Supplemental Data. Liu et al. (2013). Plant Cell /tpc

(phosphatase tensin) domain is shown in dark gray, the FH1 domain in black, and the

Supplemental Figure 1. Predicted Domain Organization of the AFH14 Protein. (A) Schematic representation of the predicted domain organization of AFH14. The PTEN (phosphatase tensin) domain is shown in dark

Supplemental Data. Cui et al. (2012). Plant Cell /tpc a b c d. Stem UBC32 ACTIN

A Root Stem Leaf Flower Silique Senescence leaf B a b c d UBC32 ACTIN C * Supplemental Figure 1. Expression Pattern and Protein Sequence of UBC32 Homologues in Yeast, Human, and Arabidopsis. (A) Expression

Supplemental Data. Sethi et al. (2014). Plant Cell /tpc

Supplemental Data Supplemental Figure 1. MYC2 Binds to the E-box but not the E1-box of the MPK6 Promoter. (A) E1-box and E-box (wild type) containing MPK6 promoter fragment. The region shown in red denotes

S156AT168AY175A (AAA) were purified as GST-fusion proteins and incubated with GSTfused

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Supplemental Materials Supplemental Figure S1 (a) Phenotype of the wild type and grik1-2 grik2-1 plants after 8 days in darkness.

Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA

Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted

Supplementary Fig 1. The responses of ERF109 to different hormones and stresses. (a to k) The induced expression of ERF109 in 7-day-old Arabidopsis

Supplementary Fig 1. The responses of ERF109 to different hormones and stresses. (a to k) The induced expression of ERF109 in 7-day-old Arabidopsis seedlings expressing ERF109pro-GUS. The GUS staining

Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity.

Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity. (A) Amino acid alignment of HDA5, HDA15 and HDA18. The blue line

Supplemental Materials

Supplemental Materials Flores-Pérez et al., Supplemental Materials, page 1 of 5 Supplemental Figure S1. Pull-down and BiFC controls, and quantitative analyses associated with the BiFC studies. (A) Controls

Supplemental Data. Benstein et al. (2013). Plant Cell /tpc

Supplemental Figure 1. Purification of the heterologously expressed PGDH1, PGDH2 and PGDH3 enzymes by Ni-NTA affinity chromatography. Protein extracts (2 µl) of different fractions (lane 1 = total extract,

Supplemental materials

Supplemental materials Materials and methods for supplemental figures Yeast two-hybrid assays TAP46-PP2Ac interactions I. The TAP46 was used as the bait and the full-length cdnas of the five C subunits

Supplemental Figure 1. VLN5 retains conserved residues at both type 1 and type 2 Ca 2+ -binding

Supplemental Figure 1. VLN5 retains conserved residues at both type 1 and type 2 Ca 2+ -binding sites in the G1 domain. Multiple sequence alignment was performed with DNAMAN6.0.40. Secondary structural

Supplemental Data. Hachez et al. Plant Cell (2014) /tpc Suppl. Figure 1A

Suppl. Figure 1A Suppl. Figure 1B Supplemental Figure 1: Results of the commercial screening of interactants using split ubiquitin technique. (A) Isolated preys (192) using the bait construct pbt3-n- as

Supplemental data. Zhao et al. (2009). The Wuschel-related homeobox gene WOX11 is required to activate shoot-borne crown root development in rice.

Supplemental data. Zhao et al. (2009). The Wuschel-related homeobox gene WOX11 is required to activate shoot-borne crown root development in rice. A B Supplemental Figure 1. Expression of WOX11p-GUS WOX11-GFP

Supplementary information

Supplementary information Supplementary figures Figure S1 Level of mycdet1 protein in DET1 OE-1, OE-2 and OE-3 transgenic lines. Total protein extract from wild type Col0, det1-1 mutant and DET1 OE lines

Supplemental Data. Farmer et al. (2010) Plant Cell /tpc

Supplemental Figure 1. Amino acid sequence comparison of RAD23 proteins. Identical and similar residues are shown in the black and gray boxes, respectively. Dots denote gaps. The sequence of plant Ub is

