Epigenetic control of tomato fruit development. Key Laboratories of Molecular Epigenetics of MOE, Northeast Normal University, Changchun, China
|
|
|
- Erin Kelley
- 6 years ago
- Views:
Transcription
1 Epigenetic control of tomato fruit development Silin Zhong 1,2*,, Zhangjun Fei 1,3,*,, Yun-Ru Chen 1, Yi Zheng 1, Mingyun Huang 1, Julia Vrebalov 1, Ryan McQuinn 1, Nigel Gapper 1, Bao Liu 2, Jenny Xiang 4, Ying Shao 4, James J. Giovannoni 1,3* 1 Boyce Thompson Institute for Plant Research, Cornell University, USA 2 Key Laboratories of Molecular Epigenetics of MOE, Northeast Normal University, Changchun, China 3 U.S. Department of Agriculture/Agriculture Research Service, Robert W. Holley Centre for Agriculture and Health, USA 4 Weill Medical College, Cornell University, USA * To whom correspondence should be addressed: James Giovannoni (jjg33@cornell.edu), Zhangjun Fei (zf25@cornell.edu), Silin Zhong (sz284@cornell.edu) Equal contribution Supplementary Figures S1 to S11 All data presented in this study can be assessed from the Tomato Epigenome Database (
2 Supplementary Figure 1 Density plot of 5-methylcytosine in the 12 tomato chromosomes of mature green fruit for each of four methylated cytosine sequence contexts. Y-axis indicates the number (in 1000 s) of 5mC in each 500 kb chromosome window. The area above zero refers to cytosines residing in the Crick strand and that below refers to the Watson strand. Line color reflects the indicated cytosine sequence context.
3 Supplementary Figure 2 DNA cytosine methylation rates across the twelve tomato chomosomes of mature green fruit. Black rectangles indicate approximate centromere positions. Line colors reflect the indicated cytosine sequence contexts.
4 Supplementary Figure 3 DNA cytosine methylation context in tomato and Arabidopsis. Fraction of 5-methylcytosines identified in each context for the tomato and Arabidopsis (Col-0) leaf tissues.
5 Supplementary Figure 4 Association of DNA cytosine methylation, TE density, small RNA and gene expression. Genes were classified into 5 groups based on their expression level in tomato fruit at 39DPA (group 5: highest, group 1: lowest). (A) Distribution of miniature inverted transposable elements (MITEs) in the regions 2 kb upstream and downstream of TSS and PAS (bin size = 100 bp). (B) Distribution of 24nt small RNAs. (C) Distribution of CG methylation. (D) Distribution of CWG methylation. (E) Distribution of CCG methylation. (F) Distribution of CHH methylation. TSS: transcription start site; PAS: polyadenylation site.
6 Supplementary Figure 5 DNA cytosine methylation of transposable elements. (A) Methylation rate of long terminal repeats (LTRs). (B) Methylation rate of miniature inverted transposable elements (MITEs). (C) Methylation rate of long interspersed elements (LINEs). (D) Methylation rate of short interspersed elements (SINEs). (E) Distribution of different classes of TE in chromosome 1 and the total number of each class of annotated TEs in the tomato genome are shown (bin size = 500 kb). (F) Distribution of LTRs and MITEs in gene regions (bin size = 100 bp). TSS: transcription start site; PAS: polyadenylation site.
7 Supplementary Figure 6 DNA cytosine methylation levels in chromosome 1 and genic regions. (A-C) Methylation rate of chromosome 1 in each sequence context (bin = 500 kb). (D-F) Methylation rate of gene bodies and surrounding regions (bin = 100 bp). (G-I) Methylation rate of non-ripening mutant Cnr and rin fruits at 42 DPA. TSS: transcription start site; PAS: polyadenylation site.
8 Supplementary Figure 7 Targets of the MADS-box transcription factor RIN. Genome browser showing the ChIP-Seq peaks indicative of RIN binding in (A) ACC SYNTHASE 2, (B) ACC SYNTHASE 4, (C) PHYTOENE SYNTHASE 1, (D) LIPOXYGENASES, (E) POLYGALACTURONASE and (F) ethylene responsive gene E8. Three ChIP-Seq biological replicates (rep 1 to 3) and one negative control library are shown (Scale = 1 kb). (G) Ripening gene expression patterns in wild-type and RIN loss-of-function mutant.
