Towards deep mechanistic neural networks for multi-omits modeling. Ameen Eetemadi Tagkopoulos Lab, UC Davis
|
|
- Winifred Copeland
- 5 years ago
- Views:
Transcription
1 Towards deep mechanistic neural networks for multi-omits modeling. Ameen Eetemadi Tagkopoulos Lab, UC Davis
2 Outline Introduction Motivation Recent work Method (TRNN) Approach Architecture Optimization Results Conclusion
3 Movivation GOAL: Predict cellular state and behavior from environmental settings and genetic background of the cell. Genome-scale model Image credit: Erik Jacobsen, Covert Lab
4 Movivation GOAL: Predict cellular state and behavior from environmental settings and genetic background of the cell. Synthetic biology Genome-scale model Metabolic engineering Test gene circuit in host cell without experiment Image credit: Erik Jacobsen, Covert Lab
5 Movivation GOAL: Predict cellular state and behavior from environmental settings and genetic background of the cell. Synthetic biology Genome-scale model Metabolic engineering Test gene circuit in host cell without experiment Find environment that maximizes engineered products Image credit: Erik Jacobsen, Covert Lab
6 Movivation GOAL: Predict cellular state and behavior from environmental settings and genetic background of the cell. Synthetic biology Genome-scale model Metabolic engineering Test gene circuit in host cell without experiment Find environment that maximizes engineered products Image credit: Erik Jacobsen, Covert Lab Predictive medicine Optimization of antibiotic effect from ~100 existing antibiotics
7 Movivation GOAL: Predict cellular state and behavior from environmental settings and genetic background of the cell. Synthetic biology Genome-scale model Metabolic engineering Test gene circuit in host cell without experiment Find environment that maximizes engineered products Image credit: Erik Jacobsen, Covert Lab Predictive medicine Guided experimentation Optimization of antibiotic effect from ~100 existing antibiotics Find the conditions with highest uncertainty
8 Recent work (ECOMICS) - Data Most comprehensive compendium for an organism M. Kim, N. Rai, V. Zorraquino, and I. Tagkopoulos, Multi-omics integration accurately predicts cellular state in unexplored conditions for Escherichia coli, Nature communications (2016)
9 Recent work (ECOMICS) Predictive Model M. Kim, N. Rai, V. Zorraquino, and I. Tagkopoulos, Multi-omics integration accurately predicts cellular state in unexplored conditions for Escherichia coli, Nature communications (2016)
10 Recent work (ECOMICS) Predictive Model M. Kim, N. Rai, V. Zorraquino, and I. Tagkopoulos, Multi-omics integration accurately predicts cellular state in unexplored conditions for Escherichia coli, Nature communications (2016)
11 Outline Introduction Motivation Recent work Method (TRNN) Approach Architecture Training Results Conclusion
12 Approach Transcription Regulatory Neural Network (TRNN) How to Integrate: 1) Transcription regulatory network 2) Transcription Thermodynamics 3) Transcription profiles
13 Approach Transcription Regulatory Neural Network (TRNN) How to Integrate: 1) Transcription regulatory network 2) Transcription Thermodynamics 3) Transcription profiles
14 Approach Transcription Regulatory Neural Network (TRNN) How to Integrate: 1) Transcription regulatory network 2) Transcription Thermodynamics 3) Transcription profiles Understanding Sentences Words Alphabet
15 Architecture TRNN Activation Function (Alphabet) 1 Concentration of TFs 2 Computational Unit 3 mrna concentration (initial prediction) # $ 1 # ' 2!(# $,, # ' ) ) *(+,,), 4 4 Perturbation 5 Decision Unit 6 mrna concentration (adjusted prediction) Example:! # $, # - # $ + = h $ = h *(+,,) $ + z =, + # $6: : h - = h - (a), {0, 1} )
16 Architecture TRNN Gene Module (Word) Words + + +!(#) B C B $ #!(#) + # $ # -!(# $, # - ) B -
17 Architecture TRNN Gene Circuit (Sentence) Sentences (a) # ) B $ B $ + (b) # B $ B - + ) # $ ) $ # B - (c) B $ ) - (d) B C B $ ) $ ) E B $ ) - # D B $