Supplemental Data. Tang et al. Plant Cell. (2012) /tpc

Supplemental Figure 1. Relative Pchlide Fluorescence of Various Mutants and Wild Type. Seedlings were grown in darkness for 5 d. Experiments were repeated 3 times with same results. Supplemental Figure

Supplementary Materials for

www.sciencemag.org/cgi/content/full/science.1245533/dc1 Supplementary Materials for A Mechanism for Reorientation of Cortical Microtubule Arrays Driven by Microtubule Severing Jelmer J. Lindeboom, Masayoshi

Supplemental Data. Na Xu et al. (2016). Plant Cell /tpc

Supplemental Figure 1. The weak fluorescence phenotype is not caused by the mutation in At3g60240. (A) A mutation mapped to the gene At3g60240. Map-based cloning strategy was used to map the mutated site

Supplemental Data. Steiner et al. Plant Cell. (2012) /tpc

Supplemental Figure 1. SPY does not interact with free GST. Invitro pull-down assay using E. coli-expressed MBP-SPY and GST, GST-TCP14 and GST-TCP15. MBP-SPY was used as bait and incubated with equal amount

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/5/244/ra72/dc1 Supplementary Materials for An Interaction Between BZR1 and DELLAs Mediates Direct Signaling Crosstalk Between Brassinosteroids and Gibberellins

Supplemental Data. Guo et al. (2015). Plant Cell /tpc

Supplemental Figure 1. The Mutant exb1-d Displayed Pleiotropic Phenotypes and Produced Branches in the Axils of Cotyledons. (A) Branches were developed in exb1-d but not in wild-type plants. (B) and (C)

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

A Repressor Complex Governs the Integration of

Developmental Cell 15 Supplemental Data A Repressor Complex Governs the Integration of Flowering Signals in Arabidopsis Dan Li, Chang Liu, Lisha Shen, Yang Wu, Hongyan Chen, Masumi Robertson, Chris A.

Supplementary Figures 1-12

Supplementary Figures 1-12 Supplementary Figure 1. The specificity of anti-abi1 antibody. Total Proteins extracted from the wild type seedlings or abi1-3 null mutant seedlings were used for immunoblotting

Chemical hijacking of auxin signaling with an engineered auxin-tir1

1 SUPPLEMENTARY INFORMATION Chemical hijacking of auxin signaling with an engineered auxin-tir1 pair Naoyuki Uchida 1,2*, Koji Takahashi 2*, Rie Iwasaki 1, Ryotaro Yamada 2, Masahiko Yoshimura 2, Takaho

Supplemental Data. Seo et al. (2014). Plant Cell /tpc

Supplemental Figure 1. Protein alignment of ABD1 from other model organisms. The alignment was performed with H. sapiens DCAF8, M. musculus DCAF8 and O. sativa Os10g0544500. The WD40 domains are underlined.

Supplemental Figure 1

12 1 8 Embryo 6 5 4 Silk 6 4 2 3 2 1 1 15 21 24 3 35 4 45 days after pollination 2 6 12 24 72 hours after pollination 35 6 3 25 2 15 1 5 Endosperm 8 12 21 22 3 35 4 45 days after pollination 5 4 3 2 1

WiscDsLox485 ATG < > //----- E1 E2 E3 E4 E bp. Col-0 arr7 ARR7 ACTIN7. s of mrna/ng total RNA (x10 3 ) ARR7.

A WiscDsLox8 ATG < > -9 +0 > ---------//----- E E E E E UTR +9 UTR +0 > 00bp B S D ol-0 arr7 ol-0 arr7 ARR7 ATIN7 D s of mrna/ng total RNA opie 0. ol-0 (x0 ) arr7 ARR7 Supplemental Fig.. Genotyping and

Supplemental Data. Zhang et al. (2010). Plant Cell /tpc

Supplemental Figure 1. uvs90 gene cloning The T-DNA insertion in uvs90 was identified using thermal asymmetric interlaced (TAIL)-PCR. Three rounds of amplification were performed; the second (2 nd ) and

Supplemental Data. Lee et al. Plant Cell. (2010) /tpc Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2.

Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2. (A) Protein structures of DWA1 and DWA2. WD40 region was determined based on the NCBI conserved domain databases (B, C) Schematic representation

Supplementary Materials: 1. Supplementary Figures S1-S9. 2. Supplementary Tables S1-S2

Supplementary Materials: 1. Supplementary Figures S1-S9 2. Supplementary Tables S1-S2 S1 1. Supplementary Figures Fig. S1. Genotypes of tcp20 mutants. Fig. S2. Root phenotypes of tcp20 mutants. Fig. S3.

Supplementary Figure 1 Collision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK2, PPK3 and PPK4 respectively.

Supplementary Figure 1 lision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK, PPK3 and PPK respectively. % of nuclei with signal / field a 5 c ppif3:gus pppk1:gus 0 35 30 5 0 15 10

kda

Relative VENUS/RFP fluorescence Relative fluorescence a min 2 min 4 min 6 min 8 min min Jas9-VENUS d kda 8 3 75 63 48 Jas9-VENUS Col- - + - + COR µm Jas9-VENUS 35 28 H2B-RFP 7 b c Overlay,2,8,6,4,2,6,4,2,8,6,4,2

Supporting Information

Supporting Information Deng et al. 10.1073/pnas.1102117108 Fig. S1. Predicted structure of Arabidopsis bzip60 RNA. Lowest free energy form (ΔG = 309.72 (initially 343.10) of bzip60 mrna folded by M-Fold

Supporting Information

Supporting Information Materials and Methods Plant Materials and Growth Conditions All Arabidopsis thaliana plants used in this study were of the Columbia-0 ecotype. 35S:PIF3-Myc (1), 35S:PIF4-Myc (2),

SUPPLEMENTARY INFORMATION

Ca 2+ /calmodulin Regulates Salicylic Acid-mediated Plant Immunity Liqun Du, Gul S. Ali, Kayla A. Simons, Jingguo Hou, Tianbao Yang, A.S.N. Reddy and B. W. Poovaiah * *To whom correspondence should be

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.

Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying

Supplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17

Molecular Cell, Volume 65 Supplemental Information Pacer Mediates the Function of Class III PI3K and HOPS Complexes in Autophagosome Maturation by Engaging Stx17 Xiawei Cheng, Xiuling Ma, Xianming Ding,

Supplementary Information

Supplementary Information ER-localized auxin transporter PIN8 regulates auxin homeostasis and male gametophyte development in Arabidopsis Supplemental Figures a 8 6 4 2 Absolute Expression b Absolute Expression

Supplemental Data. Meng et al. (2011). Plant Cell /tpc B73 CML311 CML436. Gaspé Flint

Gaspé Flint B73 CML311 CML436 A B C D 10 th leaf 10 th leaf 10 th leaf Supplemental Figure 1. Whole plant images of the four varieties used in this study (A) Extreme early flowering temperate line Gaspé

SUPPLEMENTARY INFORMATION

doi:10.1038/nature12119 SUPPLEMENTARY FIGURES AND LEGENDS pre-let-7a- 1 +14U pre-let-7a- 1 Ddx3x Dhx30 Dis3l2 Elavl1 Ggt5 Hnrnph 2 Osbpl5 Puf60 Rnpc3 Rpl7 Sf3b3 Sf3b4 Tia1 Triobp U2af1 U2af2 1 6 2 4 3

SUPPLEMENTAL DATA. Supplementary data

1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 SUPPLEMENTAL DATA Supplementary data Figure S1: Verification of pla-iα1 knockdown lines a: Semiquantitative

Nature Genetics: doi: /ng.3556 INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE. Supplementary Figure 1

INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE Supplementary Figure 1 REF6 expression in transgenic lines. (a,b) Expression of REF6 in REF6-HA ref6 and REF6ΔZnF-HA ref6 plants detected by RT qpcr (a) and immunoblot

Supplemental Figure legends Figure S1. (A) (B) (C) (D) Figure S2. Figure S3. (A-E) Figure S4. Figure S5. (A, C, E, G, I) (B, D, F, H, Figure S6.

