Influence of Heavy Metals and PCBs Pollution on the Enzyme Activity and Microbial Community of Paddy Soils around an E-Waste Recycling Workshop

Transcription

1 Int. J. Environ. Res. Public Helth 2014, 11, ; doi: /ijerph OPEN ACCESS Article Interntionl Journl of Environmentl Reserch nd Public Helth ISSN Influence of Hevy Metls nd PCBs Pollution on the Enzyme Activity nd Microbil Community of Pddy Soils round n E-Wste Recycling Workshop Xinjin Tng 1, Muhmmd Z. Hshmi 1, Dongyn Long 1, Lito Chen 1, Muhmmd I. Khn 2 nd Chofeng Shen 1, * 1 2 College of Environmentl nd Nturl Resource Sciences, Zhejing University, Hngzhou , Chin; E-Mils: xinjin@zju.edu.cn (X.T.); hshmi_qu@yhoo.com (M.Z.H.); ldongyn210@gmil.com (D.L.); lito.chen2001@gmil.com (L.C.) Deprtment of Agronomy, University of Agriculture, Fislbd 38040, Pkistn; E-Mil: khnimrn1173@yhoo.com * Author to whom correspondence should be ddressed; E-Mil: ysxzt@zju.edu.cn; Tel.: ; Fx: Received: 27 December 2013; in revised form: 18 Februry 2014 / Accepted: 5 Mrch 2014 / Published: 14 Mrch 2014 Abstrct: Due to the emerging environmentl issues relted to e-wste there is concern bout the qulity of pddy soils ner e-wste workshops. The levels of hevy metls nd PCBs nd their influence on the enzyme ctivity nd microbil community of pddy soils obtined from the immedite vicinity of n e-wste workshop were investigted in the present study. The results indicted tht the hevy metl nd PCB pollution did not differ significntly with n increse of the smpling point distnces (5 to 30 m). The concentrtion of Cd (2.16 mg kg 1 ) nd Cu (69.2 mg kg 1 ) were higher, nd the PCB pollution ws lso serious, rnging from 4.9 to 21.6 μg kg 1. The highest enzyme ctivity ws found for urese compred to phosphtse nd ctlse, nd fluctuting trend in soil enzyme ctivity ws observed in soils from different smpling sites. The microbil nlysis reveled tht there ws no pprent correltion between the microbil community nd the pollutnts. However, slight influence for soil microbil communities could be found bsed on DGGE, the Shnnon index nd PCA nlysis. The present study suggests tht the contmintion stress of hevy metls nd PCBs might hve slight influence on microbil ctivity in pddy soils. This study provides the bseline dt for enzyme ctivities nd microbil communities in pddy soil under the influence of mixed contmintion.

2 Int. J. Environ. Res. Public Helth 2014, Keywords: e-wste; hevy metls; PCBs; enzyme ctivity; microbil community; pddy soil 1. Introduction Electronic nd electric wste (e-wste), defined s end-of-life electronic products, including computers, television sets, mobile phones, trnsformers, cpcitors, wires nd cbles, re mjor environmentl concern in Chin nd other countries [1]. According to the report of the United Ntions Environment Progrmme (UNEP), pproximtely 50% 80% of globl e-wste is leglly or illeglly imported into Asi ech yer, nd bout 90% of these e-wstes end up in Chin where they re illeglly recycled in plnts or workshops for the profit [2 4]. Becuse mny electronic products contin hzrdous mterils, the primitive extrction processes used, such s strong cid leching nd the open burning of dismntled components, could result in the relese of lrge quntities of toxic metls nd orgnic contmintions into the surrounding soil environment [5 7]. The Tizhou region of Chin is considered the lrgest e-wste recycling re with both open smll e-wste recycling workshops nd closed lrge system plnts [5]. Previously, it ws found tht workshops contribute hevier pollution to the environment in generl nd prticulrly those ner to the pddy fields compred to the plnts [6]. As the qulity of the pddy system is importnt to the griculturl ecosystem nd humn helth, typicl pddy soil from close to n e-wste recycling workshop in the Tizhou region ws selected nd the qulity of pddy soil influenced by the mixed pollution ws investigted in this study. The pddy field is unique gro-ecosystem consisting of diverse hbitts of microorgnisms nd other living things. These microorgnisms support vrious importnt biogeochemicl processes occurring in pddy fields. Furthermore, soil microorgnisms hve predominnt roles in the recycling nd detoxifiction of contminnts. Therefore, soil microorgnisms cn be viewed s key mesure of the contminted soil qulity [8 10]. Soil enzymes hve lso been considered s effective indictors of the generl ctivities of soil microorgnisms [11]. Soil enzymes not only serve s n indictor of the soil qulity, but lso ply significnt role in the reduction of PCBs [12]. A similr conclusion ws reched concerning the soil ner copper smelter, in which the microbil biomss is negtively ffected by the hevy metl stress, nd the soil enzyme ctivity is gretly depressed by the presence of hevy metl contmintion [9]. The enzyme ctivities were lso found to be severely inhibited in soils tht were contminted with both PAHs nd hevy metls [13]. The structure nd diversity of microbil communities is good indictor of the influence of nthropogenic ctivities on soil ecology. Becuse only less thn 1% of soil bcteri is cultivble by current microbil technologies, the composition of microbil communities by incubtion-independent tools ws mostly studied to investigte the influence of nthropogenic ctivities on soil qulity [9,14]. Studies hve confirmed tht the exposure of hevy metls nd orgnic pollutnts could influence the microbil communities in soil [9,15 19]. Thvmni et l. [13] studied the influence of mixture of hevy metls nd PAHs on soil microbil diversity nd enzyme ctivity nd found tht soil microorgnisms nd enzyme ctivity were reduced with higher levels of mixed contmintion. Denturing grdient gel electrophoresis (DGGE) nlysis of 16S rrna genes hs been proved to be powerful tool to elucidte bcteril community structures [20]. Kim et l. [21] used DGGE to study the

