The following antibodies were used in this study: NuMA - rabbit-anti NuMA (gift from

Size: px
Start display at page:

Download "The following antibodies were used in this study: NuMA - rabbit-anti NuMA (gift from"

Transcription

1 Materials and Methods Antibodies: The following antibodies were used in this study: NuMA - rabbit-anti NuMA (gift from D. A. Compton); Dynein Intermediate Chain (Chemicon, Temecula, CA); Dynein Light Intermediate Chain - pab JH92 made against recombinant dynein LIC-A(21); p150 Glued - mab P41920 (BD Pharmingen, San Diego, CA); Arp1 - mab 45A(30); γ- tubulin - mab GTU88 (Sigma) or rabbit antiserum pab (Sigma, St. Louis, MO) against peptide EEFATEGTDRKDVFFYK; Centrin-2 - mab hcetn2.4(31); HSET - pab anti- HSET (gift from D. A. Compton); Actin - pab A-2066 (Sigma). Cell Culture and transfection: UPCI cell lines were made in the University of Pittsburgh by SMG and all other cell lines were obtained from American Type Culture Collection. UPCI:SCC lines were grown in minimal essential medium (MEM) supplemented with 10% fetal bovine serum (FBS), 2mM L-Glutamine, 0.05mg/ml gentamicin, and 1% MEM non-essential amino acids (all cell culture media/supplements from Gibco BRL, Grand Island, NY unless otherwise noted). Diploid human fibroblast cells (GM03349B) were cultured in MEM supplemented with 15% FBS. JAR cells were cultured in MEM supplemented with 10% FBS. IMR-32 and SK-HEP-1 cells were cultured in MEM supplemented with 10% FBS and 1% MEM non-essential amino acids. Normal oral cells were grown from uvulopalatopharyngoplasty (UP3) tissue samples in KGM-2 media (Bio-Whittaker, East Rutherford, NJ) as described previously (36). HEK293 human embryonic kidney N1E- 115, A431 and Hs766T cells were cultured in DMEM supplemented with 10% FBS. 1

2 MIA-PaCa2 cells were cultured in DMEM supplemented with 10% FBS and 2.5% horse serum. HCT116 and MES-SA cells were cultured in McCoy s 5A medium supplemented with 10% FBS. AGS, PC-3 and A549 cells were cultured in F12K medium supplemented with 10% FBS. All cultures were grown at 37 0 C with 5% CO 2. Cells were seeded on 22mm 2 coverslips (Corning Glass Works, Corning NY) and for sirna transfections were transfected with 1 µg/coverslip of sirna to NuMA using Lipofectamine or Lipofectamine 2000 (both Gibco) following the manufacturer s instructions and then incubated for three days prior to fixation. sirna to GAPDH was used as a negative control. Fluorescently-labeled sirna was prepared using the Silencer labeling kit (Ambion, Austin, TX). Plasmids encoding NuMA (14) and DsRed-tagged CC1 (25, 32) were transfected using Lipofectamine or FuGene6 (Roche Diagnostics, Indianapolis, IN) and fixed hours after transfection. HEK293 cells treated with Colcemid were incubated for hours in 2nM colcemid (Irvine Scientific, Santa Ana, CA) and then released overnight prior to fixation. UP3 cells were cultured in SMEM Ca 2+ free media as described previously(33) Immunofluorescence microscopy: Immunofluorescence was performed as described (6). Briefly, cells were fixed for 5 minutes in -20 C methanol, treated with blocking solution, treated with primary antibodies, washed and then treated with secondary antibodies and 4',6-Diamidino-2- phenylindole (DAPI) which stains chromatin. Samples were scored using a BX-60 microscope (Olympus, Melville, NY). At least 200 cells were scored per condition per experiment or time point, and each experiment was repeated at least four times. 2

3 Western Blot analysis: Whole cell lysates were obtained by harvesting the cells in RIPA buffer (50 mm Tris- HCl, ph 8.0, 150 mm NaCl, 0.5% Na-deoxycholate, 1% NP-40, 0.1% SDS) containing the protease inhibitors leupeptin, pepstatin and PMSF. After centrifugation, cell extracts were analyzed by immunoblotting on PVDF membrane. Blots were probed with primary antibodies overnight at 4 C or for 2 hours at room temperature and then with secondary antibodies coupled to horseradish peroxidase for one hour at room temperature. Immunoreactivity was detected by chemiluminescence using SuperSignal substrate (Pierce, Rockford, IL) as per manufacturer s protocol. 3