Supplemental Figure legends Figure S1. Map-based cloning and complementation testing for ZOP1. (A) ZOP1 was mapped to a ~273-kb interval on Chromosome 1. In the interval, a single-nucleotide G to A substitution

Supplemental Data. Zhao et al. Plant Cell. (2011) /tpc

Supplemental Figure 1. Expression of SCAB1 and its homologs in Arabidopsis. (A-G) The SCAB1 expression pattern as indicated by the promoter and GUS reporter fusion. ProSCAB1:GUS expression in seedlings

Supplemental Data. Wang et al. Plant Cell. (2013) /tpc

SNL1 SNL Supplemental Figure 1. The Expression Patterns of SNL1 and SNL in Different Tissues of Arabidopsis from Genevestigator Web Site (https://www.genevestigator.com/gv/index.jsp). 1 A 1. 1..8.6.4..

A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Journal of Plant Research A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana Linna Leng 1 Qianqian Liang

Construction of plant complementation vector and generation of transgenic plants

MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological

pgbkt7 Anti- Myc AH109 strain (KDa) 50

pgbkt7 (KDa) 50 37 Anti- Myc AH109 strain Supplementary Figure 1. Protein expression of CRN and TDR in yeast. To analyse the protein expression of CRNKD and TDRKD, total proteins extracted from yeast culture

Figure S1. DELLA Proteins Act as Positive Regulators to Mediate GA-Regulated Anthocyanin

Supplemental Information Figure S1. DELLA Proteins Act as Positive Regulators to Mediate GA-Regulated Anthocyanin Biosynthesis. (A) Effect of GA on anthocyanin content in WT and ga1-3 seedlings. Mock,

SUPPLEMENTARY INFORMATION

AS-NMD modulates FLM-dependent thermosensory flowering response in Arabidopsis NATURE PLANTS www.nature.com/natureplants 1 Supplementary Figure 1. Genomic sequence of FLM along with the splice sites. Sequencing

Nature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets.

Supplementary Figure 1 ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Gene structures are shown underneath each panel. Supplementary Figure 2 pref6::ref6-gfp complements

Supplementary Information. c d e

Supplementary Information a b c d e f Supplementary Figure 1. atabcg30, atabcg31, and atabcg40 mutant seeds germinate faster than the wild type on ½ MS medium supplemented with ABA (a and d-f) Germination

Supplemental Data. Dai et al. (2013). Plant Cell /tpc Absolute FyPP3. Absolute

A FyPP1 Absolute B FyPP3 Absolute Dry seeds Imbibed 24 hours Dry seeds Imbibed 24 hours C ABI5 Absolute Dry seeds Imbibed 24 hours Supplemental Figure 1. Expression of FyPP1, FyPP3 and ABI5 during seed

PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF

YFP-PHF1 CFP-PHT1;2 PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF + CFP-PHT1;2 Negative control!-gfp Supplemental Figure 1: PHT1;2 accumulation is PHF1 dependent. Immunoblot analysis on total protein extract

Supplemental Figure 1. Phos-Tag mobility shift detection of in vivo phosphorylated ERF6 in 35S:ERF6 WT plants after B. cinerea inoculation.

Supplemental Figure 1. Phos-Tag mobility shift detection of in vivo phosphorylated ERF6 in 35S:ERF6 WT plants after B. cinerea inoculation. Protein extracts from 35S:ERF6 WT seedlings treated with B. cinerea

Supplemental Data. Zhang et al. Plant Cell (2014) /tpc

Supplemental Data. Zhang et al. Plant Cell (214) 1.115/tpc.114.134163 55 - T C N SDIRIP1-GFP 35-25 - Psb 18 - Histone H3 Supplemental Figure 1. Detection of SDIRIP1-GFP in the nuclear fraction by Western

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10928 Materials and Methods 1. Plant material and growth conditions. All plant lines used were in Col-0 background unless otherwise specified. pif4-101 mutant

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rodríguez-Fraticelli et al., http://www.jcb.org/cgi/content/full/jcb.201203075/dc1 Figure S1. Cell spreading and lumen formation in confined