3 Int. J. Environ. Res. Public Helth 2014, totl soil microbil community profiles in pddy soil tht ws contminted by orgnic pollution. Similrly, Lopes et l. [22] investigted the microbil diversity of bulk pddy soil from two rice fields subjected to orgnic nd conventionl frming prctices used DGGE. In our previous study, we reported tht simple household workshops contributed more hevy metls nd should be given more ttention [6]. Serious inorgnic nd orgnic pollution nd their effects on microbil communities in non-irrigted griculturl soil close to n e-wste recycling workshop hve lso been investigted [23]. However, the study of pddy soil qulity round the e-wste recycling nd disposl region is scrce, nd the chrcteristics of the soil microbil communities in the pddy soil round e-wste recycling sites re not well-understood. The min im of the present study ws to nlyze whether the mixed contmintion would ffect the microbil community structure in the pddy soil region nd to study the influence through the investigtion of soil enzyme ctivities nd soil microbil community profiles. 2. Mterils nd Methods 2.1. Soil Smpling A typicl workshop, which ws locted in the Anrong villge of Tizhou nd ws mostly used to dispose of scrp wires nd cbles, ws selected in the present study. The e-wste ctivities hve been going on in this workshop for over 30 yers nd the techniques used include mnul dismntling of frctions, nd open burning of wire nd cble to recover metls, etc. Specilly, there ws no ir or wter pollution control mesures in this workshop nd the generted pollution ws relesed directly into the surrounding environment. A pddy field close to the workshop, s shown in Figure 1, ws used to collect the surfce soil smples (depth of 0~15 cm). Six soil smpling sites (P1, P2, P3, P4, P5 nd P6) were selected t 5 m intervls on line out from the workshop loction, ech t distnce of 5, 10, 15, 20, 25 nd 30 m from the workshop. At ech smpling loction, three subsmples (0 15 cm) were collected nd pooled together to mke one representtive smple of bout 1,000 g in size. Following the smpling, plnts, stones nd other items were crefully removed. Soil smples were then stored t 4 nd 20 C for further chemicl nd biologicl nlysis [23]. Figure 1. Mp of study re nd the six smpling points (P1 P6).

4 Int. J. Environ. Res. Public Helth 2014, Chemicl Anlysis Soil ph ws determined for 1:2.5 H 2 O suspensions using glss electrode nd soil orgnic mtter content ws mesured by dichromte oxidtion [24], respectively. For the hevy metls nlysis, 0.5 g freeze-dried soil ws firstly weighed nd digested with mixture contining hydrofluoric cid nd nitric cid/perchloric cid (1:1, v/v) in vessels. Next, the residues ws dissolved with hydrochloric cid, filtered nd diluted with deionized wter. Finlly, the concentrtions of the metls (Cu, Zn, Pb, Cr, Cd, nd Ni) of diluted solution were determined by flme tomic bsorption spectrometry (AAS, Solr-MK II-M6, Thermo Elementl, Fisher Scientific Inc. Toronto, ON, USA) [25,26]. Ech soil smple ws mesured in triplicte nd every step of mesurements ws optimized to meet the qulity control stndrds. For PCBs nlysis, 5.0 g freeze-dried soil ws extrcted in Soxhlet pprtus for 48 h with 200 ml mixture of hexne-cetone (1:1, v/v). After concentrtion, clen-up nd evportion, the concentrtions of the PCBs were mesured using gs chromtogrph equipped with 63 Ni electron cpture detector (Agilent 6890N, Agilent Technologies, Cliforni, CA, USA) [6,23]. The 13 PCB congeners tested were PCB18, PCB28, PCB31, PCB52, PCB44, PCB101, PCB149, PCB118, PCB153, PCB138, PCB180, PCB170, nd PCB194. During the PCBs nlysis, two chemicls (2,4,5,6-tetrchloro-m-xylene nd decchlorobiphenyl) were specilly used for determintion of PCBs recoveries, which rnged from 85% to 92% Soil Enzyme Activity Anlysis Three types of soil enzyme (ctlse, urese nd phosphtse) were mesured in this study. Ctlse ctivity ws determined ccording to Gun et l. [27] nd Stpniewsk et l. [28]. Briefly, 3.0 g dried soil smple ws dded to 250 ml flsk, then 40 ml distilled wter nd 5 ml 0.3% H 2 O 2 were poured into the flsk nd shken for 20 min. After shking, 3 N H 2 SO 4 ws dded to terminte the rection. After filtrtion, the ctlse ctivity ws mesured by the titrtion method with 0.1 N KMnO 4. The procedure described by Gun et l., [27] nd Ling et l., [29] ws used to mesure the urese ctivity. Five grms of dried soil nd 1 ml toluene were mixed in 50 ml flsk. After 15 min, 20 ml citrte buffer nd 10 ml 10% ure solution were dded. The rectnts were incubted t 37 C for 24 h. Then, the bsorbnce of the incubted solution ws mesured t 578 nm. The method modified from Wng et l. [9] ws pplied to mesure the soil lkline phosphtse ctivity, 1.0 g dried smple ws incubted with 5 ml borte buffer (ph 10.0), 0.2 ml toluene, nd 5 ml disodium phenyl phosphte solution in 50 ml flsk t 37 C for 1 h. Then, the solution ws mde up to 50 ml volume with 38 C distilled wter nd filtered. 2 ml of the filtrte ws then trnsferred into nother 50 ml volumetric fisk. Following, 2.5 ml boric cid buffer (ph 9.6), 1.5 ml potssium ferricynide (2.5%), nd 1.5 ml of 4-mino ntipyrine (0.5%) were dded nd crefully mixed. After the solution ws diluted to 50 ml nd the bsorbnce of solution ws mesured t 570 nm fter min for color development. These three types of soil enzyme were mesured three times for ech soil smple Microbil Counts To count the vible microbil numbers, 0.5 g fresh pddy soil smple with three replictes ws ccurtely weighed nd serilly diluted to obtin series of dilutions (10 4, 10 5, 10 6, 10 7, 10 8 nd 10 9 ).