4 Table S1. sirna-mediated knockdown of NuMA leads to a loss of multipolarity and restoration of spindle dynein in some cancer cell lines. Cells were scored for frequency of multipolarity in the metaphase population and dynein localization on the spindle before and after sirna knockdown of NuMA. All numbers are % of population, or % of transfected population in sirna-treated cases. The numbers represent total cells, of which approximately 50% are transfected. *In UPCI:SCC078 cells, it was not possible to differentiate transfected cells from the population due to the morphology of the cell population, multipolar Dynein Dynein positive Cell line Tissue source multipolar after sirna positive after sirna NuMAdependent UPCI:SCC103 oral cancer SK-HEP-1 liver cancer UPCI:SCC078* oral cancer NuMAindependent UPCI:SCC070 oral cancer JAR placental cancer IMR-32 brain cancer MES-SA uterine cancer

5 Table S2. Multipolarity in the tested cancer cells arises only in those that exhibit both extra centrosomes and dynein depletion. Cells were scored for frequency of cells with extra centrosomes in the interphase population, dynein localization on the spindle and multipolarity. Spindle localization of dynactin was also determined and all cell lines examined were shown to be >90% positive. All numbers are % of population. Cells were grouped according to the phenotypes seen as follows: cells with I. extra centrosomes and no dynein staining; II. normal centrosomes and no dynein staining; III. extra centrosomes and normal dynein labeling; and IV. normal centrosomes and dynein. Only cells in class I exhibited high (>10%) multipolarity, but further analysis will be required to confirm that this relationship is general one. extra dynein group cell line tissue source centrosomes positive multipolar UPCI:SCC070 oral cancer UPCI:SCC078 oral cancer UPCI:SCC103 oral cancer JAR placental cancer I. IMR-32 brain cancer SK-HEP-1 liver cancer MIA-PaCa 2 pancreas cancer A549 lung cancer MES-SA uterine cancer HCT 116 colon cancer

6 II. A-431 skin cancer PC-3 prostate cancer III. UPCI:SCC114 oral cancer UP3 oral normal IV. GM03349B skin fibroblast HEK293 embryonic kidney normal

7 Fig. S1. NuMA expression levels are decreased in cells treated with sirna. UPCI:SCC103 cells are shown transfected with fluorescently-labeled sirna to NuMA (green). Cells are stained with antibodies to NuMA (red) and with DAPI (blue). Some NuMA persists on spindles in transfected cells, but is considerably depleted when compared to untransfected cells. Fig. S2. sirna knockdown of NuMA has no effect on dynein and dynactin expression levels. Normal human fibroblast cells were transfected with sirna to NuMA and total cell extracts were immunoblotted for NuMA, the p150 Glued subunit of dynactin, and the dynein intermediate chain. Actin was used as a loading control. Note that on some immunoblots NuMA is resolved into two bands, the slower migrating band is believed to be the phosphorylated mitotic isoform (15). Fig. S3. Scoring of extra centrosomes in interphase cells. HEK293 cells were transfected with plasmids expressing hmps1 or treated with Colcemid and stained with antibodies to γ-tubulin. Interphase cells were scored for the presence of extra (>2) γ-tubulin containing centrosomes. Both treatments show an increase in cells with extra centrosomes when compared to untreated cells. Similar results were seen using antibodies to centrin-2 to label centrosomes. Additionally, the oral cancer cell line UPCI:SCC114 showed a high frequency of interphase cells with extra centrosomes, but not multipolar spindles (see Fig. S4). 7

8 Fig. S4. Multipolarity is only seen in cells that have supernumerary centrosomes and depletion of spindle dynein. (A,B) HEK293 cells were transfected with plasmids expressing hmps1 and NuMA or CC1 and scored for spindle polarity and dynein localization to the spindle. (C-E) UPCI:SCC:114 cells were labeled with antibodies to dynein (green) and γ-tubulin (red) and with DAPI (blue) and found to have existing centrosomal amplification (C). For these cells, overexpression of NuMA or CC1 alone led to a substantial increase in multipolar spindles. 8

9 Figure S1

10 NuMA p150 Glued Dynein IC actin Figure S2

11 100 Normal extra centrosomes % interphase cells untreated Colcemid hmps1 ox untreated HEK293 UPCI:SCC114 Figure S3