9 Supplementary Figure 8 RIN targets known fruit ripening regulators and binds its own promoter. Genome browser showing the ChIP-Seq peaks indicative of RIN binding in (A) RIN itself, (B) NAC-domain transcription factor NON-RIPENING (NOR), (C) MADS-box transcription factor TOMOATO AGAMOUS-LIKE 1 (TAGL1), (D) MADS-box transcription factor TDR4, (E) SPB transcription factor COLORLESS NON-RIPENING (CNR) and (F) ethylene receptor NEVER-RIPE (NR). Three ChIP-Seq biological replicates (rep 1 to 3) and one negative control library are shown (Scale = 1 kb). (G) Gene expression patterns in wild-type and RIN loss-of-function mutant.
10 Supplementary Figure 9 RIN binding sites and DMRs in fruit ripening regulatory gene loci. Genome browser showing cytosine methylation levels and ChIP-Seq peaks indicative of RIN binding in gene loci encoding (A) ACC SYNTHASE 4 (ACS4), a rate limiting enzyme for ripening ethylene production, (B) fruit-specific ethylene responsive gene E8, (C) MADS-box transcription factor TDR4 and (D) NAC domain containing transcription factor NON-RIPENING (NOR). Track labels from top to bottom: cytosine methylation levels in leaf, immature fruit (17dpa), mature green fruit (39dpa), ripening fruit (42dpa), ripened fruit (52dpa), cnr mutant fruit at 42dpa, rin mutant fruit at 42dpa, transposable elements (TEs), gene (scale = 1 kb).
11 Supplementary Figure 10 DNA cytosine methylation adjacent to RIN binding sites. (A-C) Average methylation levels near all RIN binding sites in each sequence context. The x-axis represents the distance to the RIN ChIP-Seq summit (bin = 20 bp).
12 Supplementary Figure 11 Small RNA density adjacent to RIN binding sites. The raw small RNA sequencing read counts near RIN binding sites were normalized by library size to read per million (RPM). The y-axis represent srna density, and x-axis represents the distance to the RIN ChIP-Seq summit (bin = 20 bp).
Single-base resolution methylomes of tomato fruit development reveal epigenome modifications associated with ripening
A rt i c l e s Single-base resolution methylomes of tomato fruit development reveal epigenome modifications associated with ripening Silin Zhong 1,2,5, Zhangjun Fei 1,3,5, Yun-Ru Chen 1, Yi Zheng 1, Mingyun
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Origin use and efficiency are similar among WT, rrm3, pif1-m2, and pif1-m2; rrm3 strains. A. Analysis of fork progression around confirmed and likely origins (from cerevisiae.oridb.org).
DNA. bioinformatics. epigenetics methylation structural variation. custom. assembly. gene. tumor-normal. mendelian. BS-seq. prediction.
Epigenomics T TM activation SNP target ncrna validation metagenomics genetics private RRBS-seq de novo trio RIP-seq exome mendelian comparative genomics DNA NGS ChIP-seq bioinformatics assembly tumor-normal
ChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015
ChIP-Seq Data Analysis J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind DNA
Simultaneous profiling of transcriptome and DNA methylome from a single cell
Additional file 1: Supplementary materials Simultaneous profiling of transcriptome and DNA methylome from a single cell Youjin Hu 1, 2, Kevin Huang 1, 3, Qin An 1, Guizhen Du 1, Ganlu Hu 2, Jinfeng Xue
Activation of a Floral Homeotic Gene in Arabidopsis
Activation of a Floral Homeotic Gene in Arabidopsis By Maximiliam A. Busch, Kirsten Bomblies, and Detlef Weigel Presentation by Lis Garrett and Andrea Stevenson http://ucsdnews.ucsd.edu/archive/graphics/images/image5.jpg
RNA-Seq analysis workshop
RNA-Seq analysis workshop Zhangjun Fei Boyce Thompson Institute for Plant Research USDA Robert W. Holley Center for Agriculture and Health Cornell University Outline Background of RNA-Seq Application of
Bioinformatics: Opportunities and Challenges for Data Recovery, Analysis and Sustainability
Bioinformatics: Opportunities and Challenges for Data Recovery, Analysis and Sustainability The changing pace of biology in the genomics era The Systems explosion Role of the informatics specialist Challenges
Supporting Information
Supporting Information Ho et al. 1.173/pnas.81288816 SI Methods Sequences of shrna hairpins: Brg shrna #1: ccggcggctcaagaaggaagttgaactcgagttcaacttccttcttgacgnttttg (TRCN71383; Open Biosystems). Brg shrna
About Strand NGS. Strand Genomics, Inc All rights reserved.
