Supplemental Data Length Control of the Metaphase Spindle

Transcription

1 Supplemental Data Length Control of the Metaphase Spindle S1 Gohta Goshima, Roy Wollman, Nico Stuurman, Jonathan M. Scholey, and Ronald D. Vale Supplemental Experimental Procedures Cell Culture, RNA Interference, and Overexpression Drosophila Schneider cell line (S2) was cultured and RNAi was performed according the conventional methods [S1]. Stable cell lines expressing GFP-tagged kinesin genes are described previously [S2]. For FSM analysis, a cell line containing GFP-tubulin gene under a copper-inducible promoter was used. This promoter has leaky activity in the culture medium without extra copper addition, which allows the low-level expression of GFP-tubulin suitable for FSM. Templates for in vitro transcription of dsrna were generated by PCR with the primers listed in the Table S3. The synthesized dsrna was added to cell culture in 96-well or 24-well plates in amounts of 1 mg or5mg, respectively. For double RNAi with 96-well plates, each 1 mg of dsrna was added simultaneously. At the end of the RNAi (day 3 5, see Table S3), cells were resuspended and replated on ConA-coated, 96-well plates (glass-bottom [Whatman] for automated microscope) or mm coverslips (for manual image acquisition) typically for 3 hr before fixation. CuSO 4 was added for induction of gene expression (500 mm addition for 2 3 days for overexpression and mm for low-level expression). The Con-A treatment flattens S2 cells that are round in regular culture [S3] and increases the probability that two spindle poles are in a single focal plane. Most of the cells (>70%) in the stable cell line express GFP. Note, however, that the expression level of GFP is variable among cells, but this variable enhanced our study because we could correlate expression with spindle length on a cell-by-cell basis. Immunofluorescence Microscopy Cells were fixed by 3% 6% paraformaldehyde for 15 min, permeablized by 0.5% SDS treatment for 15 min, and stained by anti-g-tubulin antibody (GTU-88 [SIGMA]; 1:500) and DAPI or Hoechst (0.5 mg/ml) in PBS containing 0.5% Triton and 10% goat serum. Specimens were imaged either automatically by ImageXpress (Axon Instruments) or manually by a cooled CCD camera Sensicam mounted on a Zeiss Axiovert microscope. 403 objective lens was used for ImageXpress microscopy. Anti-Cid (a gift from S. Henikoff) was used at 1:1000 dilution. Statistical Analysis All comparisons were tested with a t test assuming equal variance. Significance was determined after a Bonferroni correction for multiplicity. All correlation was tested with linear regression analysis, testing that the slope is significantly different from zero. Regression analysis was corrected for multiplicity as well. Fluorescent Speckle Microscopy Images of low-expressing GFP-tubulin cells were collected at 2 3 s intervals with s exposure times at room temperature (23ºC) with a cooled CCD camera Orca-ER2 (Hamamatsu) attached to a Yokogawa spinning-disk confocal scanhead (Perkin Elmer) that was mounted on a Zeiss Axiovert inverted microscope. Camera and AOTF were controlled by Metamorph software on a PC computer (Universal Imaging, Molecular Devices). Supplemental References S1. Goshima, G., and Vale, R.D. (2003). The roles of microtubulebased motor proteins in mitosis: Comprehensive RNAi analysis in the Drosophila S2 cell line. J. Cell Biol. 162, S2. Goshima, G., and Vale, R.D. (2005). Cell cycle-dependent dynamics and regulation of mitotic kinesins in Drosophila S2 cells. Mol. Biol. Cell 16, S3. Rogers, S.L., Rogers, G.C., Sharp, D.J., and Vale, R.D. (2002). Drosophila EB1 is important for proper assembly, dynamics, and positioning of the mitotic spindle. J. Cell Biol. 158, S4. Rogers, G.C., Rogers, S.L., Schwimmer, T.A., Ems-McClung, S.C., Walczak, C.E., Vale, R.D., Scholey, J.M., and Sharp, D.J. (2004). Two mitotic kinesins cooperate to drive sister chromatid separation during anaphase. Nature 427, S5. Morales-Mulia, S., and Scholey, J.M. (2005). Spindle pole organization in Drosophila S2 cells by dynein, abnormal spindle protein (Asp), and KLP10A. Mol. Biol. Cell 16, S6. Maiato, H., Khodjakov, A., and Rieder, C.L. (2005). Drosophila CLASP is required for the incorporation of microtubule subunits into fluxing kinetochore fibres. Nat. Cell Biol. 7, Image Data Analysis Images were separated into three channels on the basis of DNA, g-tubulin, and GFP staining. DNA images were convolved with a Gaussian matrix 10 pixels in size with a s of 3 pixels. g-tubulin spots were identified by segmentation of the image resulting from a Top-Hat morphological filter with a disk structural element of 3 pixels. A list of all g-tubulin spots was generated by sorting the g-tubulin average intensities. When the computational detection process identified more than 500 g-tubulin spots during the analysis of one image (because of very high background noise or artifactual aggregation of g-tubulin signals), further image analysis was halted. When possible g-tubulin spots were identified for one image, only the spots with average intensity larger than a threshold were used for length measurement. This threshold was determined on the basis of the size of the list and the mean spot intensity. When two g-tubulin spots were less than 25 mm apart and had DNA staining in between, the object was selected as a potential spindle. Montages of all potential spindles were generated, and metaphase spindles were selected manually as shown in Figure S1. Bipolar spindle is visible by either GFP-tubulin signals or, in the case where the cell does not express GFP-tubulin, whole-spindle staining by anti-gtubulin staining. All image analysis code was written in Matlab with functions from the Image analysis toolbox. A total of 10 5 images containing approximately 10 6 cells were obtained with an automated high-throughput microscope; 10 3 images were taken manually.