5 Int. J. Environ. Res. Public Helth 2014, Then, the dilution liquid ws spred on Beef extrct peptone medium for bcteri or culture medium of Guse medium No.1 for the isoltion of ctinomycetes. The pltes were incubted for 1 2 dys (bcteri) nd 4 5 dys (ctinomycetes) prior to counting the numbers of colony forming units (CFU) of bcteri nd ctinomycetes [30]. Menwhile, the wter content ws determined nd the results of microbil counts were expressed s 10 6 /g dw (dry weight) PCR-DGGE Anlysis Totl soil DNA ws extrcted nd purified from 0.5 g soil using bed beting method (FstDNATMSPIN Kit for Soil, Bio101 Inc., Cliforni, CA, USA) following the mnufcturer s instructions. The isolted the totl DNA ws conserved in 1.5 ml EP tube t 20 C. The primers F357GC: 5 -CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCCCCCTACGGGAGGC AGCAG-3 nd R518: 5 -ATTACCGCGGCTGCTGG-3 were used for the mplifiction of the bcteril 16S rrna genes for the DGGE nlysis, nd the primers F243GC: 5-CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCCCGGATGAGCCCGCGGCCTA-3 nd R518 were used for the DGGE nlysis of bcteri nd ctinomycetes, respectively [9,31]. A mster cycler grdient ws used for the PCR rection with finl volume of 50 μl in 0.2-mL tubes. Tq DNA polymerse (5 units), both primers (25 pmol), 10 PCR buffer (5 μl), ech dntp (100 mmol) nd MgCl 2 (0.1 mm) were used for the rection mixture. DNA ws mplified by following the steps of the PCR rection: 5 min initil denturtion t 94 C, followed by 20 cycles of 94 C for 1 min, 60 C for 1 min, 72 C for 1 min nd finl extension period of 72 C for 7 min. Finlly, 1% grose gel electrophoresis ws used to determine the contents of the mplified DNA. For DGGE nlysis, the mplified DNA ws seprted on 10% crylmide gel with liner denturnt grdient rnge from 35% to 60%. DGGE ws performed using 40 μl PCR products in 1 TAE buffer t 60 C for 5.5 h, nd constnt voltge of 150 V (DcodeTM Universl Detection System, Bio-Rd, Cliforni, CA, USA). The gels were then stined for 30 min with SYBR-green II nd were nlyzed for bnds [9,32]. Digitized DGGE imges were nlyzed with Quntity One imge nlysis softwre (Version 4.0, Bio-Rd) nd the similrity of the gel pttern ws identified using principl component nlysis (PCA). The Shnnon index vlue (H) of the soils ws clculted on the bsis of the number nd intensity of bnds present in the DGGE smples. H ws clculted s follows: H = (n i /N) ln(n i /N), where n i is the intensity for ech individul bnd (i) nd N is the sum of intensities of ll bnds in lne Sttisticl Anlysis All the dt were nlyzed using SPSS for Windows Relese 15.0 (SPSS Inc., Chicgo, IL, USA). The probbility vlue of 0.05 ws tken s significnce. And the dt re presented s the men vlue for the chemicl nd biologicl nlyses of ech soil smple. 3. Results nd Discussion 3.1. Soil Properties, Hevy Metls nd PCBs Anlysis The ph of the six soil smplings (P1, P2, P3, P4, P5 nd P6) ws 6.3, 5.7, 5.3, 6.1, 5.3 nd 5.5, respectively. While the content of soil orgnic mtter ws 5.3, 5.1, 5.8, 5.6, 6.7, nd 6.5%, respectively.

