RNA-seq analysis worksop
|
|
|
- Dale O’Neal’
- 5 years ago
- Views:
Transcription
1 RNA-seq analysis worksop Zhangjun Fei Boyce Thompson Institute for Plant Research USDA Robert W. Holley Center for Agriculture and Health Cornell University
2 Outline Background of RNA-seq Application of RNA-seq (what RNA-seq can do?) Available sequencing platforms and strategies and which one to choose RNA-seq data analysis Read processing and quality assessment De novo assembly Alignment to reference genome/transcriptome Differentially expressed gene identification Downstream analysis using Plant MetGenMAP
3 Milestones of Transcriptome analysis Year Milestone 1965 Sequence of the first RNA molecule determined 1977 Development of the Northern blot technique and the Sanger sequencing method 1989 Reports of RT-PCR experiments for transcriptome analysis 1991 First high-throughput EST sequencing study 1992 Introduction of Differential Display for the discovery of differentially expressed genes 1995 Reports of the microarray and Serial Analysis of Gene Expression (SAGE) methods 1996 Suppression subtractive hybridization reported 2005 First next-generation sequencing technology (Roche/454) introduced to the market 2006 First transcriptome sequencing studies using a next-generation technology (Roche/454)
4 New sequencing technologies Next generation sequencing Illumina (HiSeq 2000/2500) Roche/454 Ion Torrent (Ion Proton) ABI/SOLiD Helicos Third generation sequencing Pacific Biosciences Oxford Nanopore Complete Genomics Desktop sequencer Ion Torrent PGM Illumina MiSeq 454 GS Junior
5 RNA-seq applications
6 RNA-seq application Accelerating gene discovery and gene family expansion Improving genome annotation identifying novel genes and gene models Identifying tissue/condition specific alternative splicing events
7 RNA-seq applications Alternative splicing Short reads can t provide the complete structure of an isoform
8 PacBio long reads RNA-seq applications
9 RNA-seq applications PacBio long reads error correction
10 RNA-seq applications
11 RNA-seq applications
12 RNA-seq applications Cell 1 Cell 2 No. reads 86,126 80,543 Total base 527,933, ,348,201 Average length 6,129 5,914
13 RNA-seq applications SNP and SSR marker identification facilitating breeding SNP discovery in RNA-seq is more challenging than in DNA: Varying levels of coverage depth False discovery around splicing junctions due to incorrect mapping
14 RNA-seq applications Phylogenetic relationship, population structure, selective sweep
15 RNA-seq applications Expression QTL Distribution of SNPs (blue) and differentially expressed (DE) genes in IL10-1
16 RNA-seq applications Mutant gene cloning (BSA RNA-seq) white fruit x yellow fruit 132 of 189 SNPs in this region F1 F2 kb F3 white pool yellow pool RNA-seq SNPs and DE genes
17 RNA-seq applications GWAS Distribution of mapped markers associating with the erucic acid trait
18 RNA-seq applications Genomic imprinting and allele specific expression
19 RNA-seq applications non-coding RNAs (lncrna, lincrnas )
20 Gene fusion RNA-seq applications
21 Gene expression profiling RNA-seq applications
22 RNA-seq vs microarray Problem of microarray Cross-hybridization Stable probe secondary structures high background (e.g., nonspecific hybridization) limited dynamic range (e.g., nonlinear and saturable hybridization kinetics) RNA-seq (digital expression analysis) allow direct enumeration of transcript molecules digital expression data are absolute so data can be directly compared across different experiments and laboratories without the need for extensive internal controls or other experimental manipulation provide open systems that allow detection of previously uncharacterized transcripts, as well as rare transcripts
23 RNA-seq vs microarray high background (e.g., nonspecific hybridization) limited dynamic range (e.g., nonlinear and saturable hybridization kinetics)
24 RNA-seq applications Summary Accelerating gene discovery and gene family expansion Improving genome annotation identifying novel genes and gene models Identifying tissue/condition specific alternative splicing events SNP and SSR marker identification Phylogenetic relationship, population structure, selective sweep Expression QTL analysis Mutant gene cloning (BSA RNA-seq) Genome (Transcriptome)-wide associate study Genomic imprinting and allele specific expression analysis Identifying non-coding RNAs (lncrna, lincrnas ) Identifying gene fusion events Gene expression profiling analysis
25 Sequencing platforms and strategies
26 Sequencing platforms Next generation sequencing Illumina (HiSeq 2000/2500) Ion Torrent (Ion Proton) ABI/SOLiD Roche/454 Helicos Third generation sequencing Pacific Biosciences Oxford Nanopore Complete Genomics Desktop sequencer Ion Torrent PGM Illumina MiSeq 454 GS Junior
27 Sequencing platforms Illumina HiSeq 2000/2500 High-output mode ( M reads/ read pairs per lane) Single-end, 50 bp lane Single-end, 100 bp lane Paired-end, 2 x 100bp lane Run time: 2-11 days Illumina MiSeq 50 bp sequencing kit 300 bp sequencing kit (e.g. 2 x 150 bp) 500 bp sequencing kit (e.g. 2 x 250 bp) 150 bp sequencing kit (e.g. 2 x 75 bp) 600 bp sequencing kit (e.g. 2 x 300 bp) Run time: 5-65 hours Rapid run mode ( M reads/ read pairs per lane) Single-end, 50 bp lane Single-end, 100 bp lane Paired-end, 2 x 100bp lane Paired-end, 2 x 150bp lane Runtime: 7-40 hours
28 Sequencing platforms Single-end or paired-end For gene expression analysis with a reference genome, singleend is enough For de novo assembly, genome annotation, alternative splicing identification, it s better to use paired-end Strand-specific or non strand-specific Always choose strand-specific RNA-seq if possible
29 Strand-specific RNA sequencing More accurately determine the expression level Significantly reduce false positives in identifying alternatively spliced transcripts Identify antisense transcripts another level of gene regulation in important biological processes Determine the transcribed strand of non-coding RNAs (e.g. lincrnas)
30 Strand-specific RNA-seq library construction
31 High throughput ssrna-seq Up to 96 libraries in two days Paired-end compatible multiplexing
32 Strand specific RNA sequencing Strand-specific sequencing can produce more accurate digital gene expression data when compared to the conventional Illumina RNA-Seq.