About Strand NGS Strand NGS-formerly known as Avadis NGS, is an integrated platform that provides analysis, management and visualization tools for next-generation sequencing data. It supports extensive
Differential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression September 28, 2006 Chromatin Structure ~140 bp ~60 bp Transcriptional Regulation: 1. Packing prevents access CH 3 2. Acetylation ( C O )
CHAPTERS , 17: Eukaryotic Genetics
CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions
Lecture 3 Mutagens and Mutagenesis. 1. Mutagens A. Physical and Chemical mutagens B. Transposons and retrotransposons C. T-DNA
Lecture 3 Mutagens and Mutagenesis 1. Mutagens A. Physical and Chemical mutagens B. Transposons and retrotransposons C. T-DNA 2. Mutagenesis A. Screen B. Selection C. Lethal mutations Read: 508-514 Figs:
Differential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression June 19, 2008 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:
Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA.
Summary of Supplemental Information Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA. Figure S2: rrna removal procedure is effective for clearing out
Highly Integrated Single-Base Resolution Maps of the Epigenome in Arabidopsis
Please cite this article in press as: Lister et al., Highly Integrated Single-Base Resolution Maps of the Epigenome in Arabidopsis, Cell (2008), doi:10.1016/j.cell.2008.03.029 Resource Highly Integrated
Genome-Wide Analysis of DNA Methylation and Gene Expression Changes in Two Arabidopsis Ecotypes and Their Reciprocal Hybrids W
The Plant Cell, Vol. 24: 875 892, March 2012, www.plantcell.org ã 2012 American Society of Plant Biologists. All rights reserved. LARGE-SCALE BIOLOGY ARTICLE Genome-Wide Analysis of DNA Methylation and
Supporting Information
Supporting Information Yuan et al. 10.1073/pnas.0906869106 Fig. S1. Heat map showing that Populus ICS is coregulated with orthologs of Arabidopsis genes involved in PhQ biosynthesis and PSI function, but
Chapter 2 The Structure of Genes and Genomes. Electron micrograph of a metaphase chromosome
Chapter 2 The Structure of Genes and Genomes Electron micrograph of a metaphase chromosome Genetic information is stored in double stranded DNA DNA structure, building blocks: (A) Bases DNA structure,
Supplementary Figure 1: sgrna library generation and the length of sgrnas for the functional screen. (a) A diagram of the retroviral vector for sgrna
Supplementary Figure 1: sgrna library generation and the length of sgrnas for the functional screen. (a) A diagram of the retroviral vector for sgrna expression. It contains a U6-promoter-driven sgrna
Construction of plant complementation vector and generation of transgenic plants
MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological
Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013
Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance
DNA, Replication and RNA
DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is
The ENCODE Encyclopedia. & Variant Annotation Using RegulomeDB and HaploReg
The ENCODE Encyclopedia & Variant Annotation Using RegulomeDB and HaploReg Jill E. Moore Weng Lab University of Massachusetts Medical School October 10, 2015 Where s the Encyclopedia? ENCODE: Encyclopedia
Chapter 5. Genetic Models. Organization and Expression of Immunoglobulin Genes 3. The two-gene model: Models to Explain Antibody Diversity
Chapter 5 Organization and Expression of Immunoglobulin Genes 3 4 5 6 Genetic Models How to account for: ) Vast diversity of antibody specificities ) Presence of Variable regions at the amino end of Heavy
The ChIP-Seq project. Giovanna Ambrosini, Philipp Bucher. April 19, 2010 Lausanne. EPFL-SV Bucher Group
The ChIP-Seq project Giovanna Ambrosini, Philipp Bucher EPFL-SV Bucher Group April 19, 2010 Lausanne Overview Focus on technical aspects Description of applications (C programs) Where to find binaries,