- 1 - Supplemental Data

- 1-1 Supplemental Data 2 3 4 5 6 7 8 9 Supplemental Figure S1. Differential expression of AtPIP Genes in DC3000-inoculated plants. Gene expression in leaves was analyzed by real-time RT-PCR and expression

Supplementary Information

Supplementary Information MED18 interaction with distinct transcription factors regulates plant immunity, flowering time and responses to hormones Supplementary Figure 1. Diagram showing T-DNA insertion

Experimental Tools and Resources Available in Arabidopsis. Manish Raizada, University of Guelph, Canada

Experimental Tools and Resources Available in Arabidopsis Manish Raizada, University of Guelph, Canada Community website: The Arabidopsis Information Resource (TAIR) at http://www.arabidopsis.org Can order

Supplemental Figure 1. Rosette Leaf Morphology of Single, Double and Triple Mutants of eid3, phya-201 and phyb-5. Photographs of Ler wild type,

Supplemental Figure 1. Rosette Leaf Morphology of Single, Double and Triple Mutants of eid3, phya-201 and phyb-5. Photographs of Ler wild type, phya-201, phyb-5, phya-201 phyb-5, eid3, phya-201 eid3, phyb-5

Supplementary Data Supplementary Figures

Supplementary Data Supplementary Figures Supplementary Figure 1. Pi04314 is expressed during infection, each GFP-Pi04314 fusion is stable and myr GFP-Pi04314 is removed from the nucleus while NLS GFP-Pi04314

Supplemental Data. Borg et al. Plant Cell (2014) /tpc

Supplementary Figure 1 - Alignment of selected angiosperm DAZ1 and DAZ2 homologs Multiple sequence alignment of selected DAZ1 and DAZ2 homologs. A consensus sequence built using default parameters is shown

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Yamaguchi et al., http://www.jcb.org/cgi/content/full/jcb.201009126/dc1 S1 Figure S2. The expression levels of GFP-Akt1-PH and localization

Supplemental Figure 1. Alignment of the NbGAPC amino acid sequences with their Arabidopsis homologues.

Supplemental Figure 1. Alignment of the NbGAPC amino acid sequences with their Arabidopsis homologues. Homologs from N. benthamiana (NbGAPC1, NbGAPC2, NbGAPC3), Arabidopsis (AtGAPC1, AT3G04120; AtGAPC2,

Supplemental Data. Fan et al. (2014). Plant Cell /tpc

Supplemental Data. Fan et al. (). Plant Cell./tpc.. Cell wall EXP EXP EXP9 HLH/bHLH AIF HFR HBI PAR ABAR Atg778 At3g39 Atg38 Atg3 EXP EXP6 EXP8 Photosynthesis PSAD- PSAD- PSBY PSBO- PSAN LHCB6 PSBS LHCB

Wt (Col-0) pom2-1 Wt (Ler) pom2-3 pom2-5. pom2-4 (0%) pom2-1 (0%)

Figure 1 Wt (Col-0) Wt (Ler) pom2-3 pom2-5 pom2-2 pom2-4 B Wt (0%) (0%) Wt (4.5%) (4.5%) Wt (0%) (0%) Wt (4.5%) (4.5%) (4.5%) Figure 1. Phenotypes of pom2 and wild type (Wt) seedlings after germination

Supplemental Data. Wang et al. (2017). Plant Cell /tpc NIP1;2 NIP7;1

Supplemental Data. Wang et al. (217). Plant Cell 1.115/tpc.16.825 NIP1;1 NIP1;2 NIP2;1 NIP3;1 NIP4;1 NIP5;1 NIP6;1 NIP7;1 Supplemental Figure 1. Distinct Localization of NIPs in Root Epidermal Cells. (Supports

Table S1 A list of primers used in the study

Table S1 A list of primers used in the study Gene Forward primer (5-3 ) Reverse primer (5-3 ) T3 ATTAACCCTCACTAAAGGGA T7 TAATACGACTCACTATAGGG PvSPX2-5 GGAAGAATGACGTTGAGA PvSPX3-5 CAGCCCTTCTATGAAATTGA PvSPX3-3

Supplemental Data Supplemental Figure 1.

Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)

1. Introduction Drought stress and climate change Three strategies of plants in response to water stress 3

Contents 1. Introduction 1 1.1 Drought stress and climate change 3 1.2 Three strategies of plants in response to water stress 3 1.3 Three closely related species of Linderniaceae family are experimental

Supplemental Data. Tilbrook et al. (2016). Plant Cell /tpc

Supplemental Figure 1. Protein alignment of with. Identical aligned residues highlighted in black and similar and non-similar residues highlighted in grey and white, respectively. Position of Trp residues

Supplemental Figure 1.

Supplemental Data. Charron et al. Dynamic landscapes of four histone modifications during de-etiolation in Arabidopsis. Plant Cell (2009). 10.1105/tpc.109.066845 Supplemental Figure 1. Immunodetection

Supplemental Data. Furlan et al. Plant Cell (2017) /tpc

Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Figure.

Combining Techniques to Answer Molecular Questions

Combining Techniques to Answer Molecular Questions UNIT FM02 How to cite this article: Curr. Protoc. Essential Lab. Tech. 9:FM02.1-FM02.5. doi: 10.1002/9780470089941.etfm02s9 INTRODUCTION This manual is

Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh

Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon

SUPPLEMENTARY INFORMATION

Local auxin metabolism regulates environment-induced hypocotyl elongation Zuyu Zheng 1,2, Yongxia Guo 3, Ondřej Novák 4,5, William Chen 2, Karin Ljung 4, Joseph P. Noel 1,3, *, and Joanne Chory 1,2, *

T H E J O U R N A L O F C E L L B I O L O G Y

Supplemental material Wang et al., http://www.jcb.org/cgi/content/full/jcb.201405026/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Generation and characterization of unc-40 alleles. (A and

Rer1 and calnexin regulate endoplasmic reticulum retention of a peripheral myelin protein 22 mutant that causes type 1A Charcot-Marie-Tooth disease

Rer1 and calnexin regulate endoplasmic reticulum retention of a peripheral myelin protein mutant that causes type 1A Charcot-Marie-Tooth disease Taichi Hara, Yukiko Hashimoto, Tomoko Akuzawa, Rika Hirai,

Supplementary Figure 1. BES1 specifically inhibits ABA responses in early seedling

Supplementary Figure 1. BES1 specifically inhibits ABA responses in early seedling development. a. Exogenous BR application overcomes the hypersensitivity of bzr1-1d seedlings to ABA. Seed germination

ATL1-GFP Marker-mCherry/RFP Merge B C D

Input IP:α-H EDR1-H stedr1-h EV EDR1-H stedr1-h EV α-h α-mcherry TL1-GFP Marker-mCherry/RFP Merge C D GmMan49-mCherry mcherry-syp21 VH-a1-RFP E F G H I J EDR1-nYFP+TL1-cYFP ra6-mcherry Merge K L M Supplemental

JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Paul et al.,

Supplemental material JCB Paul et al., http://www.jcb.org/cgi/content/full/jcb.201502040/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Mutant p53-expressing cells display limited retrograde actin flow at

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Bays et al., http://www.jcb.org/cgi/content/full/jcb.201309092/dc1 Figure S1. Specificity of the phospho-y822 antibody. (A) Total cell

SUPPLEMENTARY INFORMATION

DOI:.38/ncb54 sensitivity (+/-) 3 det- WS bri-5 BL (nm) bzr-dbri- bzr-d/ bri- g h i a b c d e f Hypcocotyl length(cm) 5 5 PAC Hypocotyl length (cm)..8..4. 5 5 PPZ - - + + + + - + - + - + PPZ - - + + +

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm

Supplementary Figure 1 PZA inhibits root hair formation as well as cell elongation in the maturation zone of eto1-2 roots. (A) The PI staining of the

Supplementary Figure 1 PZA inhibits root hair formation as well as cell elongation in the maturation zone of eto1-2 roots. (A) The PI staining of the roots of three-day-old etiolated seedlings of Col-0

