Supplemental Information. Inflammatory Ly6C high Monocytes Protect. against Candidiasis through IL-15-Driven. NK Cell/Neutrophil Activation

Size: px
Start display at page:

Download "Supplemental Information. Inflammatory Ly6C high Monocytes Protect. against Candidiasis through IL-15-Driven. NK Cell/Neutrophil Activation"

Transcription

1 Immunity, Volume 46 Supplemental Information Inflammatory Ly6C high Monocytes Protect against Candidiasis through IL-15-Driven NK Cell/Neutrophil Activation Jorge Domínguez-Andrés, Lidia Feo-Lucas, María Minguito de la Escalera, Leticia González, María López-Bravo, and Carlos Ardavín

2 !"#$%&,-./ '()*+,-0234,-2534, "78%9+34:&;<,-0 :&;,,-;. :&;,?? =>,?? :&;, C" 4 E*$*9&)%D MK/L "FE*-,D 5K.L E*-,D 0KNL A%D"#%$)4=HD.5K@L???,-.21 =>,?? 9-,D.K5L :&;, 8*G 4 DB8%%$,-;. A%D"#%$)4=HD 5KOL,-0,-0 $%()A*BC"8D 0K0L :&;,,-;. :&;,? =>,?? :&;, C" 4 E*$*9&)%D 5K;L "FE*-,D 5K0L E*-,D 5K0L?? 9-,D 0KML??? :&;, 8*G 4 E*$*9&)%D 5K@L,-.21 =>,??,-0,-0234,-2534, "78%9+34:&;<,-@,-009,-009 Figure S1. Characterization by flow cytometry of DC, monocyte, MØ, NK cell and neutrophil subsets in the kidney and spleen of C57BL/6 mice. Related to Figures 1 and 2.

3 A B WT C D Ccr2- /- Figure S2. Histopathology of the C. albicans-infected kidneys of WT and Ccr2-/mice. Related to Figure 3. (A) Representative PAS-stained histological section from a paraffin-embedded WT mouse kidney at 48 hours after C. albicans infection. (B) High-magnification of the area marked by a blue square in (A). (C) Representative PAS-stained histological section from a paraffin-embedded Ccr2-/- mouse kidney at 48 hours after C. albicans infection. (D) High-magnification of the area marked by a blue square in (C). Scale bars: 500 µm (A and C), 100 µm (B and D).

4 * 5 +,", -.'/.0'/ +,", -.'/.0'/ +,", -.'/.0'/ -3 -)3.3!(12* )3 4%5!(12* Figure S3. Analysis of kidney NK cell activation after systemic C. albicans infection. Related to Figure 3. (A-B) IFNγ and Granzyme B (GrB) production by kidney NK cells analyzed by flow cytometry after intracellular staining in WT (A) and Ccr2 -/- (B) mice at the indicated times after C. albicans infection. Data are expressed as mean ± SEM of four mice per condition. ***p<0.0; unpaired t test. Red asterisks indicate the statistical significance of the differences observed between WT and Ccr2 -/- mice. Similar results were obtained in 3 independent experiments.

5 Figure S4. Fungal burden in the kidney and spleen after systemic C. albicans infection. Related to Figure 4. Kidney and spleen fungal burden of C57BL/6 at the indicated times after C. albicans infection. Data are expressed as mean ± SEM of four mice per condition. *p<0.05; **p<0.; ***p<0.0; unpaired t test. Similar results were obtained in 2 independent experiments.

6 2 4567(!'+&8&+. '.:+&&;'7<==* > '?&++. > '?&++. *+,,-'.&%$/ "#$% &'& 3 ()*+'&9:%&..",; 7,-./0/-!@"++";# '.:+&&;'7<==* > '?&++. '@"-;&A'7<B) > '?&++. ';&$G%,:H"+. "#$% &'& "#$% &'& < C"-;&A'D$;#E+'+,E- F ($%8"8E+!,-./0/-!@"++";# '/,;,?AG&. "#$% &'& "#$% &'& Figure S5. Effect of IL-15 deficiency in defense against C. albicans infection. Related to Figure 4. (A) GM-CSF analyzed by real-time PCR normalized to β-actin in CD11b + spleen cells and CD45 + kidney infiltrating leukocytes, and by ELISA in blood serum, from WT and Il15 -/- mice at the indicated times. Real-time PCR data are expressed as fold induction relative to uninfected mice. (B) Expression of mrna for inos by CD11b + spleen cells and CD45 + kidney infiltrating leukocytes from WT and Il15 -/- mice analyzed by real-time PCR, normalized to β-actin, at the indicated times. Real-time PCR data are expressed as fold induction relative to uninfected mice. (C) Candidacidal activity of blood neutrophils from WT and Il15 -/- mice. (D) Kidney fungal burden of WT mice and Il15 -/- mice at 72 h post-infection. (E) Survival of WT mice and Il15 -/- mice post-infection. n=12. (F) Candidacidal activity of bone marrow Ly6C high monocytes from WT and Il15 -/- mice. Data are expressed as mean ± SEM of 4 mice per condition. *p<0.05; **p<0.; ***p<0.0; unpaired t test. Similar results were obtained in 2 independent experiments. ELISA data for non-infected mice were below the detection level of the ELISA kit (63 pg/ml). n.i., non-infected; n.d., not detectable.