6 Int. J. Environ. Res. Public Helth 2014, Tble 1 shows the concentrtions of hevy metls (Zn, Cu, Pb, Cd, Cr, nd Ni) in the pddy soil. The results indicte tht the verge concentrtions of Zn, Cu, Pb, Cd, Cr nd Ni were 126.5, 69.2, 97.0, 2.16, 69.3 nd 34.7 mg kg 1, respectively. In the pddy soil region, the concentrtion of Cd ws higher thn the Grde III vlue (1.0 mg kg 1 ) of the Ntionl Environmentl Qulity Stndrds for soil of Chin (GB ); the concentrtion of Cu exceeded the Grde II vlue (50 mg kg 1 ), wheres there ws slight pollution of Zn nd Pb tht exceeded the Grde I vlue. However, the pddy soil in the Tizhou region ws contminted more by Cd (6.4 mg kg 1 ), Cu (256.4 mg kg 1 ), Cr (33.5 mg kg 1 ), Pb (67 mg kg 1 ) nd Zn (209.9 mg kg 1 ) [33]. Interestingly, the lowest concentrtions of hevy metls (especilly, Zn nd Cu) were mesured in P1 smple which is closest to the workshop nd the hevy metls pollution did not decrese with the distnce from the pollution source. A cler decrese of hevy metls with the distnce from the pollution source in dry lnd soil could be shown in our previous reserch [23]. We suppose the min reson might be due to the specil nture of the pddy soil smples. The pddy ecosystem lwys remins under the influence of irrigtion nd ploughing which might be responsible for the different levels of hevy metls contmintion in pddy soil compred to dry lnd soil. Therefore, no cler decrese of hevy metls with the distnce from the pollution source in pddy soil ws found in the present study. However, the results presented in this study suggest tht the dumping of lrge mount of unslvged e-wste my dischrge metls in the pddy soil directly. The flooding of the pddy soil with wter which receives the dischrging of the wste solution lso increses the metl concentrtion. Further, the receiving of wet or dry depositions ccounts for n importnt reson for metl pollution of the pddy soil [33]. In ddition, the low contents of Pb nd Cr might be reflection of the effects of different types of e-wste processing ctivities nd their resultnt dischrge. Smpling No. Tble 1. Hevy metls content in pddy soil collected from Tizhou region (mg kg 1 dw). Distnce (m) Zn Cu Pb Cd Cr Ni P ± ± ± ±0.28 b ± ±2.39 P ±10.17 b ±0.64 b ±7.82 b 2.08 ±0.33 bc ±4.12 b ±1.17 b P ±8.71 bc ±0.67 c ±9.40 c 2.56 ±0.59 c ±1.11 b ±0.76 c P ±9.26 bc ±0.55 d ±6.15 bc 2.57 ± ±3.60 b ±1.84 bc P ±4.12 bc ±0.57 d ±4.30 b 1.71 ±0.24 b ±3.18 b ±0.66 bc P ±12.73 c ±0.14 bc ±3.61 bc 2.23 ±0.19 bc ±1.84 b ±1.60 d Notes: Distnce from the e-wste recycling workshop. Vlues in ech column followed with different letters indicted significnt (p 0.05) differences mong different soil smples, nd vlues represent mens ± stndrd devition. The concentrtions of 13 PCB congeners were mesured by gs chromtogrphy. As shown in Figure 2, the totl contents of PCBs rnged from 4.9 to 21.6 μg kg 1 with n verge of 9.70 μg kg 1, therefore, the pollutions of the smple sites (P1 P6) s t reltively low level compred to those found in previous studies such s Shen et l. [6] with men concentrtion of 41.0 μg kg 1, nd Tng et l. [7] with men concentrtion of 70.6 μg kg 1, lthough the number of PCB congeners were different. The results suggest tht the low level of PCBs in ll sites my be due to the lower deposition of PCBs in pddy re from the e-wste recycling workshop [6,34]. The compositions of PCBs homologues in ech smple re lso presented in Figure 2. Since PCBs from the sme sources exhibit similr PCBs compositions, the similr compositions of the PCBs reveled tht the source of the PCBs must be

7 Content of PCBs (μg kg -1 ) Compositon Int. J. Environ. Res. Public Helth 2014, similr. Shen et l. [6] lso found similr profiles of those PCB congeners in soil from different plnts nd workshops in Chin, nd suggested they could come from similr sources. In the present study mong PCB congeners, lesser chlorinted congeners, including tri-cbs, tetr-cbs nd pent-pcbs, were the most prevlent homologues, ccounting for 71.6% 78.8% of the totl concentrtions of PCBs. This my be due to the low chlorinted congener s behvior s they trnsported more esily thn the high chlorinted congeners [35]. The profiles of trnsformer oils, which re produced nd used in Chin, hve lrge proportion of lower moleculr weight congeners, prticulrly tri-pcb, followed by tetr-pcb [36]. This sttement ws demonstrted in trnsformer oil smples, which showed tht insulting oils of loclly produced trnsformers minly contined lower chlorinted PCBs [37,38]. Figure 2. Chrcteriztion ((A) dry weight bsis) nd composition (B) of PCBs in pddy soil smples P1 P2 P3 P4 P5 P6 Smpling site pcb194 pcb170 pcb180 pcb138 pcb153 pcb118 pcb149 pcb101 pcb44 pcb52 pcb28+31 pcb18 100% 80% 60% 40% 20% 0% P1 P2 P3 P4 P5 P6 Smpling site 8Cl 7Cl 6Cl 5Cl 4Cl 3Cl (A) (B) The correltion mtrix mong hevy metls nd PCBs in pddy soil ws investigted. Sttisticlly significnt correltions could be found between Cd nd Pb (r = 0.815, p < 0.05) nd Cu with Zn (r = 0.922, p < 0.01), which indicted tht these compounds might hve similr source. However, no significnt correltion ws found mong hevy metls nd PCBs in pddy soil in the present study. The correltion results were different from our previous study in which strong correltion mong Cu, Pb nd PCBs could be found in pddy soil [7], suggesting the complex sources of pollutnts or the vrious e-wste recycling mterils in the study re Enzyme Activities All of the enzyme ctivities showed fluctuting results in the present study (Tble 2). The enzyme ctivities followed the order: urese > phosphtse > ctlse. The higher ctivities of urese followed by phosphtse, compred to the ctlse, my be due to their sensitivities to hevy metls nd PCBs [8,39]. Hu et l. [40] found tht the urese ctivity ws higher thn the phosphtse or ctlse ctivity in soil influenced by mixed contmintion of hevy metls. The uthors suggested tht the urese ctivities were more sensitive to the mixed contmintion thn the other two enzymes bsed on the EC50 vlues mesurement. The three types of enzyme ctivity t P1 (4.27 ml g 1, mg kg 1 24 h 1 nd mg kg 1 h 1, respectively) ws lower thn the other sites (P2 P6). Generlly, fluctuting trend in ctlse, urese nd phosphtse ctivity ws obtined in soil from different smpling sites. However, slowly incresing trend in ctlse nd urese ctivity could be seen from P1 to P6 except P3. The phosphtse ctivity lso incresed slowly from P1 to P5. There re