12 A HEK293 B % metaphase cells untr. hmps1 ox hmps1, NuMA ox bipolar multipolar hmps1, CC1 ox % metaphase cells untr. hmps1 ox hmps1, NuMA ox Dynein+ Dynein- hmps1, CC1 ox C UPCI:SCC114 D % metaphase cells untr. bipolar multipolar NuMA ox CC1 ox E % metaphase cells Dynein+ Dyneinuntr. NuMA ox CC1 ox Figure S4

Supplemental Information

Supplemental Information Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai

More information

Supplementary Material

Supplementary Material Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated

More information

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1. A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200

More information

SUPPLEMENTARY INFORMATION FIGURE 1 - 1

SUPPLEMENTARY INFORMATION FIGURE 1 - 1 SUPPLEMENTARY INFORMATION FIGURE 1-1 SUPPLEMENTARY INFORMATION FIGURE 2-2 SUPPLEMENTARY INFORMATION METHODS GST-Pull-Down. Cultures of E. Coli (BL21) were transformed with pgex (Clontech) and pgex recombinant

More information

Description of supplementary material file

Description of supplementary material file Description of supplementary material file In the supplementary results we show that the VHL-fibronectin interaction is indirect, mediated by fibronectin binding to COL4A2. This provides additional information

More information

RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the

RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION The Supplementary Information (SI) Methods Cell culture and transfections H1299, U2OS, 293, HeLa cells were maintained in DMEM medium supplemented with 10% fetal bovine serum. H1299 and 293 cells were

More information

Supplementary methods

Supplementary methods Supplementary methods Cell culture, infection, transfection, and RNA interference HEK293 cells and its derivatives were grown in DMEM supplemented with 10% FBS. Various constructs were introduced into

More information

LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS.

LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS. Supplemental Data: LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS. Scott Jepson, Bryan Vought, Christian H.

More information

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective

More information

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of Fig. S1 TGF RI inhibitor SB525334 effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of different concentrations of SB525334. Cells were lysed and

More information

Cell culture and drug treatment. HEK 293 cells were cultured in DMEM (Gibco-BRL)

Cell culture and drug treatment. HEK 293 cells were cultured in DMEM (Gibco-BRL) Supplementary materials Detailed methods Cell culture and drug treatment. HEK 293 cells were cultured in DMEM (Gibco-BRL) supplemented with 10% fetal bovine serum. To inhibit glucosidase Ι and ΙΙ, castanospermine

More information

Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells

Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells Ryosuke Horie. Kagawa University of medecine, Kita-gun, Japan. Disclosures: R. Horie: None.

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods sirna sequences used in this study The sequences of Stealth Select RNAi for ALK and FLOT-1 were as follows: ALK sense no.1 (ALK): 5 -AAUACUGACAGCCACAGGCAAUGUC-3 ; ALK

More information

Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining.

Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining. Supplementary materials and methods Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining. Cells were analyzed for phosphatidylserine exposure by an annexin-v FITC/propidium

More information

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Nakajima and Tanoue, http://www.jcb.org/cgi/content/full/jcb.201104118/dc1 Figure S1. DLD-1 cells exhibit the characteristic morphology

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Supplementary Figure 1. PKM2 interacts with MLC2 in cytokinesis. a, U87, U87/EGFRvIII, and HeLa cells in cytokinesis were immunostained with DAPI and an anti-pkm2 antibody. Thirty

More information

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm

More information

APA105Hu01 100µg Active Nerve Growth Factor (NGF) Organism Species: Homo sapiens (Human) Instruction manual

APA105Hu01 100µg Active Nerve Growth Factor (NGF) Organism Species: Homo sapiens (Human) Instruction manual APA105Hu01 100µg Active Nerve Growth Factor (NGF) Organism Species: Homo sapiens (Human) Instruction manual FOR RESEARCH USE ONLY NOT FOR USE IN CLINICAL DIAGNOSTIC PROCEDURES [ PROPERTIES ] 1th Edition

More information

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric*

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* Catalog # Kit Size SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* AS-55550 One 96-well strip plate This kit is optimized to detect human/mouse/rat alpha-synuclein

More information

Nature Medicine doi: /nm.2558

Nature Medicine doi: /nm.2558 Supplementary. Fig. 1. (a) Sirt1 and mutant HTT (detected by HTT 81-90 antibody) protein levels were detected by Western blotting in cerebral cortex of N171-82Q mice. (b) Sirt1 and mutant HTT (detected