18 Training Strategy Issue: backpropagation is very sensitive to initial values Strategy: Step1: train individual modules separately through a customized LP based method Step2: train full network together Use full-batch, conjugate gradient
19 Training Individual Modules Algorithm 1: Fit f, given C Input : C = {x 1, x 2, y} Output: = {t 0,t 1,t 2,b 1,b 2,p 1,p 2} 1 initialize p =[p 1,p 2]; 2 while loss (C) is not converged do 3 w ArgMin A.w y 1 1, s.t. b i 0; w i 4 hw p ; 5 for j 1:2do 6 j loss (C) ; 7 p j p j. p j ; 8 end i 9 hw p ; 10 end 11 return mx loss (C) = [f ( x i 1, x i 2 ) i= i i 4 5 x 1, i h 1 = e p 1 h 2 = e p 2 i x i y] apple A = i i 1 h 1 ( h 1 y) h2 ( h 2 y) : entry-wise vector multiplication,
20 Outline Introduction Motivation Recent work Method (TRNN) Approach Architecture Training Results Datasets Comparison Conclusion
21 Dataset 46 different datasets: Multiple candidate networks extracted from DREAM4 challenge Number of genes for each network range from 3 to 9. Synthetic data generated thermodynamic simulation Gene Knockouts Parameter perturbations (e.g. transcription rate, binding affinity of TFs, etc.) Different noise levels Validation Mean Squared Error 5-Fold cross validation Comparison with common ANN architectures
22 Results Overall MSE Comparison TRNN 0.03 MLP MLP MLP Average difference of MSE from best performing method in each dataset
23 Outline Introduction Motivation Recent work Method Approach Architecture Training Results Datasets Comparison Conclusion
24 Conclusion TRNN, is a deep learning based framework for prediction of steady state mrna concentration levels under perturbation. TRNN, requires specialized training due to it s architecture. Evaluation of TRNN on real data is key next step. For scaling up TRNN to genome scale modelling, we will make use of highly parallel computation provided by the cluster.
CS 5984: Topics and Schedule
CS 5984: and Schedule T. M. Murali January 19, 2006 T. M. Murali January 19, 2006 CS 5984: and Schedule Continuum of Models in Systems Biology From Building with a scaffold: emerging strategies for high-
More informationIdentifying Signaling Pathways. BMI/CS 776 Spring 2016 Anthony Gitter
Identifying Signaling Pathways BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2016 Anthony Gitter gitter@biostat.wisc.edu Goals for lecture Challenges of integrating high-throughput assays Connecting relevant
More informationInference in Metabolic Network Models using Flux Balance Analysis
Inference in Metabolic Network Models using Flux Balance Analysis BMI/CS 776 www.biostat.wisc.edu/bmi776/ Mark Craven craven@biostat.wisc.edu Spring 2011 Goals for Lecture the key concepts to understand
More informationCS273B: Deep learning for Genomics and Biomedicine
CS273B: Deep learning for Genomics and Biomedicine Lecture 2: Convolutional neural networks and applications to functional genomics 09/28/2016 Anshul Kundaje, James Zou, Serafim Batzoglou Outline Anatomy
More informationUsing Synthetic Biology to Identify a Human Papillomavirus Infection
Using Synthetic Biology to Identify a Human Papillomavirus Infection Lactoguard Byron Alexander Jacobs Computational and Applied Mathematics Honours, School of Computational and Applied Mathematics, University
More informationGene Signature Lab: Exploring integrative LINCS (ilincs) Data and Signatures Analysis Portal & Other LINCS Resources
Gene Signature Lab: Exploring integrative LINCS (ilincs) Data and Signatures Analysis Portal & Other LINCS Resources Jarek Meller, PhD BD2K-LINCS Data Coordination and Integration Center University of
More informationThe Integrated Biomedical Sciences Graduate Program
The Integrated Biomedical Sciences Graduate Program at the university of notre dame Cutting-edge biomedical research and training that transcends traditional departmental and disciplinary boundaries to
More informationBIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis
BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology Lecture 2: Microarray analysis Genome wide measurement of gene transcription using DNA microarray Bruce Alberts, et al., Molecular Biology
More informationTechnical University of Denmark