8 Int. J. Environ. Res. Public Helth 2014, considerble mount of evidences documenting decrese in the soil enzyme ctivity s result of exposure to hevy metl or mixed contmintion [41,42]. In ddition, the biovilbility of metls nd orgnic pollutnts to microbes t different points could lso influence the soil enzyme ctivity [13]. Furthermore, Andreoni et l. [43] hve stted tht reltively low soil enzyme ctivity could be explined by the interference of high Cu contents in Itlin soil smples. Since the pddy soil round the workshop hd low level of hevy metls nd PCBs bsed on our investigtion, the fluctuting enzyme ctivity might suggest tht the low concentrtion of mixed pollution emissions might hve no pronounced effect on enzyme ctivity in pddy soil. Smpling No. Tble 2. Soil enzymes ctivities in pddy soil in different distnces. Distnce (m) Ctlse (ml g 1 dw) Urese (mg kg 1 24 h 1 dw) Phosphtse (mg kg 1 h 1 dw) P ± ± ± P ± 0.18 b ± b ± 7.46 b P ± 0.26 bc ± c ± cd P ± 0.13 b ± 1.61 b ± ce P ± 0.07 c ± 7.26 b ± e P ± 0.75 c ± d ± d Notes: Vlues in ech column followed with different letters indicted significnt (p 0.05) differences mong different soil smples nd vlues represent mens ± stndrd devition Microbil Counts The number of bcteri nd ctinomycetes in pddy soil collected from different smpling sites were determined by plte counting nd re given in Tble 3. With n increse of distnce, the bcteri counts incresed slowly from the nerest site (P1) to the frthest site (P6), except for P5. A good reltionship ws observed between the bcteri nd the distnce from the disposing nd recycling site. These results re consistent with the soil enzyme ctivities. On the contrry, the ctinomycetes counts fluctuted from site to site nd showed nomlous informtion. It ws found tht there ws no significnt correltion between the counts of bcteri nd ctinomycetes nd contmintion in the pddy soil. However, different conclusion ws reched in study conducted by Wng et l. [9], in which the microbil biomss crbon ws negtively ffected by the elevted metl levels nd ws closely correlted with hevy metl stress in soil from copper-zinc smelter. Tble 3. The number of microbes (bcteri nd ctinomycetes) in different smpling sites. Smpling No. Distnce (m) Bcteri (10 6 /g dw) Actinomycetes (10 6 /g dw) P ± 0.06 b 0.19 ± 0.01 b P ± 0.07 b 0.32 ± 0.03 P ± 0.19 c 0.23 ± 0.02 b P ± 0.16 c 0.12 ± 0.01 b P ± 0.16 b 0.22 ± 0.12 b P ± 0.09 c 0.21 ± 0.01 b Notes: Vlues in ech column followed with different letters indicted significnt (p 0.05) differences mong different soil smples, nd vlues represent mens ± stndrd devition.

9 Int. J. Environ. Res. Public Helth 2014, Microbil Community Structure Anlysis The PCR-DGGE method ws performed to nlyze the microbil community structure influenced by the hevy metls nd PCBs in pddy soil. Figure 3 shows the DGGE bnd ptterns of the bcteri nd ctinomycetes communities in the pddy soil. Generlly, no difference ws found between the bnds t the different smpling sites, which indictes tht the microbil (i.e., bcteri nd ctinomycetes) community structure ws very similr in ll smples tken from the contminted pddy soil. The results suggested tht the microbil community structures of pddy soil from different points were not seriously influenced by hevy metls nd PCBs. Severl fctors might contribute to the similr structure of microbil communities of pddy soil, such s low level of contmintion [39] nd the co-bundnce of different orgnisms in the pddy soil [44]. The sme soil wter content my lso hinder the cler effects of mixed contmintion on the bcteril community structure. The DGGE gels were further nlyzed by the Shnnon index, nd the results re shown in Figure 4. The bcteril Shnnon index of P1 ws similr to P2 nd P3, wheres P4 exhibited the highest index vlue nd ws close to P5 nd P6. No significnt differences were found mong the Shnnon index vlues of the ctinomycetes in the pddy soil mong the six smpling sites. Overll, the chnge in the microbil diversity of the six soil smples from the pddy soil region ws indistinctive (Figure 4). The first three points (P1 P3) showed loss in Shnnon index vlues nd this might be due to the reltively high levels of PCBs (P1 nd P2) nd hevy metls (i.e., Cu, Pb nd Cd in P3). The similr loss in Shnnon index vlue hd been found in study by Thvmni et l. [13] in those sites which hd high pollution of hevy metls nd PAHs. PCA of soil fingerprints (DGGE bnds) is useful tool to detect shifts in the microbil composition of mixed contminted soil [9]. PCA results bsed on the DGGE profiles of pddy soil re shown in Figure 5 nd revel tht the microbil community structure of P1 ws similr to tht of P2 but different from tht of P3, P4, P5, nd P6. For the P1 nd P2, there ws no significnt difference of four hevy metls except Zn nd Cu. PCBs levels in these two sites (12.1 nd 21.6 μg kg 1, respectively) were lso obviously higher compred to other sites. It seems tht the similr levels of mixed contmintion especilly PCBs in these two sites might possibly contribute to the similr microbil community structure in soil, lthough there were other vrious fctors such s the co-bundnce of different orgnisms nd the sme soil wter content in pddy soil s we discussed bove. The differences in bcteril community structure were not significnt mong P3, P5 nd P6. While PCA results for the ctinomycetes reveled tht there ws minor difference in the community structure between two consecutive sites (P3 P6, Figure 5B). Over ll, there ws no good reltionship to be found between the microbil prmeters including enzyme ctives nd DGGE results with mixed contmintions of hevy metls nd PCBs in our study. Although Wng et l. [9] suggested tht there were negtive correltions mong microbil biomss, enzyme ctivity, nd metls in soil with different distnces from smelter. The PCR-DGGE nlysis results lso indicted tht soil-vilble metls concentrtions were well correlted with the reltive bundnce of Commondcee, Morxellcee, nd other bcteril communities in soil [45]. Since soil microbil community structure is n importnt component in the regultion of the soil microbil ctivity [42], nd the toxicity effects of chemicl pollutnts on soil microbil ctivity hve been confirmed [46], the microbil community shifts in the present study suggests tht the contmintion stress of hevy metls nd PCBs might pose slight influence on microbil ctivity in pddy soil. Due to the emerging