33 Strand specific RNA sequencing
34 Strand specific RNA sequencing Antisense transcript cis-natural antisense transcripts (cis-nat) 1340 cis-nat pairs in Arabidopsis (Wang et al., 2005) 687 cis-nat pairs in rice (Osato et al., 2003) trans-natural antisense transcripts (trans-nat) 1,320 trans-nat pairs in Arabidopsis (Wang et al., 2006) function alternative splicing RNA editing DNA methylation genomic imprinting X-chromosome inactivation
35 Strand specific RNA sequencing Antisense transcript LEFL2040O reads 259 reads LEFL2002DC reads 1189 reads
36 lincrna (determine the sense strand) Strand specific RNA sequencing
37 RNA-seq strategies Sequencing depth and no. of biological replicates Most frequently asked question How many samples should I multiplex in one lane? or How many reads should I generate for each of my samples? Depend on $$$ Depends on the quality of the library and the reads rrna, trna, organelle, adaptor contamination No. of biological replicates for expression call At least three Effects of read numbers on expression call Mature green fruit library (22M reads) Randomly select , 1-22M reads from the library and calculate gene expression for each dataset (20 different randomizations)
38 RNA-seq (multiplexing) 0.1M 1M 2M r= r= r= M 5M 10M r= r= r= Mature green fruit, 22M
39 RNA-seq (multiplexing)
40 RNA-seq (multiplexing)
41 RNA-seq data analysis
42 Read quality control (fastqc) Read processing
43 Read quality control (fastqc) Read processing
44 Read quality control (fastqc) Read processing
45 Read processing Remove adaptors and all possible contaminations: rrna, trna, organelle (chloroplast and mitochondrion) RNAs, virus, low quality sequences Arabidopsis 25S ribosomal RNA vs GenBank nr protein database
46 Read processing Remove contaminated sequences Align reads to rrna and organelle sequence database (bowtie or BWA) Affect RPKM values if not removed Trim adaptor and low quality sequences FASTX-Toolkit AdapterRemoval Trimmomatic Cutadapt Condetri ERNE-filter Prinseq SolexaQA-bwa Sickle
47 Read processing
48 RNA-seq data analysis De novo transcriptome assembly Long reads (454/Sanger) overlap-layout-consensus strategy Short reads (Illumina) de Bruijn graph approach Martin & Wang, 2011
49 De novo transcriptome assembly Long reads (454/Sanger) CAP3 ( TGICL/CAP3 ( MIRA ( Newbler (-cdna) Phrap ( Two major problems in existing EST assembly programs and unigene databases: 1) Large portion of different transcripts (mainly alternative spliced transcripts and paralogs) are incorrectly assembled into same transcripts type I error (false positives) 2) Large portion of nearly identical sequences are not assembled into one transcript type II error (false negatives)
50 Example of type I assembly error (paralog) In DFCI Tomato Gene Index, AW is a member of TC Sequence identity between AW and TC232370: 91.5% AW is aligned to tomato chromosome 4 TC is aligned to tomato chromosome 11
51 Example of type I assembly error (alternative splicing) In DFCI Tomato Gene Index, U95008 is a member of TC226520
52 Example of type II assembly error In DFCI Tomato Gene Index, two unigenes, TC and TC221582, are identical
53 iassembler iterative assemblies (assembly of assemblies) using MIRA and CAP3 (four cycles of MIRA followed by one cycle of CAP3) reduce errors that nearly identical sequences are not assembled Further assembly error identification 1) comparing unigene sequences against themselves to identify nearly identical sequences (type II errors) 2) aligning EST sequences to their corresponding unigene sequences to identify mis-assembled ESTs (type I errors) Both type I and II assembly errors are corrected automatically by the program Unigene base errors are then corrected based on the resulting SAM files
54 General controller Workflow of iassembler input sequences & parameters MIRA assembler CAP3 assembler type II error corrector megablast assembler type I error corrector new error detected unigene base corrector no new error detected Output
55 iassembler performance Tomato Sanger ESTs Olive 454 ESTs
56 iassembler performance A curated Arabidopsis EST dataset, which only contain ESTs that can be perfectly aligned to the TAIR10 cdnas perfectly aligned means that the sequences were aligned to Arabidopsis cdnas in their entire lengths
57 iassembler - SAM format output
58 De novo transcriptome assembly Short reads (Illumina) Trinity Trans-ABySS Oases/velvet SOAPdenovo-Trans
59 De novo transcriptome assembly Trinity
60 De novo transcriptome assembly Post processing of de novo assemblies Remove contaminations (bacteria, virus, fungus ) Remove assembly errors (mainly redundancy) Remove errors caused by library preparation (incomplete digestion of dutp containing 2 nd strand during strandspecific RNA-seq library construction)
61 De novo transcriptome assembly blastx Remove contamination blastn
62 De novo transcriptome assembly Remove contamination DeconSeq SeqClean
63 De novo transcriptome assembly Remove type II assembly error (redundancy) iassembler
64 De novo transcriptome assembly Remove transcripts derived from incomplete 2 nd digestion Gene ID length antisense sense UN comp38294_c0_seq removed