1 of 13 Technical University of Denmark Written exam, 15 December 2007 Course name: Introduction to Systems Biology Course no. 27041 Aids allowed: Open Book Exam Provide your answers and calculations on
More informationInferring Gene-Gene Interactions and Functional Modules Beyond Standard Models
Inferring Gene-Gene Interactions and Functional Modules Beyond Standard Models Haiyan Huang Department of Statistics, UC Berkeley Feb 7, 2018 Background Background High dimensionality (p >> n) often results
More informationBIOLOGY 101. CHAPTER 18: Gene Expression: Turning genes on and off
BIOLOGY 101 CHAPTER 18: Gene Expression: Turning genes on and off BACTERIAL TRANSFORMATION: Bacteria have the ability to pick up DNA from their surroundings and transcribe it as if it was their own. When
More informationOur website:
Biomedical Informatics Summer Internship Program (BMI SIP) The Department of Biomedical Informatics hosts an annual internship program each summer which provides high school, undergraduate, and graduate
More informationEngineering Genetic Circuits
Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art
More informationBIOT 107: BIOTECHNOLOGY: TRANSFORMING SOCIETY THROUGH BIOLOGY
BIOT 107: Biotechnology: Transforming Society Through Biology 1 BIOT 107: BIOTECHNOLOGY: TRANSFORMING SOCIETY THROUGH BIOLOGY Discipline BIOT - Biotechnology Course Number 107 Course Title Biotechnology:
More informationBIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM)
BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) PROGRAM TITLE DEGREE TITLE Master of Science Program in Bioinformatics and System Biology (International Program) Master of Science (Bioinformatics
More informationEra with Computational Biology/Toxicology
USM Seminar 1/22/2010 Embracing the Post-Omics Era with Computational Biology/Toxicology Ping Gong Environmental Genomics and Genetics (EGG) Team @ Environmental Laboratory Outline Introduction Bioinformatics
More informationNeural Networks and Applications in Bioinformatics. Yuzhen Ye School of Informatics and Computing, Indiana University
Neural Networks and Applications in Bioinformatics Yuzhen Ye School of Informatics and Computing, Indiana University Contents Biological problem: promoter modeling Basics of neural networks Perceptrons
More informationNeural Networks and Applications in Bioinformatics
Contents Neural Networks and Applications in Bioinformatics Yuzhen Ye School of Informatics and Computing, Indiana University Biological problem: promoter modeling Basics of neural networks Perceptrons
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationGene Network Inference and Expression Prediction Using Recurrent Neural Networks and Evolutionary Algorithms
Brigham Young University BYU ScholarsArchive All Theses and Dissertations 2010-12-10 Gene Network Inference and Expression Prediction Using Recurrent Neural Networks and Evolutionary Algorithms Heather
More informationEditorial. Current Computational Models for Prediction of the Varied Interactions Related to Non-Coding RNAs
Editorial Current Computational Models for Prediction of the Varied Interactions Related to Non-Coding RNAs Xing Chen 1,*, Huiming Peng 2, Zheng Yin 3 1 School of Information and Electrical Engineering,
More informationComputational Genomics. Reconstructing signaling and dynamic regulatory networks
02-710 Computational Genomics Reconstructing signaling and dynamic regulatory networks Input Output Hidden Markov Model Input (Static transcription factorgene interactions) Bengio and Frasconi, NIPS 1995
More informationFollowing text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005
Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of
More informationLearning Bayesian Network Models of Gene Regulation
Learning Bayesian Network Models of Gene Regulation CIBM Retreat October 3, 2003 Keith Noto Mark Craven s Group University of Wisconsin-Madison CIBM Retreat 2003 Poster Session p.1/18 Abstract Our knowledge
More informationData Mining and Applications in Genomics
Data Mining and Applications in Genomics Lecture Notes in Electrical Engineering Volume 25 For other titles published in this series, go to www.springer.com/series/7818 Sio-Iong Ao Data Mining and Applications