Supplement Figure 1. Plin5 Plin2 Plin1. KDEL-DSRed. Plin-YFP. Merge

Supplement Figure 1 Plin5 Plin2 Plin1 KDEL-DSRed Plin-YFP Merge Supplement Figure 2 A. Plin5-Ab MitoTracker Merge AML12 B. Plin5-YFP Cytochrome c-cfp merge Supplement Figure 3 Ad.GFP Ad.Plin5 Supplement

AD-FIL AD-YAB2 -2 BD-JAZ3 AD-YAB3 AD-YAB5 AD-FIL -4 3AT BD-JAZ3 AD-YAB3

3 4 9 10 11 12 AD-FIL AD-YAB5 2 B AD-YAB3 1 BD-JAZ 5 6 7 8 AD-FIL A AD-YAB2 Supplemental Data. Boter et al. (2015). Plant Cell 10.1105/tpc.15.00220 BD AD-YAB2-2 -2 BD-JAZ3 AD-YAB3 BD AD-YAB5-4 AD-FIL -4

Fig. S1. Molecular phylogenetic analysis of AtHD-ZIP IV family. A phylogenetic tree was constructed using Bayesian analysis with Markov Chain Monte

Fig. S1. Molecular phylogenetic analysis of AtHD-ZIP IV family. A phylogenetic tree was constructed using Bayesian analysis with Markov Chain Monte Carlo algorithm for one million generations to obtain

monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in

Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal

Supplemental Data. Challa et al. (2016). Plant Cell /tpc

Supplemental Figure 1. DEX-induced TCP4 activity rescues jaw-d phenotypes. (A) and (B) Rosettess of 32-day-old Col-0;ProTCP4:mTCP4:GR plants (A) and jaw-d;protcp4:mtcp4:gr (B) plants grown in mock or in

Supplemental Data. Jing et al. (2013). Plant Cell /tpc

Supplemental Figure 1. Characterization of epp1 Mutants. (A) Cotyledon angles of 5-d-old Col wild-type (gray bars) and epp1-1 (black bars) seedlings under red (R), far-red (FR) and blue (BL) light conditions,

Three major types of cytoskeleton

The Cytoskeleton Organizes and stabilizes cells Pulls chromosomes apart Drives intracellular traffic Supports plasma membrane and nuclear envelope Enables cellular movement Guides growth of the plant cell

Supplemental Table 1. The progeny of crosses between MPK4/mpk4-2 and ANQ/anq-2. Genotype Number Number Number observed expected-1 expected-2 (1) MPK4/MPK4 ANQ/ANQ 32 12 21 (2) MPK4/MPK4 ANQ/anq-2 28 25

Supplemental Figure S1. Nucleotide and deduced amino acid sequences of pepper CaHSP70a (Capsicum annuum heat shock protein 70a) cdna.

Supplemental Figure S1. Nucleotide and deduced amino acid sequences of pepper (Capsicum annuum heat shock protein 70a) cdna. Translation initiation codon is shown in bold typeface; termination codon is

Supplementary Fig. 1. Microscopic image of cotyledon adaxial epidermis of 3-dayold Col, epf2-1, ros1-4 and rdd. Scale bar, 100 m.

Supplementary Fig. 1. Microscopic image of cotyledon adaxial epidermis of 3-dayold Col, epf2-1, ros1-4 and rdd. Scale bar, 100 m. Supplementary Fig. 2. The small-cell-cluster phenotype of different ros1

Supplemental Materials

Supplemental Materials Supplemental Figure S. Phenotypic assessment of alb4 mutant plants under different stress conditions. (A) High-light stress and drought stress. Wild-type (WT) and alb4 mutant plants

Supplemental Data. Hu et al. Plant Cell (2017) /tpc

1 2 3 4 Supplemental Figure 1. DNA gel blot analysis of homozygous transgenic plants. (Supports Figure 1.) 5 6 7 8 Rice genomic DNA was digested with the restriction enzymes EcoRⅠ and BamHⅠ. Lanes in the