molecular Biology (CSIR) Hyderabad

More information

CS 5854: Predictive Models of Transcriptional Regulatory Networks

CS 5854: Predictive Models of Transcriptional Regulatory Networks CS 5854: Predictive Models of Transcriptional Regulatory Networks T. M. Murali February 28, Mar 5, 7, 2013 Predicting Transcriptional Control Networks 1. Integrated biclustering of heterogeneous genome-wide

More information

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology. G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic

More information

Discovery of Transcription Factor Binding Sites with Deep Convolutional Neural Networks

Discovery of Transcription Factor Binding Sites with Deep Convolutional Neural Networks Discovery of Transcription Factor Binding Sites with Deep Convolutional Neural Networks Reesab Pathak Dept. of Computer Science Stanford University rpathak@stanford.edu Abstract Transcription factors are

More information

Intro to Microarray Analysis. Courtesy of Professor Dan Nettleton Iowa State University (with some edits)

Intro to Microarray Analysis. Courtesy of Professor Dan Nettleton Iowa State University (with some edits) Intro to Microarray Analysis Courtesy of Professor Dan Nettleton Iowa State University (with some edits) Some Basic Biology Genes are DNA sequences that code for proteins. (e.g. gene lengths perhaps 1000

More information

HST MEMP TQE Concentration Areas ~ Approved Subjects Grid

HST MEMP TQE Concentration Areas ~ Approved Subjects Grid HST MEMP TQE Concentration Areas ~ Approved Subjects Grid Aeronautics and Astronautics Biological Engineering Brain and Cognitive Sciences Chemical Engineering 2.080J; 2.183J; choose BOTH choose ONE choose

More information

Bioinformatics & Protein Structural Analysis. Bioinformatics & Protein Structural Analysis. Learning Objective. Proteomics

Bioinformatics & Protein Structural Analysis. Bioinformatics & Protein Structural Analysis. Learning Objective. Proteomics The molecular structures of proteins are complex and can be defined at various levels. These structures can also be predicted from their amino-acid sequences. Protein structure prediction is one of the

More information

AP Biology Gene Expression/Biotechnology REVIEW

AP Biology Gene Expression/Biotechnology REVIEW AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.

More information

Non-coding Function & Variation, MPRAs II. Mike White Bio /5/18

Non-coding Function & Variation, MPRAs II. Mike White Bio /5/18 Non-coding Function & Variation, MPRAs II Mike White Bio 5488 3/5/18 MPRA Review Problem 1: Where does your CRE DNA come from? DNA synthesis Genomic fragments Targeted regulome capture Problem 2: How do

More information

Coherent Feed Forward Loops

Coherent Feed Forward Loops Coherent Feed Forward Loops Dr. M. Vijayalakshmi School of Chemical and Biotechnology SASTRA University Joint Initiative of IITs and IISc Funded by MHRD Page 1 of 10 Table of Contents 1 INTRODUCTION...

More information

Bi 1x Spring 2016: LacI Titration

Bi 1x Spring 2016: LacI Titration Bi 1x Spring 2016: LacI Titration 1 Overview In this experiment, you will measure the effect of various mutated LacI repressor ribosome binding sites in an E. coli cell by measuring the expression of a

More information

Bioinformatics Programming and Analysis CSC Dr. Garrett Dancik

Bioinformatics Programming and Analysis CSC Dr. Garrett Dancik Bioinformatics Programming and Analysis CSC 315-01 Dr. Garrett Dancik What is bioinformatics Bioinformatics: Biology + information the study and utilization of methods for storing, retrieving and analyzing

More information

Condition-specific regulation of mrna stability in yeast

Condition-specific regulation of mrna stability in yeast Condition-specific regulation of mrna stability in yeast Harmen J. Bussemaker Department of Biological Sciences & C2B2 Columbia University, New York City Gene Upstream Region Cis-Regulatory Elements

More information

The HPC-Life Sciences scenario Byte vs Flop?

The HPC-Life Sciences scenario Byte vs Flop? www.bsc.es The HPC-Life Sciences scenario Byte vs Flop? Modesto Orozco Henry Markram, Erik Lindahl, Paolo Carloni, Alfonso Valencia Richard Lavery, Peter Coveney, Charles Laughton Exascale for Life Sciences

More information

Giri Narasimhan. CAP 5510: Introduction to Bioinformatics. ECS 254; Phone: x3748

Giri Narasimhan. CAP 5510: Introduction to Bioinformatics. ECS 254; Phone: x3748 CAP 5510: Introduction to Bioinformatics Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs07.html 2/8/07 CAP5510 1 Pattern Discovery 2/8/07 CAP5510 2 What we have

More information

NIH Public Access Author Manuscript Nat Biotechnol. Author manuscript; available in PMC 2011 June 6.