More informationAn integrative, multi-scale genome-wide model reveals the phenotypic landscape of Escherichia coli
An integrative, multi-scale genome-wide model reveals the phenotypic landscape of Escherichia coli Javier Carrera, 1,4 Raissa Estrela, 2 Jing Luo, 1 Navneet Rai, 1 Athanasios Tsoukalas, 1,3 Ilias Tagkopoulos,
More informationIngenuity Pathway Analysis (IPA )
Ingenuity Pathway Analysis (IPA ) For the analysis and interpretation of omics data IPA is a web-based software application for the analysis, integration, and interpretation of data derived from omics
More informationREPORT DOCUMENTATION PAGE
REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704-0188 Public reporting burden for this collection of information is estimated to average 1 hour per response, including the time for reviewing instructions,
More informationBiotechnology (Chapter 20) Objectives
Biotechnology (Chapter 20) Objectives Understand the background science behind the technology applications Understand the tools and details of the technology Develop familiarity with performing the select
More informationComputer Aided Design of Synthetic Biological Systems Using Standardized Parts
Computer Aided Design of Synthetic Biological Systems Using Standardized Parts Douglas Densmore* CHESS Seminar 11/18/08 *in cooperation with Prof. J. Christopher Anderson and Prof. Chris Voigt Outline
More informationSynthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design.
Synthetic Biology Accelerating Discoveries, Expanding Possibilities Sustainable Energy Therapeutics Industrial Enzymes Agriculture Design Build Generate Solutions to Advance Synthetic Biology Research
More informationGene function prediction. Computational analysis of biological networks. Olga Troyanskaya, PhD
Gene function prediction Computational analysis of biological networks. Olga Troyanskaya, PhD Available Data Coexpression - Microarrays Cells of Interest Known DNA sequences Isolate mrna Glass slide Resulting
More informationCSC 121 Computers and Scientific Thinking
CSC 121 Computers and Scientific Thinking Fall 2005 Computers in Biology and Bioinformatics 1 Biology biology is roughly defined as "the study of life" it is concerned with the characteristics and behaviors
More information3/11/10. Genetic Circuits. Edge Detection. Genetic Edge Detection Algorithm. Goal. What I cannot create I do not understand.
What I cannot create I do not understand. ~Richard Feynman A Synthetic Genetic Edge Detection Program Tabor JJ, Salis HM, Simpson ZB, Chevalier AA, Levskaya A, Marcotte EM, Voigt CA, Ellington AD Cell.
More informationNetwork System Inference
Network System Inference Francis J. Doyle III University of California, Santa Barbara Douglas Lauffenburger Massachusetts Institute of Technology WTEC Systems Biology Final Workshop March 11, 2005 What
More informationPositional Preference of Rho-Independent Transcriptional Terminators in E. Coli
Positional Preference of Rho-Independent Transcriptional Terminators in E. Coli Annie Vo Introduction Gene expression can be regulated at the transcriptional level through the activities of terminators.
More informationIdentification of biological themes in microarray data from a mouse heart development time series using GeneSifter
Identification of biological themes in microarray data from a mouse heart development time series using GeneSifter VizX Labs, LLC Seattle, WA 98119 Abstract Oligonucleotide microarrays were used to study
More informationBIOCHEM + MOLE BIOLOGY- BC (BC)
Biochem + Mole Biology-BC (BC) 1 BIOCHEM + MOLE BIOLOGY- BC (BC) Courses BC 192 Biochemistry Freshman Seminar Credits: 2 (1-0-1) Introduction to curriculum and career options for biochemistry majors. Registration
More informationGut microbial colonization in day old chicks. Henri Woelders DirkJan Schokker Mari A. Smits
Gut microbial colonization in day old chicks Henri Woelders DirkJan Schokker Mari A. Smits Trends Robustness; Resilience. Ability to keep healthy, or recover from disease (with minimal human intervention).