More information

Anti-HB-EGF (Human) mab

Anti-HB-EGF (Human) mab Page 1 For Research Use Only. Not for use in diagnostic procedures. CODE No. D308-3 Anti-HB-EGF (Human) mab CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal 3H4 Mouse IgG1

More information

Supplemental data. Supplemental Materials and Methods

Supplemental data. Supplemental Materials and Methods Supplemental data Supplemental Materials and Methods Transfection of plasmid. Transfection of plasmids into FRTL5 cells was performed using Lipofectamine LTX with Plus reagent (Invitrogen) according to

More information

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab Page 1 For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab CODE No. M200-3 CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal 1F2 Mouse IgG1 100 L,

More information

Focus Application. Cell Migration. Featured Study: Inhibition of Cell Migration by Gene Silencing. xcelligence System Real-Time Cell Analyzer

Focus Application. Cell Migration. Featured Study: Inhibition of Cell Migration by Gene Silencing. xcelligence System Real-Time Cell Analyzer xcelligence System Real-Time Cell Analyzer Focus Application Cell Migration Featured Study: Inhibition of Cell Migration by Gene Silencing Markus Greiner and Richard Zimmermann Department of Medical Biochemistry

More information

Human/Mouse/Rat Phospho-Histone H2AX (S139) Immunoassay

Human/Mouse/Rat Phospho-Histone H2AX (S139) Immunoassay Cell-Based ELISA Human/Mouse/Rat Phospho-Histone H2AX (S139) Immunoassay Catalog Number KCB2288 An ELISA-based assay using fluorogenic substrates to measure phosphorylated Histone H2AX in whole cells.

More information

Supporting Information

Supporting Information Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS

More information

Stable Isotope Labeling with Amino Acids in Cell Culture. Thermo Scientific Pierce SILAC Protein Quantitation Kits

Stable Isotope Labeling with Amino Acids in Cell Culture. Thermo Scientific Pierce SILAC Protein Quantitation Kits Stable Isotope Labeling with Amino Acids in Cell Culture Thermo Scientific Pierce SILAC Protein Quantitation Kits Quantitative Analysis of Differential Protein Expression Stable isotope labeling using

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

An ELISA-based assay using fluorogenic substrates to measure total Cyclooxygenase-2 (COX-2) in whole cells.

An ELISA-based assay using fluorogenic substrates to measure total Cyclooxygenase-2 (COX-2) in whole cells. Cell-Based ELISA Human/Mouse Total COX-2 Immunoassay Catalog Number KCB4198 An ELISA-based assay using fluorogenic substrates to measure total Cyclooxygenase-2 (COX-2) in whole cells. This package insert

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION (Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).

More information

For gel-shift assays, 2 ul ivtt synthesized protein (Promega) was incubated at room temperature

For gel-shift assays, 2 ul ivtt synthesized protein (Promega) was incubated at room temperature Supplementary Material and Methods EMSA For gel-shift assays, 2 ul ivtt synthesized protein (Promega) was incubated at room temperature for 30 min in a 15 ul volume containing 15 mm Tris-HCl (ph 7.5),

More information

used at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies were

used at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies were 1 Supplemental Methods Reagents and chemicals: TGFβ was a generous gift from Genzyme Inc. (Cambridge, MA) and was used at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies

More information

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration /, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing

More information

Flag-Rac Vector V12 V12 N17 C40. Vector C40 pakt (T308) Akt1. Myc-DN-PAK1 (N-SP)

Flag-Rac Vector V12 V12 N17 C40. Vector C40 pakt (T308) Akt1. Myc-DN-PAK1 (N-SP) a b FlagRac FlagRac V2 V2 N7 C4 V2 V2 N7 C4 p (T38) p (S99, S24) p Flag (Rac) NIH 3T3 COS c +Serum p (T38) MycDN (NSP) Mycp27 3 6 2 3 6 2 3 6 2 min p Myc ( or p27) Figure S (a) Effects of Rac mutants on

More information

Tumor tissues or cells were homogenized and proteins were extracted using

Tumor tissues or cells were homogenized and proteins were extracted using SUPPLEMENTAL MATERIALS AND METHODS Western Blotting Tumor tissues or cells were homogenized and proteins were extracted using T-PER tissue protein extraction buffer. Protein concentrations were determined

More information

Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera

Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera SUPPLEMENTARY INFORMATION Roles of human POLD1 and POLD3 in genome stability Emanuela Tumini, Sonia Barroso, Carmen Pérez Calero and Andrés Aguilera SUPPLEMENTARY METHODS Cell proliferation After sirna