NIH Public Access Author Manuscript Nat Biotechnol. Author manuscript; available in PMC 2011 June 6. NIH Public Access Author Manuscript Published in final edited form as: Nat Biotechnol. 2010 March ; 28(3): 245 248. doi:10.1038/nbt.1614. What is flux balance analysis? Jeffrey D. Orth, University of California

More information

Page 70 Monday December 8, 2014

Page 70 Monday December 8, 2014 replication and Monday December 8, 0 Notebook check 8: Page 69, DNA Technology Introduction Worksheet. The process by which a foreign gene is replicated by insertion into a bacterium is called genetic

More information

Genetic Engineering for Biofuels Production

Genetic Engineering for Biofuels Production Genetic Engineering for Biofuels Production WSE 573 Spring 2013 Greeley Beck INTRODUCTION Alternative transportation fuels are needed in the United States because of oil supply insecurity, oil price increases,

More information

BIOINFORMATICS THE MACHINE LEARNING APPROACH

BIOINFORMATICS THE MACHINE LEARNING APPROACH 88 Proceedings of the 4 th International Conference on Informatics and Information Technology BIOINFORMATICS THE MACHINE LEARNING APPROACH A. Madevska-Bogdanova Inst, Informatics, Fac. Natural Sc. and

More information

Functional Genomics Research Stream

Functional Genomics Research Stream Functional Genomics Research Stream Research Meeting: January 19, 2010 Introduction, Policy Discussion & Scientific Writing histone occupancy histone occupancy histone modification histone occupancy histone

More information

Bio-inspired Active Vision. Martin Peniak, Ron Babich, John Tran and Davide Marocco

Bio-inspired Active Vision. Martin Peniak, Ron Babich, John Tran and Davide Marocco Bio-inspired Active Vision Martin Peniak, Ron Babich, John Tran and Davide Marocco GPU Computing Lab Traditional Computer Vision 3 Traditional Computer Vision Teaching a computer to classify objects has

More information

Gene Reduction for Cancer Classification using Cascaded Neural Network with Gene Masking

Gene Reduction for Cancer Classification using Cascaded Neural Network with Gene Masking Gene Reduction for Cancer Classification using Cascaded Neural Network with Gene Masking Raneel Kumar, Krishnil Chand, Sunil Pranit Lal School of Computing, Information, and Mathematical Sciences University

More information

Lecture Series 10 The Genetics of Viruses and Prokaryotes

Lecture Series 10 The Genetics of Viruses and Prokaryotes Lecture Series 10 The Genetics of Viruses and Prokaryotes The Genetics of Viruses and Prokaryotes A. Using Prokaryotes and Viruses for Genetic Experiments B. Viruses: Reproduction and Recombination C.

More information

Research Article Robust Design of Biological Circuits: Evolutionary Systems Biology Approach

Research Article Robust Design of Biological Circuits: Evolutionary Systems Biology Approach Hindawi Publishing Corporation Journal of Biomedicine and Biotechnology Volume 2, Article ID 34236, 4 pages doi:.55/2/34236 Research Article Robust Design of Biological Circuits: Evolutionary Systems Biology

More information

MulCom: a Multiple Comparison statistical test for microarray data in Bioconductor.

MulCom: a Multiple Comparison statistical test for microarray data in Bioconductor. MulCom: a Multiple Comparison statistical test for microarray data in Bioconductor. Claudio Isella, Tommaso Renzulli, Davide Corà and Enzo Medico May 3, 2016 Abstract Many microarray experiments compare

More information

Polaris and Callisto: Advances in Cellular Biology. Jordan Moore Senior Field Applications Specialist

Polaris and Callisto: Advances in Cellular Biology. Jordan Moore Senior Field Applications Specialist Polaris and Callisto: Advances in Cellular Biology Jordan Moore Senior Field Applications Specialist Single-Cell Biology Number of cells The population average is a lie average Transcripts per cell Gene

More information

Cory Brouwer, Ph.D. Xiuxia Du, Ph.D. Anthony Fodor, Ph.D.

