Factors for consideration in developing research initiatives for DNA microarray development and experimentation.
|
|
- Penelope Cobb
- 6 years ago
- Views:
Transcription
1 Factors for consideration in developing research initiatives for DNA microarray development and experimentation. Robert Fleischmann and Scott Peterson The Institute for Genomic Research The recent development of more robust hardware, chemistry, and software for DNA microarrays has resulted in the promise of a high-throughput technology capable of providing comparative sequence data and insights into gene regulation in a variety of organisms under a variety of stress conditions. Funding agencies developing programs to promote these technologies and their proper application to experimentation must develop relevant program goals and be able to critically evaluate applicants in a variety of areas. This presentation will focus on examining a variety of issues that funding agencies are likely to face in developing program initiatives and evaluating applications. These include the applicants ability to conduct high-throughput microarray experimentation, the technical and experimental limitations of the technology, the types of experimentation to be funded (hypothesis driven vs explorative), funding initiatives currently active or under consideration by other agencies (centralization vs distributing technology), and data access and sharing.
2 Array Facility Microarrayers 2 Intelligent Automations System Robots 2 Molecular Dynamics Robots Scanners Axon Scanner 2 GSI Lumonics Scanners Software Image acquisition and analysis Database structure Projects Mycobacterium tuberculosis - Becton Dickinson Porphyromonas gingivalis - NIDCR, NIH Deinococcus radiodurans Staphylococcus aureus (drug-resistance) - NIH and Rockefeller U. Thermatoga maritima - DOE Methanococcus jannaschii - DOE Methanobacterium thermoautotrophicum - DOE Streptococcus pneumoniae -, LTI, U. of Alabama Bacillus anthracis - NIH Potato disease resistance - NSF Plant Genome Initiative Arabidopsis Chromosome II - NSF Plant Genome Initiative Human Colon Cancer Metastasis - NCI, NIH Rodent Models - NHLBI, NIH (Pending)
3 Array Project Design Obtain source of genomic information Genomic sequence data ESTs What is to be arrayed? PCR amplicons Individual clones Primer design PCR of amplicons Analysis of PCR products Size and specificity Sequence proofing Array Project Design Optimization of glass surface and diluent Silanized L-poly-lysine DMSO SSC RNA source/purification and labeling Experimental design Poly A? Direct cdna labeling with Cy-3 and Cy-5 Indirect labeling using amino-allyl chemistry Hybridization
4 Array Project Design Data acquisition Spot finding Quantitation Linking to database structure Reproducibility Validation Slot blots Northerns RNA ase Protection Assays Funding Initiatives NIH NIAID RO1 s (Strong emphasis on hypothesis driven proposals) Centralization through core distribution NIDCR Supplements to current grant holders NHLBI NCI DOE NSF Plant Genome Initiative
5 Types of Experimentation Hypothesis driven science Propose a specific question Intellectually superior approach Narrow focus Optimal use of technology?? Explorative General stress responses No proposed hypothesis Explore roles of hypothetical ORFs Data Access and Sharing Data release policies - role of funding agency Should array data be treated like genomic data? Public release of all array images? Web pages NCBI, others To what end? Others can extract untapped information Quality control
6 Array Fabrication Microbial ORFs Design PCR Primers PCR Products Eukaryotic THCs Select cdna clones Microtiter Plate + Microarray Slide (as many as 10,000 or more spotted genes) PCR Products Many different plates containing different genes For each plate set, many identical replicas The Institute for Genomic Research Microarray Overview II Measure Fluoresence in 2 channels red/green Control Test Obtain RNA Samples Prepare Fluorescently Labeled Probes Hybridize, Wash Analyze the data to identify differentially expressed genes The Institute for Genomic Research
7 Microarray Overview II Measure Fluoresence in 2 channels red/green Control Obtain RNA Samples Test Prepare Fluorescently Labeled Probes Hybridize, Wash The Institute for Genomic Research Analyze the data to identify differentially expressed genes
8 R Cy3: RNA Cy5: Genomic DNA 0 Fluorescence Intensity Using Ratios Decreases Error Cy3 Intensity Integral for Each Duplicate 1.0E E+06 R 2 = 0.86 Average Percent Error = 15.1% 1.0E E E E E E+07 Cy3/Cy5 Ratio for Each Duplicate 10 R 2 = 0.96 Average Percent Error = 10.2%
Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationSoybean Microarrays. An Introduction. By Steve Clough. November Common Microarray platforms
Soybean Microarrays Microarray construction An Introduction By Steve Clough November 2005 Common Microarray platforms cdna: spotted collection of PCR products from different cdna clones, each representing
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationPlease purchase PDFcamp Printer on to remove this watermark. DNA microarray
DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationEnhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme
Interactomics and Proteomics 1. Interactomics The field of interactomics is concerned with interactions between genes or proteins. They can be genetic interactions, in which two genes are involved in the
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationSIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.
SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and
More informationCalculation of Spot Reliability Evaluation Scores (SRED) for DNA Microarray Data
Protocol Calculation of Spot Reliability Evaluation Scores (SRED) for DNA Microarray Data Kazuro Shimokawa, Rimantas Kodzius, Yonehiro Matsumura, and Yoshihide Hayashizaki This protocol was adapted from
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationTechnical Instructions for Spotting Microarrays
Technical Instructions for Spotting Microarrays PRODUCT is a special low fluorescence glass slide in the standard size of 75.6 mm x 25.0 mm x 1.0 mm. The aldehyde surface coating allows efficient covalent
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
More informationMicroarrays: since we use probes we obviously must know the sequences we are looking at!
These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationOutline. Array platform considerations: Comparison between the technologies available in microarrays
Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of
More informationMicroarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6
Slide Selection Chart... J2 Epoxide-coated Slides... J3 UltraGAPS -coated Slides... J4 GAPS II-coated Slides... J5 Corning Cover Glass... J6 384-well Printing Plates... J6 Slide Mailers/Storage Boxes...
More informationMultiplex PCR. Bruce Applegate, Michael Kane and Sergei Savikhin. Analysis of multiplex PCR reactions. Detect multiple target DNA sequences
Improved Detection Techniques for Food Borne Pathogens Use of Multi-Plex Detection Platforms Bruce Applegate, Michael Kane and Sergei Savikhin Multiplex PCR Detect multiple target DNA sequences Multiple
More informationContents. 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA Introduction Principle...
Contents 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA... 1 Introduction... 1 Principle... 1 Reagents Required and Their Role... 2 Procedure... 3 Observation... 4 Result
More informationInstruction Manual for DNA-Microarrays
Instruction Manual for DNA-Microarrays 3-D Amino Surface Last update: 2004-12 page 1 Table of contents I. Introduction...3 II. Product description...4 A. Greiner Bio-One HTA Slides...4 B: SCIENION Buffer
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationWhat is a microarray
DNA Microarrays What is a microarray A surface on which sequences from thousands of different genes are covalently attached to fixed locations (probes). Glass slides Silicon chips Utilize the selective
More informationWhat we ll do today. Types of stem cells. Do engineered ips and ES cells have. What genes are special in stem cells?
Do engineered ips and ES cells have similar molecular signatures? What we ll do today Research questions in stem cell biology Comparing expression and epigenetics in stem cells asuring gene expression
More informationTypical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides
Aminosilane coating Nexterion Slide A+ and Slide AStar Overview Type of coating Immobilization method Typical probes Ordering information Nexterion product Barcode option Item number Slides per pack Aminosilane
More informationDo engineered ips and ES cells have similar molecular signatures?
Do engineered ips and ES cells have similar molecular signatures? Comparing expression and epigenetics in stem cells George Bell, Ph.D. Bioinformatics and Research Computing 2012 Spring Lecture Series
More informationMicroarray Technique. Some background. M. Nath
Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique
More informationProtocol. Nexterion Slide A+ MPX 16. DNA-application
Seite: 1/12 1 Introduction...2 2 Storage and handling...3 3 General precautions...3 4 Reagents required...3 5 Equipment required...4 6 Array printing...4 7 Printing guidelines...5 8 DNA immobilization...6
More informationMicroarray Protocols (October, 2000) Developed by the DeRisi Lab, UCSF. Modified by the Kapur Lab, U of MN
Microarray Protocols (October, 2000) Developed by the DeRisi Lab, UCSF Modified by the Kapur Lab, U of MN Introduction Microarray technology has been developing rapidly over the last several years. The
More informationAmerican Society of Cytopathology Core Curriculum in Molecular Biology
American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Separation and Detection, Part
More informationRIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP)
Application Note: RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP) Introduction: Innovations in DNA sequencing during the 21st century have revolutionized our ability to obtain nucleotide information
More informationUsing Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application
Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,
More informationGene Expression on the Fluidigm BioMark HD
Gene Expression on the Fluidigm BioMark HD Overview Introduction to Fluidigm James Miller Advantages of the technology Running a Fluidigm gene expression project Paul Lacaze Assay design, chemistry, experimental
More informationProteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer.