2 S2 Figure S1. Manual Selection of Metaphase Cells from Automatically Generated Image Gallery An example of a gallery of control GFP-tubulin cells selected by our automated analysis algorithm (see Supplemental Experimental Procedures). Two g-tubulin punctate signals were automatically detected (white lines). This algorithm selects metaphase cells (yellow frame) as well as other nonmetaphase cells that were eliminated by manual inspection. Although many nonmetaphase cells were in the cell galleries derived from this automated detection, the automation nevertheless greatly facilitated our procedure because metaphase cells with two g-tubulin signals are rare (<1%) and difficult to identify in fields of cells. Also, spindle length is automatically measured and recorded during the process. Figure S2. Immunoblot Confirming Perturbation of Protein Level SDS-PAGE was performed for the extracts prepared after RNAi (A) or overexpression of GFP-tagged kinesins (B), followed by western blotting with specific antibodies. As controls, extracts of no RNA treated cells (A, left) or GFP-tubulin cells (B, left) were used. Greater than 80% reduction was detected after RNAi for most of the proteins. However, considerable residual Msps was detected after our 3 day RNAi treatment (the antibody is a gift from J. Raff). We found that this was the best condition to accumulate metaphase cells with the bipolar spindle. Greater than 4 day treatment caused severe centrosomal defects and bipolar spindles were rarely observed (N. Mahoney, G.G., A. Douglass, R.D.V., unpublished data). Arrows in (B) indicate GFP-tagged kinesins, whereas asterisks indicate endogenous kinesins. All the antibodies were previously used [S1, S4, S3, S2, S5].

3 S3 Figure S3. Correlation of Protein Overexpression with Spindle Length After overexpression of GFP-tagged protein, both spindle length and GFP intensity were measured. Scatter plots show the correlation between the overexpression of the motor and spindle length in independent experiments. Linear regression lines are plotted only in cases where the slope was significantly different from zero. More statistical details are shown in Table S2.

4 S4 Figure S4. Sister Kinetochores Are under Tension at Metaphase in the Presence of Sister-Chromatid Cohesion (A) Immunofluorescence of Cid (Drosophila CENP-A), an inner-kinetochore protein. Sister inner-kinetochore distance of control metaphase cells was w25% longer than in cells treated with colchicine, indicating that sister chromatids are under tension in the bipolar spindle. In contrast, paired Cid dots were not detected in Rad21 RNAi spindles, in which thinner, unalinged sister chromatids are frequently detected, strongly suggesting the generation of weaker tension as a result of precious separation of sister chromatids. The bar represents 5mm. (B) Distanceof sister Klp67A-GFP signals (Klp67A is an outer-kinetochore marker[s2]), rapidly decreased upon MT depolymerization by colchicines in metaphase. Time-lapse imaging was performed using spinning-disk confocal microscope. See also Movie S1.