Nucleic acids. How DNA works. DNA RNA Protein. DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology
Nucleic acid chemistry and basic molecular theory Nucleic acids DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology Cell cycle DNA RNA Protein Transcription Translation
Appendix A DNA and PCR in detail DNA: A Detailed Look
Appendix A DNA and PCR in detail DNA: A Detailed Look A DNA molecule is a long polymer consisting of four different components called nucleotides. It is the various combinations of these four bases or
Eukaryotic Gene Structure
Eukaryotic Gene Structure Terminology Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Gene Basic physical and
Alternative Cleavage and Polyadenylation of RNA
Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related
% Viability. isw2 ino isw2 ino isw2 ino isw2 ino mM HU 4-NQO CPT
a Drug concentration b 1.3% MMS nhp1 nhp1 8 nhp1 mag1.5% MMS.3% MMS nhp1 nhp1 ino8 9 ino8 9 % Viability 4.5% MMS ino8 9 ino8 9 2.5.1.15 % MMS c d nhp1 nhp1 nhp1 nhp1 nhp1 nhp1 Control (YPD) γ IR (1 gy)
SUPPLEMENTAL MATERIALS
SUPPLEMENL MERILS Eh-seq: RISPR epitope tagging hip-seq of DN-binding proteins Daniel Savic, E. hristopher Partridge, Kimberly M. Newberry, Sophia. Smith, Sarah K. Meadows, rian S. Roberts, Mark Mackiewicz,
Sequence Annotation & Designing Gene-specific qpcr Primers (computational)
James Madison University From the SelectedWorks of Ray Enke Ph.D. Fall October 31, 2016 Sequence Annotation & Designing Gene-specific qpcr Primers (computational) Raymond A Enke This work is licensed under
Candidate region (0.74 Mb) ATC TCT GGG ACT CAT GAG CAG GAG GCT AGC ATC TCT GGG ACT CAT TAG CAG GAG GCT AGC
A idm-3 idm-3 B Physical distance (Mb) 4.6 4.86.6 8.4 C Chr.3 Recom. Rate (%) ATG 3.9.9.9 9.74 Candidate region (.74 Mb) n=4 TAA D idm-3 G3T(E4) G4A(W988) WT idm-3 ATC TCT GGG ACT CAT GAG CAG GAG GCT AGC
Introduction to Plant Genome and Gene Structure. Dr. Jonaliza L. Siangliw Rice Gene Discovery Unit, BIOTEC
Introduction to Plant Genome and Gene Structure Dr. Jonaliza L. Siangliw Rice Gene Discovery Unit, BIOTEC Defining genome Coined by Hans Winkler (1920) as genom(e) by joining gene and chromosome Lederberg
Complete Sample to Analysis Solutions for DNA Methylation Discovery using Next Generation Sequencing
Complete Sample to Analysis Solutions for DNA Methylation Discovery using Next Generation Sequencing SureSelect Human/Mouse Methyl-Seq Kyeong Jeong PhD February 5, 2013 CAG EMEAI DGG/GSD/GFO Agilent Restricted
Annotating 7G24-63 Justin Richner May 4, Figure 1: Map of my sequence
Annotating 7G24-63 Justin Richner May 4, 2005 Zfh2 exons Thd1 exons Pur-alpha exons 0 40 kb 8 = 1 kb = LINE, Penelope = DNA/Transib, Transib1 = DINE = Novel Repeat = LTR/PAO, Diver2 I = LTR/Gypsy, Invader
Nucleic Acids: DNA and RNA
Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,
Introduction to genome biology
Introduction to genome biology Lisa Stubbs We ve found most genes; but what about the rest of the genome? Genome size* 12 Mb 95 Mb 170 Mb 1500 Mb 2700 Mb 3200 Mb #coding genes ~7000 ~20000 ~14000 ~26000
Nature Methods: doi: /nmeth.4396
Supplementary Figure 1 Comparison of technical replicate consistency between and across the standard ATAC-seq method, DNase-seq, and Omni-ATAC. (a) Heatmap-based representation of ATAC-seq quality control
What we ll do today. Types of stem cells. Do engineered ips and ES cells have. What genes are special in stem cells?
Do engineered ips and ES cells have similar molecular signatures? What we ll do today Research questions in stem cell biology Comparing expression and epigenetics in stem cells asuring gene expression
The C-value paradox. PHAR2811: Genome Organisation. Is there too much DNA? C o t plots. What do these life forms have in common?