Cory Brouwer, Ph.D. Xiuxia Du, Ph.D. Anthony Fodor, Ph.D. Cory Brouwer, Ph.D. Dr. Cory R. Brouwer is Director of the Bioinformatics Services Division and Associate Professor of Bioinformatics and Genomics at UNC Charlotte. He and his team provide a wide range

More information

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA HANDOUT LECTURE-04 PROTEOMICS AND SYSTEMS BIOLOGY Slide 1 Today we will talk about proteomics and systems biology. Slide 2 The lecture outline First I will start on proteomics then we will move on to systems

More information

Machine Learning. HMM applications in computational biology

Machine Learning. HMM applications in computational biology 10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly

More information

B. Incorrect! Ligation is also a necessary step for cloning.

B. Incorrect! Ligation is also a necessary step for cloning. Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease

More information

Data Mining for Biological Data Analysis

Data Mining for Biological Data Analysis Data Mining for Biological Data Analysis Data Mining and Text Mining (UIC 583 @ Politecnico di Milano) References Data Mining Course by Gregory-Platesky Shapiro available at www.kdnuggets.com Jiawei Han

More information

ChIP-seq and RNA-seq. Farhat Habib

ChIP-seq and RNA-seq. Farhat Habib ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions

More information

Single-cell sequencing

Single-cell sequencing Single-cell sequencing Jie He 2017-10-31 The Core of Biology Is All About One Cell Forward Approaching The Nobel Prize in Physiology or Medicine 2004 Dr. Richard Axel Dr. Linda Buck Hypothesis 1. The odorant

More information

Optimizing gene expression with GeneGA

Optimizing gene expression with GeneGA Optimizing gene expression with GeneGA Zhenpeng Li, Xiaochen Bo October 30, 2017 Contents 1 Introduction 1 2 Implementation 1 3 Functions and examples 2 4 Installation notes 7 1 Introduction Biological

More information

Optimizing gene expression with GeneGA

Optimizing gene expression with GeneGA Optimizing gene expression with GeneGA Zhenpeng Li, Xiaochen Bo October 30, 2018 Contents 1 Introduction 1 2 Implementation 1 3 Functions and examples 2 4 Installation notes 7 1 Introduction Biological

More information

Infectious Diseases Institute Faculty Hires See below for research interests, areas of expertise and contact information

Infectious Diseases Institute Faculty Hires See below for research interests, areas of expertise and contact information Infectious Diseases Institute Faculty Hires See below for research interests, areas of expertise and contact information Matt Anderson, Ph.D. Anderson.3196@osu.edu Microbial Communities, Host Defense and

More information

Thebiotutor.com A2 Biology OCR Unit F215: Control, genomes and environment Module 2.3 Genomes and gene technologies Answers

Thebiotutor.com A2 Biology OCR Unit F215: Control, genomes and environment Module 2.3 Genomes and gene technologies Answers Thebiotutor.com A2 Biology OCR Unit F215: Control, genomes and environment Module 2.3 Genomes and gene technologies Answers Andy Todd 1 1. (i) plasmid cut by restriction enzyme; at specific sequence; same

More information

Implementation Regulation for the BSc Programme Nanobiology

Implementation Regulation for the BSc Programme Nanobiology Implementation Regulation for the BSc Programme Nanobiology 2017-2018 Part of the Course and Exam Regulation of the Bachelor Programme As referred to in Section 2 of the Course and Exam Regulation. Faculty

More information

Smart India Hackathon

Smart India Hackathon TM Persistent and Hackathons Smart India Hackathon 2017 i4c www.i4c.co.in Digital Transformation 25% of India between age of 16-25 Our country needs audacious digital transformation to reach its potential

More information

Bioinformatics. Dick de Ridder. Tuinbouw Digitaal, 12/11/15

Bioinformatics. Dick de Ridder. Tuinbouw Digitaal, 12/11/15 Bioinformatics Dick de Ridder Tuinbouw Digitaal, 12/11/15 Bioinformatics is not Bioinformatics is also not Bioinformatics Bioinformatics (2) Bioinformatics (3) US National Institutes of Health (NIH): Bioinformatics:

More information

Table of Contents The School of Biomedical Engineering, Science and Health Systems: Undergraduate Programs

Table of Contents The School of Biomedical Engineering, Science and Health Systems: Undergraduate Programs Table of The School of Biomedical Engineering, Science and Health Systems: Undergraduate Programs About the School...2 Undergraduate Major Biomedical Engineering...4 About the Major Concentrations Biomaterials

More information

Biology Warm Up. 1. Complete the entrance ticket you received at the door.

Biology Warm Up. 1. Complete the entrance ticket you received at the door. Biology Warm Up Monday, February 8 1. Complete the entrance ticket you received at the door. NOTE: This is not a grade. I want to see what you know/remember. Once you finish, place in front blue basket.