5 S5 Figure S5. Decreased Poleward-Flux Rate after Klp61F RNAi Poleward-flux observation by fluorescent speckle microscopy (FSM), a technique in which low levels of GFP-tubulin results in the random incorporation of GFP speckles into the MT lattice [S4]. (A) The poleward flux of GFP-tubulin speckles was detected by kymograph analyses after RNAi of Klp61F and for control cells. The bar represents 1mm. See also Movies S2 and S3. (B) Distribution of rates of speckle movement on the basis of kymograph analyses for control bipolar spindles (speckle number = 109) and monopolar spindles after Klp61F RNAi (n = 89). The graph likely represents a mixed population of kmts and nonkinetochore MTs. The majority of the speckles move poleward at <0.75 mm/min velocity after Klp61F RNAi, which is significantly different from control spindles, in which many speckles moved at >1.5 mm/min velocity. For control cells, we could also detect 19 speckles that move across the chromosome region and therefore are undoubtedly not derived from kmts. The average rate of the movement of interpolar (ip) MTs was mm/min, which is much faster than the rate of kmt flux in S2 cells ( mm/min [S6]). This fast rate was scarcely seen in the Klp61F RNAi spindles, suggesting that Klp61Fdependent sliding contributes to generate poleward flux of ipmts in the bipolar spindles. However, the fact that some, albeit slow, flux remains after Klp61F RNAi suggests that there is a Kinesin-5 independent component of flux in these cells.

6 S6 Table S1. Quantification of the Metaphase Spindle Length after RNAi Gene Avg Length (mm) Control Length (mm) Normalized Length Std (mm) SEM (mm) N P Value Klp10A E207 Klp10A E203 Klp67A E215 Klp67A E+00 Klp67A E209 Klp67A E210 Klp67A E208 67A/Mast E203 67A/Mast E202 67A/Msps E201 67A/Msps E204 Dhc E204 Dhc E202 EB E204 EB E211 EB E205 Mast E215 Mast E210 Msps E212 Msps E212 Ncd E203 Ncd E201 Rad E207 Quantitation of spindle length in separate RNAi experiments. P values are derived from comparison with the control cell sample (no RNA addition) stained at the same day. N represents the number of spindles analyzed in each treatment. Table S2. Quantification of the Metaphase Spindle Length after Overproduction Gene N P Value Klp10A Klp10A Klp10A Klp10A Klp61F Klp61F Klp61F Klp61F Klp61F Klp61F Klp67A Klp67A 82 <0.001 Ncd Ncd 148 <0.001 Ncd Ncd A quantification of the trend of spindle length as a function of overexpression levels of indicated genes (see Figure 3 in the main text). Each value represents a separate experiment. The p value is the probability that the slope of the regression line is equal to zero.

7 S7 Table S3. Primer Sequences for dsrna Synthesis and Observed Day after Treatment Gene Primer 1 (5 0 / 3 0 ) Primer 2 (5 0 / 3 0 ) Length (bp) Day Klp61F 5 0 UTR TATTTGCGCATTATTTTAAAATTG CATATTGATCAATTGAAAC Klp10A ATGATTACGGTGGGGCA GACATCGATCTCCTTGCG Klp67A 5 0 UTR a AGAAACAACAACGATCACTTC CATTTTCGATAGAATGCTCC Klp67A 3 0 UTR a TGAAGTAACAACTATTCCGC TGCTTGGATGAGGGCAAGG Ncd GCTCTAAGCACAGAAGTGGTGC CCATTCGAATCTCCATGTCC Mast/Orbit CAGTGATAAAAACGCAGACTGG GGGCAGCTATGTCTAATGTTCC Minispindles (Msps) ATCCAAGGTGAATCATAATGCC AGACAATGAGGACGATGATGG EB1 GTACAAAATACCGTTGGTTCGG ATTTGAAACGTGAACGAAAACC Dhc64C AAACTCAACAGAATTAACGCCC TTGGTACTTGTCACACCACTCC Rad21 ATACCAAAGAGAACGAGAACGC CTGGGAATTTCATAGTTGTCCC T7 promoter sequences (TAATACGACTCACTATAGGG) were added to 5 0 end of primer. a For Klp67A, dsrna of both 5 0 and 3 0 UTRs were mixed and added to cells for RNAi [S2]. Table S4. Parameters Used in Sensitivity Analyses in Figure B of the Box in the Main Text Symbol Meaning Values Units K b T Boltzmann constant 4.2 $ [pn $ mm] N Number of interpolar MTs 100 # S 0 Whole-spindle tension rest length 10 [mm] V sliding,max Free load velocity of Kinesin [mm/s] V d,0 Minimal depolymerization velocity 0.01 [mm/s] V dep,max Maximal depolymerization velocity due to sliding force 0.06 [mm/s] V poly Plus end polymerization velocity 0.06 [mm/s] a Total force per unit length of sliding motors 100 [pn/mm] b Spindle tension spring constant 80 [pn/mm] F kt,0 Depolymerization force on the kinetochore 100 [pn] d Minimal distance for polymerization 4 [nm]