Proteomics And Cancer Biomarker Discovery Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar Overview Proteomics Cancer Aims Tools Data Base search Challenges Summary 1 Overview
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationExpression Array System
Integrated Science for Gene Expression Applied Biosystems Expression Array System Expression Array System SEE MORE GENES The most complete, most sensitive system for whole genome expression analysis. The
More informationAldehyde Arraying Slides High quality slides designed for array production
Protocol Aldehyde Arraying Slides High quality slides designed for array production Control #: 03PCT1001.A0 Effective Date: 01-Jul-11 ECO #: 4002 Content Page Introduction 3 Technical Information 3 Protocol
More informationSpotted DNA Array Design. Todd Lowe Bio 210 Jan 13 & 15, 2003
Spotted DNA Array Design Todd Lowe Bio 210 Jan 13 & 15, 2003 Making Your Own Array For Affymetrix-style GeneChips, most labs will use commercially available arrays, so no array design considerations Spotted
More information3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome
Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts
More informationTHE INSTITUTE FOR GENOMIC RESEARCH Standard Operating Procedure SOP #: M004 REVISION LEVEL:.3 EFFECTIVE DATE: 9/16/03
Standard Operating Procedure PAGE: 1 of 8 SOP #: M004 REVISION LEVEL:.3 EFFECTIVE DATE: 9/16/03 AUTHOR: Jeremy Hasseman PRIMARY REVIEWERS: Renee Gaspard, Bryan Frank 1. PURPOSE This protocol describes
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationBENG 183 Trey Ideker. Genome Assembly and Physical Mapping
BENG 183 Trey Ideker Genome Assembly and Physical Mapping Reasons for sequencing Complete genome sequencing!!! Resequencing (Confirmatory) E.g., short regions containing single nucleotide polymorphisms
More informationFatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
More informationApplications and Uses. (adapted from Roche RealTime PCR Application Manual)
What Can You Do With qpcr? Applications and Uses (adapted from Roche RealTime PCR Application Manual) What is qpcr? Real time PCR also known as quantitative PCR (qpcr) measures PCR amplification as it
More information6. GENE EXPRESSION ANALYSIS MICROARRAYS
6. GENE EXPRESSION ANALYSIS MICROARRAYS BIOINFORMATICS COURSE MTAT.03.239 16.10.2013 GENE EXPRESSION ANALYSIS MICROARRAYS Slides adapted from Konstantin Tretyakov s 2011/2012 and Priit Adlers 2010/2011
More informationChapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
More informationSame TaqMan Assay quality, new format
Product Bulletin TaqMan Array Plates TaqMan Array Plates TaqMan Gene Expression Assays delivered in ready-to-use 96-well Custom Array Plates or predefined Gene Signature Plates Flexible choose from customizable
More informationQuantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract
Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer Application Note Odilo Mueller Abstract This application note describes how the Agilent Technologies 2100 bioanalyzer can be used
More informationGenomes summary. Bacterial genome sizes
Genomes summary 1. >930 bacterial genomes sequenced. 2. Circular. Genes densely packed. 3. 2-10 Mbases, 470-7,000 genes 4. Genomes of >200 eukaryotes (45 higher ) sequenced. 5. Linear chromosomes 6. On
More informationDNA Workflow. Marine Biological Laboratory. Mark Bratz Applications Scientist, Promega Corporation. August 2016
DNA Workflow Marine Biological Laboratory Mark Bratz Applications Scientist, August 2016 Scientific Applications Support Mission Realize customer driven applications of Promega technologies to enhance
More informationincluding, but not limited to:
*This Section is part of the original Request for Proposal # P08 080. The Contractor should provide the following eligible Scientific Biomedical Research Equipment, Reagents & Supplies including, but not
More informationBioinformatics III Structural Bioinformatics and Genome Analysis. PART II: Genome Analysis. Chapter 7. DNA Microarrays
Bioinformatics III Structural Bioinformatics and Genome Analysis PART II: Genome Analysis Chapter 7. DNA Microarrays 7.1 Motivation 7.2 DNA Microarray History and current states 7.3 DNA Microarray Techniques
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationFunctional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017
Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene
More informationQuantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit
Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to
More informationLeonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
More informationHigh-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours
High-Resolution Oligonucleotide- Based acgh Analysis of Single Cells in Under 24 Hours Application Note Authors Paula Costa and Anniek De Witte Agilent Technologies, Inc. Santa Clara, CA USA Abstract As
More informationAdaptation of Ralstonia solanacearum biovar 2 to temperate climates Stevens, Patricia
University of Groningen Adaptation of Ralstonia solanacearum biovar 2 to temperate climates Stevens, Patricia IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you
More informationChapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationConstruction of plant complementation vector and generation of transgenic plants
MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationMICROARRAYTechnologies
High-Throughput Array Production Using Precision Glass Syringes BioTechniques 32:1360-1365 (June 2002) J. Shieh, C. To, J. Carramao, N. Nishimura 1, Y. Maruta 2, Y. Hashimoto 1, D. Wright, H.-c. Wu, and
More informationQuality Measures for CytoChip Microarrays
Quality Measures for CytoChip Microarrays How to evaluate CytoChip Oligo data quality in BlueFuse Multi software. Data quality is one of the most important aspects of any microarray experiment. This technical
More informationAgilent s Mx3000P and Mx3005P
Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded
More informationSystematic Analysis of single cells by PCR
Systematic Analysis of single cells by PCR Wolfgang Mann 27th March 2007, Weihenstephan Overview AmpliGrid Technology Examples DNA Forensics Single Cell Sequencing Polar Body Diagnostics Single Cell RT
More informationmeasuring gene expression December 5, 2017
measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationData Sheet. GeneChip Human Genome U133 Arrays
GeneChip Human Genome Arrays AFFYMETRIX PRODUCT FAMILY > ARRAYS > Data Sheet GeneChip Human Genome U133 Arrays The Most Comprehensive Coverage of the Human Genome in Two Flexible Formats: Single-array
More informationMassARRAY System MASSARRAY SYSTEM ACCELERATING RESEARCH
SENSITIVITY ACCELERATING RESEARCH SPEED SPECIFICITY ACCURACY No compromise MASSARRAY SYSTEM Genotyping Somatic mutation profiling Methylation analysis Quantitative gene expression and copy number variant
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationCOMPUTATIONAL ANALYSIS OF MICROARRAY DATA
COMPUTATIONAL ANALYSIS OF MICROARRAY DATA John Quackenbush Microarray experiments are providing unprecedented quantities of genome-wide data on gene-expression patterns. Although this technique has been
More informationImportance of replication in microarray gene expression studies: Statistical methods and evidence from repetitive cdna hybridizations
Importance of replication in microarray gene expression studies: Statistical methods and evidence from repetitive cdna hybridizations Mei-Ling Ting Lee*, Frank C. Kuo, G. A. Whitmore, and Jeffrey Sklar
More informationBiotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
More informationIntroduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
More informationStudent Learning Outcomes (SLOS)
Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get
More informationMolecular Analysis of Genes and Gene Products. BIT 220 Chapter 22
Molecular Analysis of Genes and Gene Products BIT 220 Chapter 22 Credit: Courtesy Susan Lanzendorf, Ph.D., Jones Institute for Reproductive Medicine/Eastern Virginia Medical School 2003 John Wiley and
More informationClass Information. Introduction to Genome Biology and Microarray Technology. Biostatistics Rafael A. Irizarry. Lecture 1
This work is licensed under a Creative Commons ttribution-noncommercial-sharelike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
More informationPerformance comparison of one-color and two-color platforms within the MicroArray Quality Control (MAQC) project
Nature Publishing Group http://www.nature.com/naturebiotechnology Performance comparison of one-color and two-color platforms within the MicroArray Quality Control (MAQC) project Tucker A Patterson 1,
More informationIntroduction To Real-Time Quantitative PCR (qpcr)
Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular
More informationAMPURE PCR PURIFICATION PAGE 1 OF 7
PCR PURIFICATION PAGE 1 OF 7 Please refer to http://www.agencourt.com/technical/reagent_information/ for updated protocols. AMPure is a registered trademark of Agencourt Bioscience and is for laboratory
More informationMICROARRAY HYBRIDISATION PROTOCOL 10/05 (for both PCR and Oligo arrays on UltraGAPS slides)
MICROARRAY HYBRIDISATION PROTOCOL 10/05 (for both PCR and Oligo arrays on UltraGAPS slides) Vassilis Mersinias, Giselda Bucca and Graham Hotchkiss Quick Protocol (see notes at end for detailed instructions)
More informationGetting high-quality cytogenetic data is a SNP.