65 De novo transcriptome assembly High number of assembled transcripts Alternative splicing Non-coding RNAs Incomplete coverage of full length transcripts DFCI gene index
66 RNA-seq data analysis Alignment Align reads to reference genome TopHat Alignment reads to reference transcriptome bowtie BWA If you have a reference genome, it s not a good idea to align the reads to the predicted CDS or cdna, due to the incomplete prediction of UTRs and alternative splicing
67 RNA-seq data analysis Visualization tools Integrative Genomics Viewer (IGV)
68 RNA-seq data analysis Read counting and normalization Read counting htseq-count samtools (samtools view c) Normalization RPKM: reads per kilobase of exon model per million mapped reads FPKM: fragments per kilobase of exon model per million mapped reads
69 RNA-seq data analysis Quality control biological replicates Sample correlation matrix
70 RNA-seq data analysis Differentially expressed gene detection Pair-wise comparison DESeq edger Time course data first data transformation using getvariancestabilizeddata function in DESeq (to get normal distribution). Then DE gene identification using F tests in LIMMA Multiple test correction False Discovery Rate (FDR) q value
71 RNA-seq data analysis Differentially expressed gene detection
72 Plant MetGenMAP Omics Genomics Transcriptomics Proteomics Metabolomics Integration & Analysis Functional annotations of genes Biological networks Dynamic behaviors of genes Information Altered pathways Altered biological processes Transcriptional changes Metabolic changes Functional roles of genes Regulators of changed genes
73 Plant MetGenMAP Altered pathways Altered biological processes Transcriptional changes Metabolic changes Functional roles of genes Regulators of changed genes (Joung et al., Plant Physiology, 2009)
74 Plant MetGenMAP User Input Gene expression, metabolite dataset Data Management PathVisualizer Visualization of pathways The Pathway Tools Pathway Repository PathFinder Identification of significantly altered pathways Pathway Browser Gene Ontology Sequence Repository Gene Function Repository PromAnalyzer Identification of over-represented regulatory motifs FunctAnnotator Identification of over-represented functional categories Dataset Analyzer User Dataset AHRD - Automatic assignment of human readable descriptions
75 Supported platforms Plant MetGenMAP
76 Plant MetGenMAP Need an account to use the system for easier project management
77 Plant MetGenMAP
78 Plant MetGenMAP Altered pathways
79 Plant MetGenMAP Pathway visualization
80 Plant MetGenMAP Defining functional roles of genes
81 Plant MetGenMAP Associating Genes, Metabolites and Phenotypes in Tomato Using Plant MetGenMAP
82 Plant MetGenMAP IL3-2 M82 Includes the S. pennellii introgression segment containing the r gene (fruit specific phytoene synthase) and has very low levels of lycopene transcriptome metabolites
83 Plant MetGenMAP Pathways Significantly Altered in Tomato Introgression Line IL3-2 Pathway P value (FDR) carotenoid biosynthesis glutamate degradation III sucrose degradation I arginine degradation VII (arginase 3 pathway) lipoxygenase pathway jasmonic acid biosynthesis
84 Plant MetGenMAP Sucrose degradation pathway M82 IL3-2 8 mg/gfw glucose fructose
85 Plant MetGenMAP Mapping Gene Expression Profiles to Metabolic Pathways in Arabidopsis UV-A, Blue, Far-red, Red 1, Red 2, Uv-A/B and White Light 4 h 40 min 14 conditions
86 40min 4h Plant MetGenMAP Pathways Specifically Regulated by Long-term or Short-term Lights P value < 0.05 Pathway photosynthesis photosynthesis, light reaction chlorophyllide a biosynthesis Calvin cycle salicylic acid biosynthesis anthocyanin biosynthesis flavonoid biosynthesis spermidine biosynthesis spermine biosynthesis stachyose biosynthesis superpathway of polyamine biosynthesis Light treatments AL,BL,FL,PL,RL,UL,WL AL,BL,FL,PL,RL,UL,WL AL,BL,FL,PL,RL,UL,WL BL,FL, RL,WL BL,FL, RL,UL FS,PS,RS,WS AS,FS,PS,RS AS,BS,PS, WS AS,BS,PS,US,WS AS,BS,US,WS AS,BS,PS,US,WS AL(UV-A), BL(blue), FL(far-red), PL(red 1 ), RL(red 2 ), UL(UV-A/B), WL(white)
87 Plant MetGenMAP Promoter analysis of co-expressed genes in a specific pathway The regulation of metabolite biosynthesis is coordinated by specific transcription factors. A subset of genes in the same pathway could be regulated by common transcription factors. Plant MetGenMAP identifies overrepresented motifs from promoter sequences of a set of co-expressed genes in a specific metabolite pathway
88 Plant MetGenMAP Known Enriched Regulatory Motifs from the Altered Pathways in Light Treatments Microarray datasets: long term UV-A and short term blue light treatments Pathways: photosynthesis, photosynthesis (light reaction), chlorophyllide a biosynthesis, leucine degradation, valine biosynthesis, and spermine biosynthesis Consensus Pathway Motif name P value Reference of known motif CACGTGGC Photosynthesis, light reaction G-box 2.13e-12 (Terzaghi and Cashmore, 1995) GCCACGTG Photosynthesis, light reaction SORLIP e-12 (Jiao et al., 2005) GmCACGTG Photosynthesis G-box 3.5e-11 (Terzaghi and Cashmore, 1995) AGATAAGA Leucine degradation pathway I-box 2.03e-4 (Escobar et al., 2004; Martinez-Hernand ez et al., 2002; Chattopadhyay et al., 1 998; Giuliano et al., 1988) Important candidate transcriptional regulators Modulate the expression of a subset of genes in a specific metabolic pathway Candidates for further engineering the production of important plant metabolites