10 Shnnon index of bcteri Shnnon index of ctinomycete Int. J. Environ. Res. Public Helth 2014, environmentl issues of e-wste, the potentil threts of mixed contmintion to the qulity nd helth of pddy soil should be further studied. Figure 3. DGGE profiles of soil bcteri (A) nd ctinomycetes (B) communities from different soil smples. P2 P1 P6 P3 P4 P5 P2 P1 P6 P3 P4 P5 A B Figure 4. Shnnon diversity indexes of bcteri (A) nd ctinomycetes (B) in different soil smples. (Different letters in the column indicted significnt difference, p 0.05) P1 P2 P3 P4 P5 P6 Smpling site A b b b Figure 5. PCA nlysis results bsed on DGGE profiles of pddy soil smples ((A): bcteri, (B): ctinomycetes) P1 P2 P3 P4 P5 P6 Smpling site B A Bcteri Bcteri B Actinomycete P1 P2 P3 P4 P5 P6 P1 P2 P3 P4 P5 P6 P1 P2 P3 P4 P5 P6 P1 P2 P3 P4 P5 P

11 Int. J. Environ. Res. Public Helth 2014, Conclusions This study ws conducted to investigte the influence of hevy metls nd PCBs on the microbil community structure in pddy soil from Tizhou, Chin. The results indicted tht the pollutnts hd no significnt influence on the microbil popultion mong the different smpling points. Different enzymes ctivities in the pddy soil were detected, nd fluctuting trend in ctlse, urese nd phosphtse ctivity ws obtined in soils from different smpling sites. However, the results bsed on DGGE, the Shnnon index nd PCA nlysis reveled tht the soil microbil community structure ws slightly influenced in the pddy soil with hevy metls nd PCBs contmintion. The present study suggests tht the contmintion stress of hevy metls nd PCBs might hve slight influence on microbil ctivity in pddy soil. Due to the emerging environmentl issues of e-wste, the potentil threts of mixed contmintion to the qulity nd helth of pddy soil should be further studied. Acknowledgments This work ws finncilly supported by the Ntionl Nturl Science Foundtion of Chin ( , ). Author Contributions Xinjin Tng did the soil smpling, prts of chemicl nlysis, nd wrote the min pper, Muhmmd Z. Hshmi wrote prts of the pper nd hd the contribution of English lnguge editing, Dongyn Long ttended in some dt nlysis nd pper orgniztion, Lito Chen finished the min lbortory work nd dt nlysis, Muhmmd I. Khn hd some contribution of pper revision, while Chofeng Shen ws the supervisor during ll the reserch. Conflicts of Interest The uthors declre no conflict of interest. References 1. Wong, M.H.; Wu, S.C.; Deng, W.J.; Yu, X.Z.; Luo, Q.; Leung, A.O.W.; Wong, C.S.C.; Luksemburg, W.J.; Wong, A.S. Export of toxic chemicls A review of the cse of uncontrolled electronic-wste recycling. Environ. Pollut. 2007, 149, Chen, D.; Bi, X.; Zho, J.; Chen, L.; Tn, J.; Mi, B.; Sheng, G.; Fu, J.; Wong, M. Pollution chrcteriztion nd diurnl vrition of PBDEs in the tmosphere of n e-wste dismntling region. Environ. Pollut. 2009, 157, Bi, X.; Simoneit, B.R.T.; Wng, Z.Z.; Wng, X.; Sheng, G.; Fu, J. The mjor components of prticles emitted during recycling of wste printed circuit bords in typicl e-wste workshop of South Chin. Atmos. Environ. 2010, 44, Wng, Y.; Luo, C.; Li, J.; Yin, H.; Li, X.; Zhng, G. Chrcteriztion of PBDEs in soils nd vegettions ner n e-wste recycling site in South Chin. Environ. Pollut. 2011, 159,