More information

1. Goat Anti-Caspase-3 (CPP32) Antibody, R&D systems (cat #AF-605-NA), 0.5ug/ml

1. Goat Anti-Caspase-3 (CPP32) Antibody, R&D systems (cat #AF-605-NA), 0.5ug/ml Western Blot Antibodies: 1. Goat Anti-Caspase-3 (CPP32) Antibody, R&D systems (cat #AF-605-NA), 0.5ug/ml 2. Goat Anti-human LAP (TGF-b1) Antibody, R&D Systems (cat #AF-246-NA), 0.1-0.2 ug/ml 3. Rabbit

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid

More information

Human/Mouse/Rat Phospho-CREB (S133) Immunoassay. An ELISA-based assay using fluorogenic substrates to measure phosphorylated CREB in whole cells.

Human/Mouse/Rat Phospho-CREB (S133) Immunoassay. An ELISA-based assay using fluorogenic substrates to measure phosphorylated CREB in whole cells. Cell-Based ELISA Human/Mouse/Rat Phospho-CREB (S133) Immunoassay Catalog Number KCB2510 An ELISA-based assay using fluorogenic substrates to measure phosphorylated CREB in whole cells. This package insert

More information

Supplementary Fig.1 Luton

Supplementary Fig.1 Luton Supplementary Fig.1 Luton a 175 Brain Thymus Spleen Small Intestine Kidney Testis HeLa b 250 Lung Kidney MDCK c EFA6B si Control si Mismatch #637 #1564 #1770 83 62 47.5 175 IB: anti-efa6b #B1 130 66 Lysates

More information

Supplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after

Supplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after Supplementary Information: Materials and Methods Recombinant protein expression and in vitro kinase assay. GST and GST-p53 were purified according to standard protocol after induction with.5mm IPTG for

More information

Supporting Online Material for

Supporting Online Material for Supporting Online Material for Spatiotemporal dynamics of Aurora B-PLK1-MCAK signaling axis orchestrates kinetochore bi-orientation and faithful chromosome segregation Hengyi Shao, Yuejia Huang, Liangyu

More information

Supplemental Material

Supplemental Material Supplemental Material 1 Figure S1. Phylogenetic analysis of Cep72 and Lrrc36, comparative localization of Cep72 and Lrrc36 and Cep72 antibody characterization (A) Phylogenetic alignment of Cep72 and Lrrc36

More information

HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid

HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid SUPPLEMENTAL MATERIALS AND METHODS Cell culture, transfection and treatments. HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid encoding vmia (HeLa vmia) 1 were cultured

More information

Supplementary information

Supplementary information Supplementary information Table of Content: Supplementary Results... 2 Supplementary Figure S1: Experimental validation of AP-MS results by coimmunprecipitation Western blot analysis.... 3 Supplementary

More information

Supporting Online Material Material and Methods

Supporting Online Material Material and Methods Supporting Online Material Material and Methods Live-cell DIC recordings PtK 1 cells (ATCC, Manassas, VA) were filmed on a Nikon (Nikon Instruments, Melville, NY) inverted microscope equipped with 60x

More information

Protocol for induction of expression and cell lysate production

Protocol for induction of expression and cell lysate production Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected

More information

The Transfection Collection TCF/LEF Transient Pack Wnt / -catenin Signaling Pathway Catalog #: 79273

The Transfection Collection TCF/LEF Transient Pack Wnt / -catenin Signaling Pathway Catalog #: 79273 Data Sheet The Transfection Collection TCF/LEF Transient Pack Wnt / -catenin Signaling Pathway Catalog #: 79273 Background The Wnt / -catenin signaling pathway controls a large and diverse set of cell

More information

Single cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor

Single cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor SUPPLEMENTARY INFORMATION Single cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor Anna Turetsky 1,a, Eunha Kim 1,a, Rainer H. Kohler 1, Miles A. Miller 1, Ralph Weissleder 1,2,

More information

Supplementary material and methods

Supplementary material and methods Inhibitory effect of caffeic acid on ADP-induced thrombus formation and platelet activation involves mitogen-activated protein kinases Yu Lu 1,2,3,#, Quan Li 3,4,#, Yu-Ying Liu 3,4, Kai Sun 3,4, Jing-Yu

More information

Supplementary Information

Supplementary Information Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2016 Supplementary Information Efficient Delivery of Chlorin e6 into Ovarian