PHAR2811: enome Organisation Synopsis: -value paradox, different classes of DA, repetitive DA and disease. If protein-coding portions of the human genome make up only 1.5% what is the rest doing? The -value
Introduction to the UCSC genome browser
Introduction to the UCSC genome browser Dominik Beck NHMRC Peter Doherty and CINSW ECR Fellow, Senior Lecturer Lowy Cancer Research Centre, UNSW and Centre for Health Technology, UTS SYDNEY NSW AUSTRALIA
MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE?
MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE? Lesson Plan: Title Introduction to the Genome Browser: what is a gene? JOYCE STAMM Objectives Demonstrate basic skills in using the UCSC Genome
Year III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
Do engineered ips and ES cells have similar molecular signatures?
Do engineered ips and ES cells have similar molecular signatures? Comparing expression and epigenetics in stem cells George Bell, Ph.D. Bioinformatics and Research Computing 2012 Spring Lecture Series
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination.
Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Seeds of Col-0 were harvested from plants grown at 16 C, stored for 2 months, imbibed for indicated
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Number and length distributions of the inferred fosmids.
Supplementary Figure 1 Number and length distributions of the inferred fosmids. Fosmid were inferred by mapping each pool s sequence reads to hg19. We retained only those reads that mapped to within a
Cell Nucleus. Chen Li. Department of Cellular and Genetic Medicine
Cell Nucleus Chen Li Department of Cellular and Genetic Medicine 13 223 chenli2008@fudan.edu.cn Outline A. Historical background B. Structure of the nucleus: nuclear pore complex (NPC), lamina, nucleolus,
Green Center Computational Core ChIP- Seq Pipeline, Just a Click Away
Green Center Computational Core ChIP- Seq Pipeline, Just a Click Away Venkat Malladi Computational Biologist Computational Core Cecil H. and Ida Green Center for Reproductive Biology Science Introduc
I. Prokaryotic Gene Regulation. Figure 1: Operon. Operon:
I. Prokaryotic Gene Regulation Figure 1: Operon Operon: a) Regulatory Elements consist of an Operator that serves as the on-off switch for the genes of the operon. Also contains a promoter for the Structural
Meiotic crossovers are associated with open chromatin and enriched with Stowaway transposons in potato
Marand et al. Genome Biology (217) 18:23 DOI 1.1186/s1359-17-1326-8 RESEARCH Meiotic crossovers are associated with open chromatin and enriched with Stowaway transposons in potato Open Access Alexandre
ChIP-seq/Functional Genomics/Epigenomics. CBSU/3CPG/CVG Next-Gen Sequencing Workshop. Josh Waterfall. March 31, 2010
ChIP-seq/Functional Genomics/Epigenomics CBSU/3CPG/CVG Next-Gen Sequencing Workshop Josh Waterfall March 31, 2010 Outline Introduction to ChIP-seq Control data sets Peak/enriched region identification
Genome Annotation. What Does Annotation Describe??? Genome duplications Genes Mobile genetic elements Small repeats Genetic diversity
Genome Annotation Genome Sequencing Costliest aspect of sequencing the genome o But Devoid of content Genome must be annotated o Annotation definition Analyzing the raw sequence of a genome and describing
DNA methylation changes in response to sulfur dioxide stress in Arabidopsis plants
Available online at www.sciencedirect.com Procedia Environmental Sciences 18 ( 2013 ) 37 42 2013 International Symposium on Environmental Science and Technology (2013 ISEST) DNA methylation changes in
SNPs - GWAS - eqtls. Sebastian Schmeier
SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association
Genome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)
Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA
Supplemental Fig. 1. Transient expression of dynamic reporters of DNA methylation (DYNAMETs) in plants. (A) Schematic representation of potential
Supplemental Fig. 1. Transient expression of dynamic reporters of DNA methylation (DYNAMETs) in plants. (A) Schematic representation of potential dynamic reporter of DNA methylation (DYNAMET). A DYNAMET
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Processing of mutations and generation of simulated controls. On the left, a diagram illustrates the manner in which covariate-matched simulated mutations were obtained, filtered