89 Plant MetGenMAP Enriched Gene Ontology Terms in Light Treatments generation of precursor metabolites and energy photosynthesis chlorophyll biosynthetic process porphyrin biosynthetic process tetrapyrrole biosynthetic process chlorophyll metabolic process tetrapyrrole metabolic process porphyrin metabolic process oxidation reduction heterocycle metabolic process cofactor biosynthetic process regulation of photosynthesis photosynthetic electron transport chain cofactor metabolic process photosynthesis, light harvesting in photosystem I regulation of generation of precursor metabolites and energy regulation of photosynthesis, light reaction pigment biosynthetic process pigment metabolic process secondary metabolic process cellular metabolic process metabolic process cellular process Photosynthesis related 218 GO terms response to radiation response to light stimulus 40 min 4 h regulation of biosynthetic process regulation of cellular biosynthetic process regulation of transcription regulation of metabolic process regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process regulation of macromolecule biosynthetic process regulation of biological process regulation of cellular process regulation of cellular metabolic process regulation of gene expression biological regulation response to osmotic stress regulation of macromolecule metabolic process response to salt stress response to endogenous stimulus transcription response to abscisic acid stimulus regulation of RNA metabolic process regulation of transcription, DNA-dependent response to ethylene stimulus response to hormone stimulus intracellular signaling cascade response to cadmium ion response to far red light signal transduction response to jasmonic acid stimulus response to UV-B detection of light stimulus involved in visual perception detection of light stimulus involved in sensory perception detection of stimulus involved in sensory perception phototransduction red, far-red light phototransduction detection of light stimulus detection of visible light visual perception system process cognition sensory perception of light stimulus sensory perception neurological system process detection of abiotic stimulus cell communication response to external stimulus rhythmic process circadian rhythm response to metal ion detection of external stimulus response to water response to water deprivation response to inorganic substance detection of stimulus photomorphogenesis Stress related
90 Plant MetGenMAP Functional Classification of Genes Up-regulated in Each of Light Treatments 40 min 4 h Light treatments trigger systems which helps plants to fight against light stresses Light treatments caused significant changes of associated primary and secondary metabolite levels
RNA-Seq analysis workshop
RNA-Seq analysis workshop Zhangjun Fei Boyce Thompson Institute for Plant Research USDA Robert W. Holley Center for Agriculture and Health Cornell University Outline Background of RNA-Seq Application of
RNA-Seq analysis workshop. Zhangjun Fei
RNA-Seq analysis workshop Zhangjun Fei Outline Background of RNA-Seq Application of RNA-Seq (what RNA-Seq can do?) Available sequencing platforms and strategies and which one to choose RNA-Seq data analysis
Transcriptome analysis
Statistical Bioinformatics: Transcriptome analysis Stefan Seemann seemann@rth.dk University of Copenhagen April 11th 2018 Outline: a) How to assess the quality of sequencing reads? b) How to normalize
Transcriptomics analysis with RNA seq: an overview Frederik Coppens
Transcriptomics analysis with RNA seq: an overview Frederik Coppens Platforms Applications Analysis Quantification RNA content Platforms Platforms Short (few hundred bases) Long reads (multiple kilobases)
Experimental Design. Sequencing. Data Quality Control. Read mapping. Differential Expression analysis
-Seq Analysis Quality Control checks Reproducibility Reliability -seq vs Microarray Higher sensitivity and dynamic range Lower technical variation Available for all species Novel transcript identification
RNA-sequencing. Next Generation sequencing analysis Anne-Mette Bjerregaard. Center for biological sequence analysis (CBS)
RNA-sequencing Next Generation sequencing analysis 2016 Anne-Mette Bjerregaard Center for biological sequence analysis (CBS) Terms and definitions TRANSCRIPTOME The full set of RNA transcripts and their
Introduction to RNA-Seq
Introduction to RNA-Seq Monica Britton, Ph.D. Bioinformatics Analyst September 2014 Workshop Overview of Today s Activities Morning RNA-Seq Concepts, Terminology, and Work Flows Two-Condition Differential
1. Introduction Gene regulation Genomics and genome analyses
1. Introduction Gene regulation Genomics and genome analyses 2. Gene regulation tools and methods Regulatory sequences and motif discovery TF binding sites Databases 3. Technologies Microarrays Deep sequencing
De novo assembly in RNA-seq analysis.