More information

Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice

Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice Belal A. Mohamed, Amal Z. Barakat, Torsten Held, Manar Elkenani, Christian Mühlfeld, Jörg Männer, and Ibrahim M. Adham

More information

Gα 13 Activation Assay Kit

Gα 13 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα 13 Activation Assay Kit Catalog Number: 80401 20 assays NewEast Biosciences 1 Table of Content Product

More information

Antibodies used in this study Figure S1. Akt expression in neutrophils from WT and individual Akt isoform knockout mice

Antibodies used in this study Figure S1. Akt expression in neutrophils from WT and individual Akt isoform knockout mice ntibodies used in this study The anti β-actin monoclonal antibody (Sigma-ldrich, St. Louis, MO) was generated against a slightly modified human β-actin N-terminal peptide, c-sp-sp-sp-ile-la-la-leu-val-ile-

More information

Materials Dulbecco s Modified Eagle Medium (DMEM) and fetal calf serum (FCS) were

Materials Dulbecco s Modified Eagle Medium (DMEM) and fetal calf serum (FCS) were SUPPLEMENT Materials and Methods Materials Dulbecco s Modified Eagle Medium (DMEM) and fetal calf serum (FCS) were obtained from GIBCO-BRL (Paisley, UK). Cell culture plastic wares were from Greiner (Frickenhausen,

More information

Checkpoint Kinase Activity Immunoblot Kit

Checkpoint Kinase Activity Immunoblot Kit Product Manual Checkpoint Kinase Activity Immunoblot Kit Catalog Number STA- 413 20 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cdc25C is a protein phosphatase responsible

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Ono et al., http://www.jcb.org/cgi/content/full/jcb.201208008/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Chromatin-binding properties of MCM2 and condensin II during

More information

supplementary information

supplementary information DOI: 10.1038/ncb1919 Mori et al. Supplementary Figure 1a-b a Characterization of the mdrg cells Anti-NF150 DIC (89%: N=154) 100µm Anti-S100 DIC 100µm b (9.1%: N=144) Characterization of the cortical neurons

More information

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- #1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals

More information

An ELISA-based assay using fluorogenic substrates to measure total inducible Nitric Oxide Synthase (inos) in whole cells.

An ELISA-based assay using fluorogenic substrates to measure total inducible Nitric Oxide Synthase (inos) in whole cells. Cell-Based ELISA Human Total inos Immunoassay Catalog Number KCB9502 An ELISA-based assay using fluorogenic substrates to measure total inducible Nitric Oxide Synthase (inos) in whole cells. This package

More information

Supplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface.

Supplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface. Supplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface. (a) Human PDAC cell lines were treated as indicated in Figure 1 panel F. Cells were analyzed for FITC-rBAG3 binding

More information

Supplementary Material - Methods

Supplementary Material - Methods Novel Protein-Protein Interactions in the Schizophrenia interactome Supplementary Material - Methods Experimental validations of predicted interactions Table S1-1: Protein pairs that were validated by

More information

Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered

Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl

More information

Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium

Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium Iodide (Invitrogen, Carlsbad, CA) staining. Briefly, 2x10 5 cells were washed once in cold PBS and resuspended

More information

Lullaby sirna Transfection Reagent - Results

Lullaby sirna Transfection Reagent - Results sirna Transfection Reagent - Results OZ Biosciences is delighted to announce the launching of a new sirna transfection reagent: -sirna. This lipid based transfection reagent is specifically designed for

More information

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab Page 1 For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab CODE No. M200-3 CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal 1F2 Mouse IgG1 κ 100 µl,

More information

Supplemental Materials and Methods

Supplemental Materials and Methods Supplemental Materials and Methods In situ hybridization In situ hybridization analysis of HFE2 and genin mrna in rat liver tissues was performed as previously described (1). Briefly, the digoxigenin-labeled

More information

EXPERIMENTAL PROCEDURES

EXPERIMENTAL PROCEDURES EXPERIMENTAL PROCEDURES Cell culture and antibodies-human colorectal cancer HCT-116 cells, human embryonic kidney 293 cells and human normal breast epithelial cells MCF-10A cells were cultured as recommended

More information

Development of Novel Advanced Cell Culture Surfaces that Provide Better Cell Growth and Attachment for Cell-Based Assays