12 Int. J. Environ. Res. Public Helth 2014, Luo, C.; Liu, C.; Wng, Y.; Liu, X.; Li, F.; Zhng, G.; Li, X. Hevy metl contmintion in soils nd vegetbles ner n e-wste processing site, South Chin. J. Hzrd. Mter. 2011, 186, Shen, C.; Chen, Y.; Hung, S.; Wng, Z.; Yu, C.; Qio, M.; Xu, Y.; Setty, K.; Zhng, J.; Zhu, Y. Dioxin-like compounds in griculturl soils ner e-wste recycling sites from Tizhou re, Chin: Chemicl nd bionlyticl chrcteriztion. Environ. Int. 2009, 35, Tng, X.J.; Shen, C.; Chen, L.; Xio, X.; Khn, M.I.; Dou, C.; Chen, Y.X. Inorgnic nd orgnic pollution in griculturl soil from n emerging e-wste recycling town in Tizhou re, Chin. J. Soil Sediment. 2010, 10, Filip, Z. Interntionl pproch to ssessing soil qulity by ecologiclly-relted biologicl prmeters. Agri. Eco. Environ. 2002, 88, Wng, Y.P.; Shi, J.Y.; Wng, H.; Lin, Q.; Chen, X.C.; Chen, Y.X. The influence of soil hevy metls pollution on soil microbil biomss, enzyme ctivity, nd community composition ner copper smelter. Ecotox. Environ. Sf. 2007, 67, Microorgnisms s Indictors of Soil Helth. Avilble onine: 2_Publiktioner/3_fgrpporter/rpporter/FR388.pdf (ccessed on 27 December 2013). 11. Killhm, K.; Stddon, W.J. Bioindictors nd Sensors of Soil Helth nd the Appliction of Geosttistics. In Enzymes in the Environment; Burns, R.G., Dick, R.P., Eds.; Mrcel Dekker Inc.: New York, NY, USA, 2002; pp Tu, C.; Teng, Y.; Luo, Y.; Sun, X.; Deng, S.; Li, Z.; Liu, W.; Xu, Z. PCB removl, soil enzyme ctivities, nd microbil community structures during the phytoremedition by lflf in field soils. J. Soil Sediment. 2011, 11, Thvmni, P.; Mlik, S.; Beer, M.; Meghrj, M.; Nidu, R. Microbil ctivity nd diversity in long-term mixed contminted soils with respect to polyromtic hydrocrbons nd hevy metls. J. Environ. Mnge. 2012, 99, Renell, G.; Mench, M.; Lndi, L.; Nnnipieri, P. Microbil ctivity nd hydrolse synthesis in long-term Cd-contminted soils. Soil Biol. Biochem. 2005, 37, Suhdolc, M.; Schroll, R.; Gttinger, A.; Schloter, M.; Munch, J.C.; Lestn, D. Effects of modified Pb-, Zn-, nd Cd-vilbility on the microbil communities nd on the degrdtion of isoproturon in hevy metl contminted soil. Soil Biol. Biochem. 2004, 36, McGrth, S.P.; Zho, F.J.; Lombi, E. Plnt nd rhizosphere processes involved in phytoremedition of metl-contminted soils. Plnt. Soil 2001, 232, Lst, M.M. Phytoextrction of toxic metls: A review of biologicl mechnisms. J. Environ. Qul. 2002, 31, Lee, C.; Kim, J.; Shin, S.G.; O Flherty, V.; Hwng, S. Quntittive nd qulittive trnsitions of methnogen community structure during the btch nerobic digestion of cheese-processing wstewter. Appl. Microbio. Biotech. 2010, 87, Bker, G.C.; Gffr, S.; Cown, D.A.; Suhrto, A.R. Bcteril community nlysis of Indonesin hot springs. FEMS Microbiol. Lett. 2001, 200, Muyzer, G.; Smll, K. Appliction of denturing grdient gel electrophoresis (DGGE) nd temperture grdient gel electrophoresis (TGGE) in microbil ecology. Antonie vn Leeuwenhoek Int J. Gen. Molec. Microbiol. 1998, 73,