De novo assembly in RNA-seq analysis. Joachim Bargsten Wageningen UR/PRI/Plant Breeding October 2012 Motivation Transcriptome sequencing (RNA-seq) Gene expression / differential expression Reconstruct
ChIP-seq and RNA-seq. Farhat Habib
ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions
Applications of short-read
Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Sequencing applications RNA-Seq includes experiments
Introduction to RNA-Seq
Introduction to RNA-Seq Monica Britton, Ph.D. Sr. Bioinformatics Analyst March 2015 Workshop Overview of RNA-Seq Activities RNA-Seq Concepts, Terminology, and Work Flows Using Single-End Reads and a Reference
Sequencing applications. Today's outline. Hands-on exercises. Applications of short-read sequencing: RNA-Seq and ChIP-Seq
Sequencing applications Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ RNA-Seq includes experiments
ChIP-seq and RNA-seq
ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)
RNA-Seq de novo assembly training
RNA-Seq de novo assembly training Training session aims Give you some keys elements to look at during read quality check. Transcriptome assembly is not completely a strait forward process : Multiple strategies
Wheat CAP Gene Expression with RNA-Seq
Wheat CAP Gene Expression with RNA-Seq July 9 th -13 th, 2018 Overview of the workshop, Alina Akhunova http://www.ksre.k-state.edu/igenomics/workshops/ RNA-Seq Workshop Activities Lectures Laboratory Molecular
Sequence Analysis 2RNA-Seq
Sequence Analysis 2RNA-Seq Lecture 10 2/21/2018 Instructor : Kritika Karri kkarri@bu.edu Transcriptome Entire set of RNA transcripts in a given cell for a specific developmental stage or physiological
Transcriptome Assembly, Functional Annotation (and a few other related thoughts)
Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 23, 2017 Differential Gene Expression Generalized Workflow File Types
CBC Data Therapy. Metatranscriptomics Discussion
CBC Data Therapy Metatranscriptomics Discussion Metatranscriptomics Extract RNA, subtract rrna Sequence cdna QC Gene expression, function Institute for Systems Genomics: Computational Biology Core bioinformatics.uconn.edu
Eucalyptus gene assembly
Eucalyptus gene assembly ACGT Plant Biotechnology meeting Charles Hefer Bioinformatics and Computational Biology Unit University of Pretoria October 2011 About Eucalyptus Most valuable and widely planted
Deep Sequencing technologies
Deep Sequencing technologies Gabriela Salinas 30 October 2017 Transcriptome and Genome Analysis Laboratory http://www.uni-bc.gwdg.de/index.php?id=709 Microarray and Deep-Sequencing Core Facility University
Finding Genes with Genomics Technologies
PLNT2530 Plant Biotechnology (2018) Unit 7 Finding Genes with Genomics Technologies Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License
GREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
How to deal with your RNA-seq data?