More information1. Page 90: Cellular Metabolism Explain what the everyday use of the word metabolism means to you.
Biology 100 Winter 2013 North Seattle Community College Reading Guide 10 Metabolism, Enzymes, and Building a Protein Reading: 1) Chapter 5 (various pages) in Microbiology Demystified 2) Chapter 7 (various
More informationA study on the robustness of strain optimization algorithms
A study on the robustness of strain optimization algorithms Paulo Vilaça, Paulo Maia, and Miguel Rocha Abstract In recent years, there have been considerable advances in the use of genome-scale metabolic
More informationA Simple Approach to Study Designs in Complex Biochemical Pathways
Symposium on Complexity & Computation in the Natural Sciences A Simple Approach to Study Designs in Complex Biochemical Pathways SOMDATTA SINHA Centre for Cellular and Molecular Biology (CSIR) Hyderabad
More informationCS 5854: Predictive Models of Transcriptional Regulatory Networks
CS 5854: Predictive Models of Transcriptional Regulatory Networks T. M. Murali February 28, Mar 5, 7, 2013 Predicting Transcriptional Control Networks 1. Integrated biclustering of heterogeneous genome-wide
More informationThis place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.
G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic
More informationDiscovery of Transcription Factor Binding Sites with Deep Convolutional Neural Networks
Discovery of Transcription Factor Binding Sites with Deep Convolutional Neural Networks Reesab Pathak Dept. of Computer Science Stanford University rpathak@stanford.edu Abstract Transcription factors are
More informationIntro to Microarray Analysis. Courtesy of Professor Dan Nettleton Iowa State University (with some edits)
Intro to Microarray Analysis Courtesy of Professor Dan Nettleton Iowa State University (with some edits) Some Basic Biology Genes are DNA sequences that code for proteins. (e.g. gene lengths perhaps 1000
More informationHST MEMP TQE Concentration Areas ~ Approved Subjects Grid
HST MEMP TQE Concentration Areas ~ Approved Subjects Grid Aeronautics and Astronautics Biological Engineering Brain and Cognitive Sciences Chemical Engineering 2.080J; 2.183J; choose BOTH choose ONE choose
More informationBioinformatics & Protein Structural Analysis. Bioinformatics & Protein Structural Analysis. Learning Objective. Proteomics
The molecular structures of proteins are complex and can be defined at various levels. These structures can also be predicted from their amino-acid sequences. Protein structure prediction is one of the
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationNon-coding Function & Variation, MPRAs II. Mike White Bio /5/18
Non-coding Function & Variation, MPRAs II Mike White Bio 5488 3/5/18 MPRA Review Problem 1: Where does your CRE DNA come from? DNA synthesis Genomic fragments Targeted regulome capture Problem 2: How do
More informationCoherent Feed Forward Loops
Coherent Feed Forward Loops Dr. M. Vijayalakshmi School of Chemical and Biotechnology SASTRA University Joint Initiative of IITs and IISc Funded by MHRD Page 1 of 10 Table of Contents 1 INTRODUCTION...
More informationBi 1x Spring 2016: LacI Titration
Bi 1x Spring 2016: LacI Titration 1 Overview In this experiment, you will measure the effect of various mutated LacI repressor ribosome binding sites in an E. coli cell by measuring the expression of a
More informationBioinformatics Programming and Analysis CSC Dr. Garrett Dancik
Bioinformatics Programming and Analysis CSC 315-01 Dr. Garrett Dancik What is bioinformatics Bioinformatics: Biology + information the study and utilization of methods for storing, retrieving and analyzing
More informationCondition-specific regulation of mrna stability in yeast
Condition-specific regulation of mrna stability in yeast Harmen J. Bussemaker Department of Biological Sciences & C2B2 Columbia University, New York City Gene Upstream Region Cis-Regulatory Elements
More informationThe HPC-Life Sciences scenario Byte vs Flop?