Functional Genomics II
Functional Genomics II Jay Hesselberth PhD University of Colorado SOM Biochemistry & Molecular Genetics jay.hesselberth@gmail.com Outline Tues, May. Definition. Yeast genome 3. Gene-centric resources and
Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
DNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
TSSpredator User Guide v 1.00
TSSpredator User Guide v 1.00 Alexander Herbig alexander.herbig@uni-tuebingen.de Kay Nieselt kay.nieselt@uni-tuebingen.de June 3, 2013 1 Getting Started TSSpredator is a tool for the comparative detection
Transcription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
PeakSeq enables systematic scoring of ChIP-seq experiments relative to controls
PeakSeq enables systematic scoring of ChIP-seq experiments relative to controls Joel Rozowsky, Ghia Euskirchen 2, Raymond K Auerbach 3, Zhengdong D Zhang, Theodore Gibson, Robert Bjornson 4, Nicholas Carriero
Trasposable elements: Uses of P elements Problem set B at the end
Trasposable elements: Uses of P elements Problem set B at the end P-elements have revolutionized the way Drosophila geneticists conduct their research. Here, we will discuss just a few of the approaches
BIO303, Genetics Study Guide II for Spring 2007 Semester
BIO303, Genetics Study Guide II for Spring 2007 Semester 1 Questions from F05 1. Tryptophan (Trp) is encoded by the codon UGG. Suppose that a cell was treated with high levels of 5- Bromouracil such that
DNA - DEOXYRIBONUCLEIC ACID
DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating
Md Shamimuzzaman and Lila Vodkin *
Shamimuzzaman and Vodkin BMC Genomics 2013, 14:477 RESEARCH ARTICLE Open Access Genome-wide identification of binding sites for NAC and YABBY transcription factors and co-regulated genes during soybean
Supplemental Information. Antagonistic Activities of Sox2. and Brachyury Control the Fate Choice. of Neuro-Mesodermal Progenitors
Developmental Cell, Volume 42 Supplemental Information Antagonistic Activities of Sox2 and Brachyury Control the Fate Choice of Neuro-Mesodermal Progenitors Frederic Koch, Manuela Scholze, Lars Wittler,
earray 5.0 Create your own Custom Microarray Design
earray 5.0 Create your own Custom Microarray Design http://earray.chem.agilent.com earray 5.x Overview Session Summary Session Summary Agilent Genomics Microarray Solution earray Functional Overview Gene
Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist
Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data
DIFFERENTIAL METHYLATION METHODS IN MULTI-CONTEXT ORGANISMS
Libraries Annual Conference on Applied Statistics in Agriculture 2015-27th Annual Conference Proceedings DIFFERENTIAL METHYLATION METHODS IN MULTI-CONTEXT ORGANISMS Douglas Baumann University of Wisconsin
pdsipher and pdsipher -GFP shrna Vector User s Guide
pdsipher and pdsipher -GFP shrna Vector User s Guide NOTE: PLEASE READ THE ENTIRE PROTOCOL CAREFULLY BEFORE USE Page 1. Introduction... 1 2. Vector Overview... 1 3. Vector Maps 2 4. Materials Provided...
Pathogen Infection and MORC Proteins Affect Chromatin Accessibility of Transposable Elements and Expression of Their Proximal Genes in Arabidopsis
MPMI Vol. 29, No. 9, 2016, pp. 674 687. http://dx.doi.org/10.1094/mpmi-01-16-0023-r Pathogen Infection and MORC Proteins Affect Chromatin Accessibility of Transposable Elements and Expression of Their
Heritable Epigenetic Variation among Maize Inbreds
Heritable Epigenetic Variation among Maize Inbreds Steve R. Eichten 1., Ruth A. Swanson-Wagner 1., James C. Schnable 2, Amanda J. Waters 1, Peter J. Hermanson 1, Sanzhen Liu 3, Cheng-Ting Yeh 3, Yi Jia
Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro
Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro Philip Morris International R&D, Philip Morris Products S.A., Neuchatel, Switzerland Introduction Nicotiana sylvestris
translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
Lecture 21: Epigenetics Nurture or Nature? Chromatin DNA methylation Histone Code Twin study X-chromosome inactivation Environemnt and epigenetics
Lecture 21: Epigenetics Nurture or Nature? Chromatin DNA methylation Histone Code Twin study X-chromosome inactivation Environemnt and epigenetics Epigenetics represents the science for the studying heritable
Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.
Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How
The human noncoding genome defined by genetic diversity
SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41588-018-0062-7 In the format provided by the authors and unedited. The human noncoding genome defined by genetic diversity Julia di Iulio 1,5,
Chapter 24: Promoters and Enhancers
Chapter 24: Promoters and Enhancers A typical gene transcribed by RNA polymerase II has a promoter that usually extends upstream from the site where transcription is initiated the (#1) of transcription
How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information
DNA: CH 13 How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information Discovering DNA s Function 1928: Frederick Griffith studied
Chapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
DNA: The Molecule of Heredity
1 DNA: The Molecule of Heredity DNA Deoxyribonucleic acid Is a type of nucleic acid What chromosomes (and genes) are made of Made up of repeating nucleotide subunits 1 nucleotide looks like: Phosphate
Perm-seq: Mapping Protein-DNA Interactions in Segmental Duplication and Highly Repetitive Regions of Genomes with Prior- Enhanced Read Mapping
RESEARCH ARTICLE Perm-seq: Mapping Protein-DNA Interactions in Segmental Duplication and Highly Repetitive Regions of Genomes with Prior- Enhanced Read Mapping Xin Zeng 1,BoLi 2, Rene Welch 1, Constanza
DNA: The Genetic Material. Chapter 10
DNA: The Genetic Material Chapter 10 DNA as the Genetic Material DNA was first extracted from nuclei in 1870 named nuclein after their source. Chemical analysis determined that DNA was a weak acid rich
Genes - DNA - Chromosome. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology
Genes - DNA - Chromosome Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology DNA Cellular DNA contains genes and intragenic regions both of which may
Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
Assay Standards Working Group Nov 2012 Assay Standards Working Group Recommendations, November 2012
Assay Standards Working Group Recommendations, November 2012 Contents Assay Standards Working Group Recommendations, August 2012... 1 Contents... 1 Introduction... 2 1: Reference Epigenome Criteria...
Leveraging biological replicates to improve analysis in ChIP-seq experiments
, http://dx.doi.org/10.5936/csbj.201401002 CSBJ Leveraging biological replicates to improve analysis in ChIP-seq experiments Yajie Yang a,b, Justin Fear a,b, Jianhong Hu c, Irina Haecker d, Lei Zhou a,
Supplemental Data Supplemental Figure 1.
Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)
Transcription factor binding site prediction in vivo using DNA sequence and shape features
Transcription factor binding site prediction in vivo using DNA sequence and shape features Anthony Mathelier, Lin Yang, Tsu-Pei Chiu, Remo Rohs, and Wyeth Wasserman anthony.mathelier@gmail.com @AMathelier
LECTURE 12: INSIGHTS FROM GENOME SEQUENCING
LECTURE 12: INSIGHTS FROM GENOME SEQUENCING Read Chapter 10 (p366-375) DOE s Genomics and its implications (link at course website) STS (p359), SNP, SSR (integrates the following) Linkage, Physical, Sequence
CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016
CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene
Supplementary Table 1: Oligo designs. A list of ATAC-seq oligos used for PCR.
Ad1_noMX: Ad2.1_TAAGGCGA Ad2.2_CGTACTAG Ad2.3_AGGCAGAA Ad2.4_TCCTGAGC Ad2.5_GGACTCCT Ad2.6_TAGGCATG Ad2.7_CTCTCTAC Ad2.8_CAGAGAGG Ad2.9_GCTACGCT Ad2.10_CGAGGCTG Ad2.11_AAGAGGCA Ad2.12_GTAGAGGA Ad2.13_GTCGTGAT
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
BIO 101 : The genetic code and the central dogma
BIO 101 : The genetic code and the central dogma NAME Objectives The purpose of this exploration is to... 1. design experiments to decipher the genetic code; 2. visualize the process of protein synthesis;
Rice Structural and Functional Genome Research in ASPGC, Academia Sinica
Journal of Genetics and Molecular Biology Vol. 14, No. 4, 201-206, December 1, 2003 Rice Structural and Functional Genome Research in ASPGC, Academia Sinica Ya-Ting Chao 1, Chin-San Chen 1, Hong-Hwa Chen
Zool 3200: Cell Biology Exam 2 2/20/15
Name: TRASK Zool 3200: Cell Biology Exam 2 2/20/15 Answer each of the following short and longer answer questions in the space provided; circle the BEST answer or answers for each multiple choice question