How to deal with your RNA-seq data? Rachel Legendre, Thibault Dayris, Adrien Pain, Claire Toffano-Nioche, Hugo Varet École de bioinformatique AVIESAN-IFB 2017 1 Rachel Legendre Bioinformatics 27/11/2018
measuring gene expression December 5, 2017
measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA
measuring gene expression December 11, 2018
measuring gene expression December 11, 2018 Intervening Sequences (introns): how does the cell get rid of them? Splicing!!! Highly conserved ribonucleoprotein complex recognizes intron/exon junctions and
RNA-Seq data analysis course September 7-9, 2015
RNA-Seq data analysis course September 7-9, 2015 Peter-Bram t Hoen (LUMC) Jan Oosting (LUMC) Celia van Gelder, Jacintha Valk (BioSB) Anita Remmelzwaal (LUMC) Expression profiling DNA mrna protein Comprehensive
Introduction to RNA sequencing
Introduction to RNA sequencing Bioinformatics perspective Olga Dethlefsen NBIS, National Bioinformatics Infrastructure Sweden November 2017 Olga (NBIS) RNA-seq November 2017 1 / 49 Outline Why sequence
RNA-SEQUENCING ANALYSIS
RNA-SEQUENCING ANALYSIS Joseph Powell SISG- 2018 CONTENTS Introduction to RNA sequencing Data structure Analyses Transcript counting Alternative splicing Allele specific expression Discovery APPLICATIONS
Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013
Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance
RNA standards v May
Standards, Guidelines and Best Practices for RNA-Seq: 2010/2011 I. Introduction: Sequence based assays of transcriptomes (RNA-seq) are in wide use because of their favorable properties for quantification,
Analysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ),
Analysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ), 2012-01-26 What is a gene What is a transcriptome History of gene expression assessment RNA-seq RNA-seq analysis
RNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia
RNA-Seq Workshop AChemS 2017 Sunil K Sukumaran Monell Chemical Senses Center Philadelphia Benefits & downsides of RNA-Seq Benefits: High resolution, sensitivity and large dynamic range Independent of prior
RNAseq Applications in Genome Studies. Alexander Kanapin, PhD Wellcome Trust Centre for Human Genetics, University of Oxford
RNAseq Applications in Genome Studies Alexander Kanapin, PhD Wellcome Trust Centre for Human Genetics, University of Oxford RNAseq Protocols Next generation sequencing protocol cdna, not RNA sequencing
RNA-Sequencing analysis
RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges
Next-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA. March 2, Steven R. Kain, Ph.D. ABRF 2013
Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA March 2, 2013 Steven R. Kain, Ph.D. ABRF 2013 NuGEN s Core Technologies Selective Sequence Priming Nucleic Acid Amplification
The Genome Analysis Centre. Building Excellence in Genomics and Computa5onal Bioscience
Building Excellence in Genomics and Computa5onal Bioscience Resequencing approaches Sarah Ayling Crop Genomics and Diversity sarah.ayling@tgac.ac.uk Why re- sequence plants? To iden
Introduction to transcriptome analysis using High Throughput Sequencing technologies. D. Puthier 2012
Introduction to transcriptome analysis using High Throughput Sequencing technologies D. Puthier 2012 A typical RNA-Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
Total RNA isola-on End Repair of double- stranded cdna
Total RNA isola-on End Repair of double- stranded cdna mrna Isola8on using Oligo(dT) Magne8c Beads AAAAAAA A Adenyla8on (A- Tailing) A AAAAAAAAAAAA TTTTTTTTT AAAAAAA TTTTTTTTT TTTTTTTT TTTTTTTTT AAAAAAAA
Third Generation Sequencing
Third Generation Sequencing By Mohammad Hasan Samiee Aref Medical Genetics Laboratory of Dr. Zeinali History of DNA sequencing 1953 : Discovery of DNA structure by Watson and Crick 1973 : First sequence
Gene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
RNA-Seq Analysis. Simon Andrews, Laura v
RNA-Seq Analysis Simon Andrews, Laura Biggins simon.andrews@babraham.ac.uk @simon_andrews v2018-10 RNA-Seq Libraries rrna depleted mrna Fragment u u u u NNNN Random prime + RT 2 nd strand synthesis (+
RNA Sequencing: Experimental Planning and Data Analysis. Nadia Atallah September 12, 2018
RNA Sequencing: Experimental Planning and Data Analysis Nadia Atallah September 12, 2018 A Next Generation Sequencing (NGS) Refresher Became commercially available in 2005 Construction of a sequencing
Analysis of RNA-seq Data
Analysis of RNA-seq Data A physicist and an engineer are in a hot-air balloon. Soon, they find themselves lost in a canyon somewhere. They yell out for help: "Helllloooooo! Where are we?" 15 minutes later,
RNA-Seq. Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University
RNA-Seq Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University joshua.ainsley@tufts.edu Day five Alternative splicing Assembly RNA edits Alternative splicing
RNA-Seq Software, Tools, and Workflows
RNA-Seq Software, Tools, and Workflows Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 1, 2016 Some mrna-seq Applications Differential gene expression analysis Transcriptional profiling Assumption:
NGS technologies: a user s guide. Karim Gharbi & Mark Blaxter
NGS technologies: a user s guide Karim Gharbi & Mark Blaxter genepool-manager@ed.ac.uk Natural history of sequencing 2 Brief history of sequencing 100s bp throughput 100 Gb 1977 1986 1995 1999 2005 2007
About Strand NGS. Strand Genomics, Inc All rights reserved.