www.bsc.es The HPC-Life Sciences scenario Byte vs Flop? Modesto Orozco Henry Markram, Erik Lindahl, Paolo Carloni, Alfonso Valencia Richard Lavery, Peter Coveney, Charles Laughton Exascale for Life Sciences
More informationGiri Narasimhan. CAP 5510: Introduction to Bioinformatics. ECS 254; Phone: x3748
CAP 5510: Introduction to Bioinformatics Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs07.html 2/8/07 CAP5510 1 Pattern Discovery 2/8/07 CAP5510 2 What we have
More informationNIH Public Access Author Manuscript Nat Biotechnol. Author manuscript; available in PMC 2011 June 6.
NIH Public Access Author Manuscript Published in final edited form as: Nat Biotechnol. 2010 March ; 28(3): 245 248. doi:10.1038/nbt.1614. What is flux balance analysis? Jeffrey D. Orth, University of California
More informationPage 70 Monday December 8, 2014
replication and Monday December 8, 0 Notebook check 8: Page 69, DNA Technology Introduction Worksheet. The process by which a foreign gene is replicated by insertion into a bacterium is called genetic
More informationGenetic Engineering for Biofuels Production
Genetic Engineering for Biofuels Production WSE 573 Spring 2013 Greeley Beck INTRODUCTION Alternative transportation fuels are needed in the United States because of oil supply insecurity, oil price increases,
More informationBIOINFORMATICS THE MACHINE LEARNING APPROACH
88 Proceedings of the 4 th International Conference on Informatics and Information Technology BIOINFORMATICS THE MACHINE LEARNING APPROACH A. Madevska-Bogdanova Inst, Informatics, Fac. Natural Sc. and
More informationFunctional Genomics Research Stream
Functional Genomics Research Stream Research Meeting: January 19, 2010 Introduction, Policy Discussion & Scientific Writing histone occupancy histone occupancy histone modification histone occupancy histone
More informationBio-inspired Active Vision. Martin Peniak, Ron Babich, John Tran and Davide Marocco
Bio-inspired Active Vision Martin Peniak, Ron Babich, John Tran and Davide Marocco GPU Computing Lab Traditional Computer Vision 3 Traditional Computer Vision Teaching a computer to classify objects has
More informationGene Reduction for Cancer Classification using Cascaded Neural Network with Gene Masking
Gene Reduction for Cancer Classification using Cascaded Neural Network with Gene Masking Raneel Kumar, Krishnil Chand, Sunil Pranit Lal School of Computing, Information, and Mathematical Sciences University
More informationLecture Series 10 The Genetics of Viruses and Prokaryotes
Lecture Series 10 The Genetics of Viruses and Prokaryotes The Genetics of Viruses and Prokaryotes A. Using Prokaryotes and Viruses for Genetic Experiments B. Viruses: Reproduction and Recombination C.
More informationResearch Article Robust Design of Biological Circuits: Evolutionary Systems Biology Approach
Hindawi Publishing Corporation Journal of Biomedicine and Biotechnology Volume 2, Article ID 34236, 4 pages doi:.55/2/34236 Research Article Robust Design of Biological Circuits: Evolutionary Systems Biology
More informationMulCom: a Multiple Comparison statistical test for microarray data in Bioconductor.
MulCom: a Multiple Comparison statistical test for microarray data in Bioconductor. Claudio Isella, Tommaso Renzulli, Davide Corà and Enzo Medico May 3, 2016 Abstract Many microarray experiments compare
More informationPolaris and Callisto: Advances in Cellular Biology. Jordan Moore Senior Field Applications Specialist
Polaris and Callisto: Advances in Cellular Biology Jordan Moore Senior Field Applications Specialist Single-Cell Biology Number of cells The population average is a lie average Transcripts per cell Gene
More informationCory Brouwer, Ph.D. Xiuxia Du, Ph.D. Anthony Fodor, Ph.D.