Development of Novel Advanced Cell Culture Surfaces that Provide Better Cell Growth and Attachment for Cell-Based Assays Development of Novel Advanced Cell Culture Surfaces that Provide Better Cell Growth and Attachment for Cell-Based Assays Elizabeth J. Abraham, Ph.D. BD Biosciences Outline Overview of surfaces and culture

More information

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6

More information

Gα i Activation Assay Kit

Gα i Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα i Activation Assay Kit Catalog Number 80301 20 assays NewEast Biosciences, Inc 1 Table of Content Product

More information

Immunoprecipitation Protocol

Immunoprecipitation Protocol Immunoprecipitation Protocol Immunoprecipitation is a general method to obtain the enrichment of a specific protein from tissue lysate and cell lysate. It can be used to purify a specific protein, to identify

More information

Supporting Information

Supporting Information Supporting Information Tal et al. 10.1073/pnas.0807694106 SI Materials and Methods VSV Infection and Quantification. Infection was carried out by seeding 5 10 5 MEF cells per well in a 6-well plate and

More information

NTM486-04, NTM174-04,

NTM486-04, NTM174-04, Transfection of transformed human trabecular meshwork TM5, and primary human NTM210-05, NTM486-04, NTM174-04, and NTM153-00 cells with Metafectene Easy Adnan Dibas1A,C, Ming Jiang1A,C, Thomas Yorio1A,C.

More information

Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were. oligonucleotide spanning the NF-kB site (5 -GATCC-

Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were. oligonucleotide spanning the NF-kB site (5 -GATCC- SUPPLEMENTARY MATERIALS AND METHODS Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were prepared as previously described. (1) A [ 32 P] datp-labeled doublestranded oligonucleotide spanning

More information

Bioimaging of microrna-294 expression-dependent color change. in cells by a dual fluorophore-based molecular beacon

Bioimaging of microrna-294 expression-dependent color change. in cells by a dual fluorophore-based molecular beacon Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information for Chemical Communications Bioimaging of microrna-294 expression-dependent

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Thompson et al., http://www.jcb.org/cgi/content/full/jcb.200909067/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Modification-specific antibodies do not detect unmodified

More information

We performed RT-PCR, cloning, sequencing and qrt-pcr in murine melanoma. cell lines and melanocytic tumors from RET-mice in accordance with the method

We performed RT-PCR, cloning, sequencing and qrt-pcr in murine melanoma. cell lines and melanocytic tumors from RET-mice in accordance with the method Supplementary Material and Methods Quantitative RT-PCR (qrt-pcr) We performed RT-PCR, cloning, sequencing and qrt-pcr in murine melanoma cell lines and melanocytic tumors from RET-mice in accordance with

More information

Supporting Information

Supporting Information Supporting Information Stavru et al. 0.073/pnas.357840 SI Materials and Methods Immunofluorescence. For immunofluorescence, cells were fixed for 0 min in 4% (wt/vol) paraformaldehyde (Electron Microscopy

More information

Supplemental methods:

Supplemental methods: Supplemental methods: ASC-J9 treatment ASC-J9 was patented by the University of Rochester, the University of North Carolina, and AndroScience Corp., and then licensed to AndroScience Corp. Both the University

More information

Supplemental Information

Supplemental Information Supplemental Information Genetic and Functional Studies Implicate HIF1α as a 14q Kidney Cancer Suppressor Gene Chuan Shen, Rameen Beroukhim, Steven E. Schumacher, Jing Zhou, Michelle Chang, Sabina Signoretti,

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

Supplemental Information: Phosphorylation of CLIP-170 by Both Plk1 and CK2 Is Involved in the Timely Formation of Kinetochore-microtubule Attachments

Supplemental Information: Phosphorylation of CLIP-170 by Both Plk1 and CK2 Is Involved in the Timely Formation of Kinetochore-microtubule Attachments Supplemental Information: Phosphorylation of CLIP-170 by Both Plk1 and CK2 Is Involved in the Timely Formation of Kinetochore-microtubule Attachments Hongchang Li, X. Shawn Liu, Xiaoming Yang, Yingmin

More information

< Supporting Information >

< Supporting Information > SUPPORTING INFORMATION 1 < Supporting Information > Discovery of autophagy modulators through the construction of high-content screening platform via monitoring of lipid droplets Sanghee Lee, Eunha Kim,

More information

Cell viability. Cell viability was examined by MTT assay (Sigma-Aldrich).