About Strand NGS Strand NGS-formerly known as Avadis NGS, is an integrated platform that provides analysis, management and visualization tools for next-generation sequencing data. It supports extensive
Genome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
Computational & Quantitative Biology Lecture 6 RNA Sequencing
Peter A. Sims Dept. of Systems Biology Dept. of Biochemistry & Molecular Biophysics Sulzberger Columbia Genome Center October 27, 2014 Computational & Quantitative Biology Lecture 6 RNA Sequencing We Have
Plant Breeding and Agri Genomics. Team Genotypic 24 November 2012
Plant Breeding and Agri Genomics Team Genotypic 24 November 2012 Genotypic Family: The Best Genomics Experts Under One Roof 10 PhDs and 78 MSc MTech BTech ABOUT US! Genotypic is a Genomics company, which
Reads to Discovery. Visualize Annotate Discover. Small DNA-Seq ChIP-Seq Methyl-Seq. MeDIP-Seq. RNA-Seq. RNA-Seq.
Reads to Discovery RNA-Seq Small DNA-Seq ChIP-Seq Methyl-Seq RNA-Seq MeDIP-Seq www.strand-ngs.com Analyze Visualize Annotate Discover Data Import Alignment Vendor Platforms: Illumina Ion Torrent Roche
Analysis of RNA-seq Data. Feb 8, 2017 Peikai CHEN (PHD)
Analysis of RNA-seq Data Feb 8, 2017 Peikai CHEN (PHD) Outline What is RNA-seq? What can RNA-seq do? How is RNA-seq measured? How to process RNA-seq data: the basics How to visualize and diagnose your
Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist
Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data
COMPUTATIONAL PREDICTION AND CHARACTERIZATION OF A TRANSCRIPTOME USING CASSAVA (MANIHOT ESCULENTA) RNA-SEQ DATA
COMPUTATIONAL PREDICTION AND CHARACTERIZATION OF A TRANSCRIPTOME USING CASSAVA (MANIHOT ESCULENTA) RNA-SEQ DATA AOBAKWE MATSHIDISO, SCOTT HAZELHURST, CHRISSIE REY Wits Bioinformatics, University of the
Matthew Tinning Australian Genome Research Facility. July 2012
Next-Generation Sequencing: an overview of technologies and applications Matthew Tinning Australian Genome Research Facility July 2012 History of Sequencing Where have we been? 1869 Discovery of DNA 1909
The Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica
The Ensembl Database Dott.ssa Inga Prokopenko Corso di Genomica 1 www.ensembl.org Lecture 7.1 2 What is Ensembl? Public annotation of mammalian and other genomes Open source software Relational database
Application of NGS (next-generation sequencing) for studying RNA regulation
Application of NGS (next-generation sequencing) for studying RNA regulation SAIHST, SKKU Sung Wook Chi In this lecturre Intro: Sequencing Technology NGS (Next-Generation Sequencing) Sequencing of RNAs
Next Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
Statistical Genomics and Bioinformatics Workshop. Genetic Association and RNA-Seq Studies
Statistical Genomics and Bioinformatics Workshop: Genetic Association and RNA-Seq Studies RNA Seq and Differential Expression Analysis Brooke L. Fridley, PhD University of Kansas Medical Center 1 Next-generation
Background Wikipedia Lee and Mahadavan, JCB, 2009 History (Platform Comparison) P Park, Nature Review Genetics, 2009 P Park, Nature Reviews Genetics, 2009 Rozowsky et al., Nature Biotechnology, 2009
less sensitive than RNA-seq but more robust analysis pipelines expensive but quantitiatve standard but typically not high throughput
Chapter 11: Gene Expression The availability of an annotated genome sequence enables massively parallel analysis of gene expression. The expression of all genes in an organism can be measured in one experiment.
Bioinformatics Advice on Experimental Design
Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics
Next generation sequencing techniques" Toma Tebaldi Centre for Integrative Biology University of Trento
Next generation sequencing techniques" Toma Tebaldi Centre for Integrative Biology University of Trento Mattarello September 28, 2009 Sequencing Fundamental task in modern biology read the information
Sequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned
Sanger vs Next-Gen Sequencing
Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics
RNA-Seq Module 2 From QC to differential gene expression.
RNA-Seq Module 2 From QC to differential gene expression. Ying Zhang Ph.D, Informatics Analyst Research Informatics Support System (RISS) MSI Apr. 24, 2012 RNA-Seq Tutorials Tutorial 1: Introductory (Mar.