Cory Brouwer, Ph.D. Dr. Cory R. Brouwer is Director of the Bioinformatics Services Division and Associate Professor of Bioinformatics and Genomics at UNC Charlotte. He and his team provide a wide range
More informationNPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA
HANDOUT LECTURE-04 PROTEOMICS AND SYSTEMS BIOLOGY Slide 1 Today we will talk about proteomics and systems biology. Slide 2 The lecture outline First I will start on proteomics then we will move on to systems
More informationMachine Learning. HMM applications in computational biology
10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly
More informationB. Incorrect! Ligation is also a necessary step for cloning.
Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease
More informationData Mining for Biological Data Analysis
Data Mining for Biological Data Analysis Data Mining and Text Mining (UIC 583 @ Politecnico di Milano) References Data Mining Course by Gregory-Platesky Shapiro available at www.kdnuggets.com Jiawei Han
More informationChIP-seq and RNA-seq. Farhat Habib
ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions
More informationSingle-cell sequencing
Single-cell sequencing Jie He 2017-10-31 The Core of Biology Is All About One Cell Forward Approaching The Nobel Prize in Physiology or Medicine 2004 Dr. Richard Axel Dr. Linda Buck Hypothesis 1. The odorant
More informationOptimizing gene expression with GeneGA
Optimizing gene expression with GeneGA Zhenpeng Li, Xiaochen Bo October 30, 2017 Contents 1 Introduction 1 2 Implementation 1 3 Functions and examples 2 4 Installation notes 7 1 Introduction Biological
More informationOptimizing gene expression with GeneGA
Optimizing gene expression with GeneGA Zhenpeng Li, Xiaochen Bo October 30, 2018 Contents 1 Introduction 1 2 Implementation 1 3 Functions and examples 2 4 Installation notes 7 1 Introduction Biological
More informationInfectious Diseases Institute Faculty Hires See below for research interests, areas of expertise and contact information
Infectious Diseases Institute Faculty Hires See below for research interests, areas of expertise and contact information Matt Anderson, Ph.D. Anderson.3196@osu.edu Microbial Communities, Host Defense and
More informationThebiotutor.com A2 Biology OCR Unit F215: Control, genomes and environment Module 2.3 Genomes and gene technologies Answers
Thebiotutor.com A2 Biology OCR Unit F215: Control, genomes and environment Module 2.3 Genomes and gene technologies Answers Andy Todd 1 1. (i) plasmid cut by restriction enzyme; at specific sequence; same
More informationImplementation Regulation for the BSc Programme Nanobiology
Implementation Regulation for the BSc Programme Nanobiology 2017-2018 Part of the Course and Exam Regulation of the Bachelor Programme As referred to in Section 2 of the Course and Exam Regulation. Faculty
More informationSmart India Hackathon
TM Persistent and Hackathons Smart India Hackathon 2017 i4c www.i4c.co.in Digital Transformation 25% of India between age of 16-25 Our country needs audacious digital transformation to reach its potential
More informationBioinformatics. Dick de Ridder. Tuinbouw Digitaal, 12/11/15
Bioinformatics Dick de Ridder Tuinbouw Digitaal, 12/11/15 Bioinformatics is not Bioinformatics is also not Bioinformatics Bioinformatics (2) Bioinformatics (3) US National Institutes of Health (NIH): Bioinformatics:
More informationTable of Contents The School of Biomedical Engineering, Science and Health Systems: Undergraduate Programs
Table of The School of Biomedical Engineering, Science and Health Systems: Undergraduate Programs About the School...2 Undergraduate Major Biomedical Engineering...4 About the Major Concentrations Biomaterials
More informationBiology Warm Up. 1. Complete the entrance ticket you received at the door.
Biology Warm Up Monday, February 8 1. Complete the entrance ticket you received at the door. NOTE: This is not a grade. I want to see what you know/remember. Once you finish, place in front blue basket.