Cell viability. Cell viability was examined by MTT assay (Sigma-Aldrich). Supplementary Materials Supplementary materials and methods Cell culture. Primary human dermal fibroblasts (DFs) were isolated from full-thickness skin samples. Tissue samples were dissected into small

More information

Histone H3 Methylation Antibody Panel Pack I - Active Genes Base Catalog # C Component Size Shipping Temperature

Histone H3 Methylation Antibody Panel Pack I - Active Genes Base Catalog # C Component Size Shipping Temperature Histone H3 Methylation Antibody Panel Pack I - Active Genes Base Catalog # PACK CONTENTS Component Size Shipping Temperature Upon Receipt Checklist 3K4D Histone H3K4me2 (H3K4 Dimethyl) Polyclonal Antibody

More information

Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and

Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and SUPPLEMENTARY MATERIALS AND METHODS Chromatin Immunoprecipitation for qpcr analysis Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and IL24, all located on chromosome 1. Primer

More information

For Research Use Only. Not for use in diagnostic procedures.

For Research Use Only. Not for use in diagnostic procedures. Printed December 13, 2011 Version 1.0 For Research Use Only. Not for use in diagnostic procedures. DDDDK-tagged Protein PURIFICATION GEL with Elution Peptide (MoAb. clone FLA-1) CODE No. 3326 / 3327 PURIFICATION

More information

SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION

SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION SUPPLEMENTAL MATERIALS SIRTUIN PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF ACTIVATION Haranatha R. Potteti*, Subbiah Rajasekaran*, Senthilkumar B. Rajamohan*, Chandramohan R. Tamatam,

More information

DuoSet IC. Human/Mouse Phospho-STAT3 (Y705) Catalog Number DYC4607B-2 Catalog Number DYC4607B-5 Catalog Number DYC4607BE

DuoSet IC. Human/Mouse Phospho-STAT3 (Y705) Catalog Number DYC4607B-2 Catalog Number DYC4607B-5 Catalog Number DYC4607BE DuoSet IC Human/Mouse Phospho-STAT3 (Y705) Catalog Number DYC4607B-2 Catalog Number DYC4607B-5 Catalog Number DYC4607BE For the development of sandwich ELISAs to measure Signal Transducer and Activator

More information

An ELISA-based assay using fluorogenic substrates to measure total HIF-1 in the context of a whole cell.

An ELISA-based assay using fluorogenic substrates to measure total HIF-1 in the context of a whole cell. Cell-Based ELISA Human/Mouse Total HIF-1 Immunoassay Catalog Number KCB1935 An ELISA-based assay using fluorogenic substrates to measure total HIF-1 in the context of a whole cell. This package insert

More information

Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by

Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by Alpha or beta human chorionic gonadotropin knockdown decrease BeWo cell fusion by down-regulating PKA and CREB activation Sudha Saryu Malhotra 1, Pankaj Suman 2 and Satish Kumar Gupta 1 * 1 Reproductive

More information

Supplemental Data Supplementary Figure Legends and Scheme Figure S1.

Supplemental Data Supplementary Figure Legends and Scheme Figure S1. Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,

More information

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807 INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended

More information

Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1

Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 a His-ORMDL3 ~ 17 His-ORMDL3 GST-ORMDL3 - + - + IPTG GST-ORMDL3 ~ b Integrated Density (ORMDL3/ -actin) 0.4 0.3 0.2 0.1

More information

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53 Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -

More information

Gene Forward (5 to 3 ) Reverse (5 to 3 ) Accession # PKA C- TCTGAGGAAATGGGAGAACC CGAGGGTTTTCTTCCTCTCAA NM_011100

Gene Forward (5 to 3 ) Reverse (5 to 3 ) Accession # PKA C- TCTGAGGAAATGGGAGAACC CGAGGGTTTTCTTCCTCTCAA NM_011100 Supplementary Methods: Materials. BRL37344, insulin, 3-isobutyl-1-methylxanthine, dibutyryl camp (Bt2-cAMP) and 8-Bromoadenosine 3,5 -cyclic monophosphate sodium (8-br-cAMP), cilostamide, adenosine deaminase,

More information

DuoSet IC. Human Total p21. Catalog Number DYC Catalog Number DYC Catalog Number DYC1047E

DuoSet IC. Human Total p21. Catalog Number DYC Catalog Number DYC Catalog Number DYC1047E DuoSet IC Human Total p21 Catalog Number DYC1047-2 Catalog Number DYC1047-5 Catalog Number DYC1047E For the development of sandwich ELISAs to measure p21 in cell lysates. This package insert must be read

More information