Introduction to NGS analyses
Introduction to NGS analyses Giorgio L Papadopoulos Institute of Molecular Biology and Biotechnology Bioinformatics Support Group 04/12/2015 Papadopoulos GL (IMBB, FORTH) IMBB NGS Seminar 04/12/2015 1
An introduction to RNA-seq. Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy
An introduction to RNA-seq Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy The central dogma Genome = all DNA in an organism (genotype) Transcriptome = all RNA (molecular
RNA Seq: Methods and Applica6ons. Prat Thiru
RNA Seq: Methods and Applica6ons Prat Thiru 1 Outline Intro to RNA Seq Biological Ques6ons Comparison with Other Methods RNA Seq Protocol RNA Seq Applica6ons Annota6on Quan6fica6on Other Applica6ons Expression
Application of NGS (nextgeneration. for studying RNA regulation. Sung Wook Chi. Sungkyunkwan University (SKKU) Samsung Medical Center (SMC)
Application of NGS (nextgeneration sequencing) for studying RNA regulation Samsung Advanced Institute of Heath Sciences and Technology (SAIHST) Sungkyunkwan University (SKKU) Samsung Research Institute
Long and short/small RNA-seq data analysis
Long and short/small RNA-seq data analysis GEF5, 4.9.2015 Sami Heikkinen, PhD, Dos. Topics 1. RNA-seq in a nutshell 2. Long vs short/small RNA-seq 3. Bioinformatic analysis work flows GEF5 / Heikkinen
TECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA
TECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA Stranded, Illumina ready library construction in
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation
Consensus Ensemble Approaches Improve De Novo Transcriptome Assemblies
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Computer Science and Engineering: Theses, Dissertations, and Student Research Computer Science and Engineering, Department
Research school methods seminar Genomics and Transcriptomics
Research school methods seminar Genomics and Transcriptomics Stephan Klee 19.11.2014 2 3 4 5 Genetics, Genomics what are we talking about? Genetics and Genomics Study of genes Role of genes in inheritence
Welcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
Experimental Design. Dr. Matthew L. Settles. Genome Center University of California, Davis
Experimental Design Dr. Matthew L. Settles Genome Center University of California, Davis settles@ucdavis.edu What is Differential Expression Differential expression analysis means taking normalized sequencing
Novel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc.
Novel methods for RNA and DNA- Seq analysis using SMART Technology Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc. Agenda Enabling Single Cell RNA-Seq using SMART Technology SMART
Transcriptomics. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona
Transcriptomics Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona Central dogma of molecular biology Central dogma of molecular biology Genome Complete DNA content of
Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis
Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods
Advanced RNA-Seq course. Introduction. Peter-Bram t Hoen
Advanced RNA-Seq course Introduction Peter-Bram t Hoen Expression profiling DNA mrna protein Comprehensive RNA profiling possible: determine the abundance of all mrna molecules in a cell / tissue Expression
Galaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory http://collaboratory.lifesci.ucla.edu Workshop Outline ü Day 1 UCLA galaxy
Motivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
Introduction of RNA-Seq Analysis
Introduction of RNA-Seq Analysis Jiang Li, MS Bioinformatics System Engineer I Center for Quantitative Sciences(CQS) Vanderbilt University September 21, 2012 Goal of this talk 1. Act as a practical resource
Applications of Next Generation Sequencing in Metagenomics Studies
Applications of Next Generation Sequencing in Metagenomics Studies Francesca Rizzo, PhD Genomix4life Laboratory of Molecular Medicine and Genomics Department of Medicine and Surgery University of Salerno
Shuji Shigenobu. April 3, 2013 Illumina Webinar Series
Shuji Shigenobu April 3, 2013 Illumina Webinar Series RNA-seq RNA-seq is a revolutionary tool for transcriptomics using deepsequencing technologies. genome HiSeq2000@NIBB (Wang 2009 with modifications)
Analysis of RNA-seq Data. Bernard Pereira
Analysis of RNA-seq Data Bernard Pereira The many faces of RNA-seq Applications Discovery Find new transcripts Find transcript boundaries Find splice junctions Comparison Given samples from different experimental
Form for publishing your article on BiotechArticles.com this document to
Your Article: Article Title (3 to 12 words) Article Summary (In short - What is your article about Just 2 or 3 lines) Category Transcriptomics sequencing and lncrna Sequencing Analysis: Quality Evaluation
Mapping strategies for sequence reads
Mapping strategies for sequence reads Ernest Turro University of Cambridge 21 Oct 2013 Quantification A basic aim in genomics is working out the contents of a biological sample. 1. What distinct elements
AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE
ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS
Genome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does
Sequence Based Function Annotation
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological
02 Agenda Item 03 Agenda Item
01 Agenda Item 02 Agenda Item 03 Agenda Item SOLiD 3 System: Applications Overview April 12th, 2010 Jennifer Stover Field Application Specialist - SOLiD Applications Workflow for SOLiD Application Application
Analysis of Differential Gene Expression in Cattle Using mrna-seq
Analysis of Differential Gene Expression in Cattle Using mrna-seq mrna-seq A rough guide for green horns Animal and Grassland Research and Innovation Centre Animal and Bioscience Research Department Teagasc,
Next Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017
Next Generation Sequencing Jeroen Van Houdt - Leuven 13/10/2017 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977 A Maxam and W Gilbert "DNA seq by chemical degradation" F Sanger"DNA
10/06/2014. RNA-Seq analysis. With reference assembly. Cormier Alexandre, PhD student UMR8227, Algal Genetics Group
RNA-Seq analysis With reference assembly Cormier Alexandre, PhD student UMR8227, Algal Genetics Group Summary 2 Typical RNA-seq workflow Introduction Reference genome Reference transcriptome Reference
SCIENCE CHINA Life Sciences. Comparative analysis of de novo transcriptome assembly
SCIENCE CHINA Life Sciences SPECIAL TOPIC February 2013 Vol.56 No.2: 156 162 RESEARCH PAPER doi: 10.1007/s11427-013-4444-x Comparative analysis of de novo transcriptome assembly CLARKE Kaitlin 1, YANG