More information

Chapter 18. The Exciting World Of Bacterial Genetics

Chapter 18. The Exciting World Of Bacterial Genetics Chapter 18. The Exciting World Of Bacterial Genetics Why study bacterial genetics? Its an easy place to start history we know more about it systems better understood simpler genome good model for control

More information

Design Principles in Synthetic Biology

Design Principles in Synthetic Biology Design Principles in Synthetic Biology Chris Myers 1, Nathan Barker 2, Hiroyuki Kuwahara 3, Curtis Madsen 1, Nam Nguyen 1, Michael Samoilov 4, and Adam Arkin 4 1 University of Utah 2 Southern Utah University

More information

ECS 234: Genomic Data Integration ECS 234

ECS 234: Genomic Data Integration ECS 234 : Genomic Data Integration Heterogeneous Data Integration DNA Sequence Microarray Proteomics >gi 12004594 gb AF217406.1 Saccharomyces cerevisiae uridine nucleosidase (URH1) gene, complete cds ATGGAATCTGCTGATTTTTTTACCTCACGAAACTTATTAAAACAGATAATTTCCCTCATCTGCAAGGTTG

More information

Uncovering differentially expressed pathways with protein interaction and gene expression data

Uncovering differentially expressed pathways with protein interaction and gene expression data The Second International Symposium on Optimization and Systems Biology (OSB 08) Lijiang, China, October 31 November 3, 2008 Copyright 2008 ORSC & APORC, pp. 74 82 Uncovering differentially expressed pathways

More information

CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? CHAPTER 2A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved.

CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? CHAPTER 2A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved. CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? 35 INTRODUCTION In the Program Introduction, you learned that the increase in diabetes in the United States has resulted in a great demand for its treatment,

More information

Supporting Appendix 2: Biological Description of the Origons in the E. coli Transcription-Regulatory Network

Supporting Appendix 2: Biological Description of the Origons in the E. coli Transcription-Regulatory Network Supporting Appendix 2: Biological Description of the Origons in the E. coli Transcription-Regulatory Network 1 Table of Contents Origons containing FFLs...3 Transcriptional Response of E. coli to Stimuli:

More information

Computational Genomics. Irit Gat-Viks & Ron Shamir & Haim Wolfson Fall

Computational Genomics. Irit Gat-Viks & Ron Shamir & Haim Wolfson Fall Computational Genomics Irit Gat-Viks & Ron Shamir & Haim Wolfson Fall 2015-16 1 What s in class this week Motivation Administrata Some very basic biology Some very basic biotechnology Examples of our type

More information

PCA and SOM based Dimension Reduction Techniques for Quaternary Protein Structure Prediction

PCA and SOM based Dimension Reduction Techniques for Quaternary Protein Structure Prediction PCA and SOM based Dimension Reduction Techniques for Quaternary Protein Structure Prediction Sanyukta Chetia Department of Electronics and Communication Engineering, Gauhati University-781014, Guwahati,

More information

17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites

17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites 17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites 1 Section 17.5 Transcription regulatory proteins, transcription factors, target cis-acting sites

More information

Integrated M.Tech. in Biotechnology (B.Tech + M.Tech) programme. Semester 1

Integrated M.Tech. in Biotechnology (B.Tech + M.Tech) programme. Semester 1 Annexure-VI Integrated M.Tech. in Biotechnology (B.Tech + M.Tech) programme Semester 1 CY101/PH102 Engineering Chemistry/ Engineering Physics 3 1 0 4 MA103 Basic Mathematics 3 1 0 4 CS101 Computer Programming-I

More information

Progress and Future Directions in Integrated Systems Toxicology. Mary McBride Agilent Technologies

Progress and Future Directions in Integrated Systems Toxicology. Mary McBride Agilent Technologies Progress and Future Directions in Integrated Systems Toxicology Mary McBride Agilent Technologies 1 Toxicity testing tools of the late 20 th century Patchwork approach to testing dates back to the 1930

More information

Prediction of organic matter removal from pulp and paper mill wastewater using artificial neural network

Prediction of organic matter removal from pulp and paper mill wastewater using artificial neural network FEDERAL UNIVERSITY OF BAHIA, BRAZIL POLYTECHNIC SCHOOL DEPARTMENT OF ENVIRONMENTAL ENGINEERING RESEARCH GROUP ON SOLID WASTE AND WASTEWATER RESEARCH NETWORK ON CLEAN TECHNOLOGIES http://www.teclim.ufba.br

More information

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger Protein-Protein-Interaction Networks Ulf Leser, Samira Jaeger This Lecture Protein-protein interactions Characteristics Experimental detection methods Databases Biological networks Ulf Leser: Introduction

More information

Metabolic Networks. Ulf Leser and Michael Weidlich

Metabolic Networks. Ulf Leser and Michael Weidlich Metabolic Networks Ulf Leser and Michael Weidlich This Lecture Introduction Systems biology & modelling Metabolism & metabolic networks Network reconstruction Strategy & workflow Mathematical representation

More information