13 Int. J. Environ. Res. Public Helth 2014, Kim, S.; Bek, K.; Lee, I. Phytoremedition nd microbil community structure of soil from metl-contminted militry shooting rnge: Comprisons of field nd pot experiments. J. Environ. Sci. Hel. A 2010, 45, Lopes, A.R.; Fri, C.; Prieto-Fernndez, A.; Trsr-Ceped, C.; Mni, C.M.; Nunes, O.C. Comprtive study of the microbil diversity of bulk pddy soil of two rice fields subjected to orgnic nd conventionl frming. Soil Biol. Biochem. 2011, 43, Tng, X.; Qio, J.; Chen, C.; Chen, L.; Yu, C.; Shen, C.; Chen, Y. Bcteril communities of polychlorinted biphenyls polluted soil round n e-wste recycling workshop. Soil Sedimet Contm. 2013, 22, Bo, S.D. Soil nd Agriculturl Chemistry Anlysis; Chin Agriculture Press: Beijing, Chin, 2000, (in Chinese). 25. Lu, R.K. Anlysis Method of Soil Agriculturl Chemistry; Chin Agriculturl Science nd Technology Press: Beijing, Chin, 1999, (in Chinese). 26. Hseu, Z.Y.; Chen, Z.S.; Tsi, C.C.; Tsui, C.C.; Cheng, S.F.; Liu, C.L.; Lin, H.T. Digestion methods for totl hevy metls in sediments nd soils. Wter Air Soil Pollut. 2002, 141, Gun, S.Y. Soil Enzyme nd Reserch Methods; Chin Agriculture Press: Beijing, Chin, 1986, (in Chinese). 28. Stpniewsk, Z.; Wolinsk, A.; Ziomek, J. Response of soil ctlse ctivity to chromium contmintion. J. Environ. Sci. 2009, 21, Ling, W.; Wu, Z.B.; Cheng, S.P.; Zhou, Q.H.; Hu, H.Y. Roles of substrte microorgnisms nd urese ctivities in wstewter purifiction in constructed wetlnd system. Ecol. Eng. 2003, 21, Cheem, S.A.; Khn, M.I.; Tng, X.; Zhng, C.; Shen, C.; Mlik, Z.; Ali, S.; Yng, J.; Shen, K.; Chen, X. Enhncement of phennthrene nd pyrene degrdtion in rhizosphere of tll fescue (Festuc rundince). J. Hzrd. Mter. 2009, 166, Muyzer, G.; Ellen, C.W.; Andre, G.U. Profiling of complex microbil popultions by denturing grdient gel electrophoresis nlysis of polymerse chin rection genes coding for 16S rrna. Appl. Environ. Microbiol. 1993, 59, Lin, H.R.; Chen, X.C.; Hu, S.P.; Shen, C.F.; Chen, G.C.; Shi, J.Y.; Chen, Y.X. Led vilbility nd soil microbil community composition in rice rhizosphere ffected by thiosulfte ddition. Appl. Soil. Ecol. 2010, 45, Zhng, J.; Hng, M.I.N. Eco-toxicity nd metl contmintion of pddy soil in n e-wstes recycling re. J. Hzrd. Mter. 2009, 165, Shen, C.; Hung, S.; Wng, Z.; Qio, M.; Tng, X.; Yu, C.; Shi, D.; Zhu, Y.; Shi, J.; Chen, X. Identifiction of Ah receptor gonists in soil of e-wste recycling sites from Tizhou re in Chin. Environ. Sci. Technol. 2007, 42, Choi, S.D.; Bek, S.Y.; Chng, Y.S.; Wni, F.; Ikonomou, M.G.; Yoon, Y.J.; Prk, B.K.; Hong, S. Pssive ir smpling of polychlorinted biphenyls nd orgnochlorine pesticides t the Koren Arctic nd Antrctic reserch sttions: Implictions for long-rnge trnsport nd locl pollution. Environ. Sci. Technol. 2008, 42,

14 Int. J. Environ. Res. Public Helth 2014, Zhng, Z.; Liu, L.; Li, Y.F.; Wng, D.; Ji, H.; Hrner, T.; Sverko, E.; Wn, X.; Xu, D.; Ren, N. Anlysis of polychlorinted biphenyls in concurrently smpled Chinese ir nd surfce soil. Environ. Sci. Technol. 2008, 42, Jing, Q. Chrcteristics of PCB congeners nd homologues in Chinese trnsformer oil. Chin Environ. Sci. 2007, 27, Ren, N.; Que, M.; Li, Y.F.; Liu, Y.; Wn, X.; Xu, D.; Sverko, E.; M, J. Polychlorinted biphenyls in Chinese surfce soils. Environ. Sci. Technol. 2007, 41, Akml, M.; Wng, H.Z.; Wu, J.J.; Xu, J.M.; Xu, D.F. Chnges in enzymes ctivity, substrte utiliztion pttern nd diversity of soil microbil communities under cdmium pollution. J. Environ. Sci. Chin 2005, 17, Hu, B.; Ling, D.; Liu, J.; Xie, J. Ecotoxicologicl effects of Cu nd Se combined pollution on soil enzyme ctivities in plnted nd unplnted soil. Environ. Toxicol. Chem. 2013, 32, Speir, T.W.; Vn Schik, A.P.; Hunter, L.C.; Ryburn, J.L.; Percivl, H.J. Attempts to derive EC50 vlues for hevy metls from lnd-pplied Cu-, Ni-, nd Zn-spiked sewge sludge. Soil Biol. Biochem. 2007, 39, Go, Y.; Zhou, P.; Mo, L.; Zhi, Y.; Shi, W. Assessment of effects of hevy metls combined pollution on soil enzyme ctivities nd microbil community structure: Modified ecologicl dose Response model nd PCR-RAPD. Environ. Erth Sci. 2010, 60, Andreoni, V.; Cvlc, L.; Ro, M.; Nocerino, G.; Bernsconi, S.; Dell Amico, E.; Colombo, M.; Ginfred, L. Bcteril communities nd enzyme ctivities of PAHs polluted soils. Chemosphere 2004, 57, Zhou, J.; Guo, W.; Wng, R.; Hn, X.; Wng, Q. Microbil community diversity in the profle of n griculturl soil in northern Chin. J. Environ. Sci. 2008, 20, Hung, J.; Sheng, X.; He, L.; Hung, Z.; Wng, Q.; Zhng, Z. Chrcteriztion of depth-relted chnges in bcteril community compositions nd functions of pddy soil profile. FEMS Microbiol. Lett. 2013, 347, Smolders, E.; Buekers, J.; Oliver, I.; McLughlin, M.J. Soil properties ffecting toxicity of zinc to soil microbil properties in lbortory-spiked nd field-contminted soils. Environ. Toxicol. Chem. 2004, 23, by the uthors; licensee MDPI, Bsel, Switzerlnd. This rticle is n open ccess rticle distributed under the terms nd conditions of the Cretive Commons Attribution license (