More informationChapter 18. The Exciting World Of Bacterial Genetics
Chapter 18. The Exciting World Of Bacterial Genetics Why study bacterial genetics? Its an easy place to start history we know more about it systems better understood simpler genome good model for control
More informationDesign Principles in Synthetic Biology
Design Principles in Synthetic Biology Chris Myers 1, Nathan Barker 2, Hiroyuki Kuwahara 3, Curtis Madsen 1, Nam Nguyen 1, Michael Samoilov 4, and Adam Arkin 4 1 University of Utah 2 Southern Utah University
More informationECS 234: Genomic Data Integration ECS 234
: Genomic Data Integration Heterogeneous Data Integration DNA Sequence Microarray Proteomics >gi 12004594 gb AF217406.1 Saccharomyces cerevisiae uridine nucleosidase (URH1) gene, complete cds ATGGAATCTGCTGATTTTTTTACCTCACGAAACTTATTAAAACAGATAATTTCCCTCATCTGCAAGGTTG
More informationUncovering differentially expressed pathways with protein interaction and gene expression data
The Second International Symposium on Optimization and Systems Biology (OSB 08) Lijiang, China, October 31 November 3, 2008 Copyright 2008 ORSC & APORC, pp. 74 82 Uncovering differentially expressed pathways
More informationCHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? CHAPTER 2A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved.
CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? 35 INTRODUCTION In the Program Introduction, you learned that the increase in diabetes in the United States has resulted in a great demand for its treatment,
More informationSupporting Appendix 2: Biological Description of the Origons in the E. coli Transcription-Regulatory Network
Supporting Appendix 2: Biological Description of the Origons in the E. coli Transcription-Regulatory Network 1 Table of Contents Origons containing FFLs...3 Transcriptional Response of E. coli to Stimuli:
More informationComputational Genomics. Irit Gat-Viks & Ron Shamir & Haim Wolfson Fall
Computational Genomics Irit Gat-Viks & Ron Shamir & Haim Wolfson Fall 2015-16 1 What s in class this week Motivation Administrata Some very basic biology Some very basic biotechnology Examples of our type
More informationPCA and SOM based Dimension Reduction Techniques for Quaternary Protein Structure Prediction
PCA and SOM based Dimension Reduction Techniques for Quaternary Protein Structure Prediction Sanyukta Chetia Department of Electronics and Communication Engineering, Gauhati University-781014, Guwahati,
More information17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites
17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites 1 Section 17.5 Transcription regulatory proteins, transcription factors, target cis-acting sites
More informationIntegrated M.Tech. in Biotechnology (B.Tech + M.Tech) programme. Semester 1
Annexure-VI Integrated M.Tech. in Biotechnology (B.Tech + M.Tech) programme Semester 1 CY101/PH102 Engineering Chemistry/ Engineering Physics 3 1 0 4 MA103 Basic Mathematics 3 1 0 4 CS101 Computer Programming-I
More informationProgress and Future Directions in Integrated Systems Toxicology. Mary McBride Agilent Technologies
Progress and Future Directions in Integrated Systems Toxicology Mary McBride Agilent Technologies 1 Toxicity testing tools of the late 20 th century Patchwork approach to testing dates back to the 1930
More informationPrediction of organic matter removal from pulp and paper mill wastewater using artificial neural network
FEDERAL UNIVERSITY OF BAHIA, BRAZIL POLYTECHNIC SCHOOL DEPARTMENT OF ENVIRONMENTAL ENGINEERING RESEARCH GROUP ON SOLID WASTE AND WASTEWATER RESEARCH NETWORK ON CLEAN TECHNOLOGIES http://www.teclim.ufba.br
More informationProtein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger
Protein-Protein-Interaction Networks Ulf Leser, Samira Jaeger This Lecture Protein-protein interactions Characteristics Experimental detection methods Databases Biological networks Ulf Leser: Introduction
More informationMetabolic Networks. Ulf Leser and Michael Weidlich
Metabolic Networks Ulf Leser and Michael Weidlich This Lecture Introduction Systems biology & modelling Metabolism & metabolic networks Network reconstruction Strategy & workflow Mathematical representation
More information