Getting high-quality cytogenetic data is a SNP. SNP data. Increased insight. Cytogenetics is at the forefront of the study of cancer and congenital disorders. And we put you at the forefront of cytogenetics.
More informationProtocol. Nexterion Slide E MPX 16. Protein-application
Seite: 1/8 1 Introduction... 2 2 Storage and handling... 3 3 General precautions... 3 4 Reagents required... 3 5 Equipment required... 3 6 Array printing... 4 7 Printing guidelines... 4 8 Protein immobilization...
More informationBiology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.
Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After
More informationReal-Time PCR Workshop Gene Expression. Applications Absolute and Relative Quantitation
Real-Time PCR Workshop Gene Expression Applications Absolute and Relative Quantitation Absolute Quantitation Easy to understand the data, difficult to develop/qualify the standards Relative Quantitation
More informationMicroarray Gene Expression Analysis at CNIO
Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationQuantitative Real Time PCR USING SYBR GREEN
Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to
More informationAll your genetic analyses on a single instrument
GENOMELAB GEXP GENETIC ANALYSIS SYSTEM All your genetic analyses on a single instrument GENOMELAB GEXP GENETIC ANALYSIS SYSTEM All on a single instrument Perform your genetic assays on one instrument A
More informationA comparative study of protein arrays immobilized on different substrates
A comparative study of protein arrays immobilized on different substrates Zu Ming Tang, Qian Mei, Chun Xiu Zhang, Yi Zhu, Zu Hong Lu Presented at the 8th International Conference on Electronic Materials
More informationReverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques
More informationCancer Genetics Solutions
Cancer Genetics Solutions Cancer Genetics Solutions Pushing the Boundaries in Cancer Genetics Cancer is a formidable foe that presents significant challenges. The complexity of this disease can be daunting
More informationHigh-throughput profiling, confirmation, and screening in a mid-density format. The QuantStudio 12K Flex Real-Time PCR System
PRODUCT BULLETIN OpenArray technology on the QuantStudio 12K Flex system OpenArray technology on the QuantStudio 12K Flex Real-Time PCR System High-throughput profiling, confirmation, and screening in
More informationIn The Name of GOD. HLA Typing. By: M. Farzanehkhah NoAvaran MAYA Teb Co.
In The Name of GOD HLA Typing 21.04.2016 By: M. Farzanehkhah NoAvaran MAYA Teb Co. Haplotypes: An HLA haplotype is a series of HLA genes (loci alleles) by chromosome, one passed from mother and one from
More informationGene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays
Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Application Note Authors Bahram Arezi, Nilanjan Guha and Anne Bergstrom Lucas Agilent Technologies Inc. Santa
More informationLATE-PCR. Linear-After-The-Exponential
LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,
More informationBiosensors, Bugs, and Biodefense
Biosensors, Bugs, and Biodefense Daniel V. Lim, Ph.D. Distinguished University Professor Division of Cell Biology, Microbiology, and Molecular Biology Department of Biology and Center for Biological Defense
More informationAdvances in analytical biochemistry and systems biology: Proteomics
Advances in analytical biochemistry and systems biology: Proteomics Brett Boghigian Department of Chemical & Biological Engineering Tufts University July 29, 2005 Proteomics The basics History Current
More information