7 4 67-2(''% )*+* $,-. +%/&(-2/)03/' +%/&(-2/)03/' %&'(() 5 )(803/&.+'% )*+* $,-. +%/&(-2/)03/' +%/&(-2/)03/' %&'(() Figure S6. CD122 expression by spleen NK cells and neutrophils. Related to Figure 5. CD122 expression by spleen NK cells and neutrophils of non-infected C57BL/6 mice and C57BL/6 mice 24 hr after infection. Data are expressed as mean fluorescence intensity (MFI) ± SEM of four mice per condition. ***p<0.0; unpaired t test.

8 * -./0) -./0) 1 +, +,!"#$%& '(' )*+, '(' Figure S7. Dectin-1 and IRF5 deficiency are related with an impaired IL-15 expression. Related to Figure 6. (A and B) Expression of mrna for IL-15 by BMDCs from WT and Clec7a -/- (A) or Irf5 -/- (B) mice analyzed by real-time PCR, normalized to β-actin, 6 hours after stimulation with HKC, Curdlan or LPS. Data are expressed as fold induction relative to unstimulated cells. Data represent mean ± SEM of four independent BMDC cultures per condition. *p<0.05; **p<0.; ***p<0.0; unpaired t test. Similar results were obtained in 2 independent experiments.

9 Table S1. Primers for Real-Time PCR. Related to the STAR Methods section. Gene Primer Sequence 5-3 Il2 Il12A Il12B Il15 Il18 Il23A Csf2 Nos2 b-actin Il2-for CAAGCAGGCCACAGAATTGA Il2-rev CCGCAGAGGTCCAAGTTCA Il12A-for CCACCCTTGCCCTCCTAAA Il12A-rev GGCAGCTCCCTCTTGTTGTG Il12B-for GGAAGCACGGCAGCAGAATA Il12B-rev AACTTGAGGGAGAAGTAGGAATGG Il15-for CATCCATCTCGTGCTACTTGTGTT Il15-rev CATCTATCCAGTTGGCCTCTGT Il18-for CAGGCCTGACATCTTCTGCAA Il18-rev CTGACATGGCAGCCATTGT Il23A-for GCTGTGCCTAGGAGTAGCAG Il23A-rev CACTGGATACGGGGCACATT Csf2-for GGTCCTGAGGAGGATGTG Csf2-rev GAGGTTCAGGGCTTCTTTGA Nos2-for CAGCTGGGCTGTACAAACCTT Nos2-rev CATTGGAAGTGAAGCGTTTCG b-actin-for GGCTGTATTCCCCTCCATCG b-actin-rev CCAGTTGGTAACAATGCCATGT

Supplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence

Supplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence 1 5 6 7 8 9 10 11 1 1 1 Supplementary Figure 1. Characterization of the POP transcriptional and post-transcriptional regulatory elements. (A) POP nucleotide sequence depicting the consensus sequence for

More information

Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating

Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating Supplemental Figure Legend: Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating strategy for mouse MDSC. CD11b + Ly6C high Ly6G - cells are defined as M-MDSC. CD11b + Ly6C low

More information

Mayumi Egawa, Kaori Mukai, Soichiro Yoshikawa, Misako Iki, Naofumi Mukaida, Yohei Kawano, Yoshiyuki Minegishi, and Hajime Karasuyama

Mayumi Egawa, Kaori Mukai, Soichiro Yoshikawa, Misako Iki, Naofumi Mukaida, Yohei Kawano, Yoshiyuki Minegishi, and Hajime Karasuyama Immunity, Volume 38 Supplemental Information Inflammatory Monocytes Recruited to Allergic Skin Acquire an Anti-inflammatory M2 Phenotype via Basophil-Derived Interleukin-4 Mayumi Egawa, Kaori Mukai, Soichiro

More information

Flowcytometry-based purity analysis of peritoneal macrophage culture.

Flowcytometry-based purity analysis of peritoneal macrophage culture. Liao et al., KLF4 regulates macrophage polarization Revision of Manuscript 45444-RG- Supplementary Figure Legends Figure S Flowcytometry-based purity analysis of peritoneal macrophage culture. Thioglycollate

More information

DC enriched CD103. CD11b. CD11c. Spleen. DC enriched. CD11c. DC enriched. CD11c MLN

DC enriched CD103. CD11b. CD11c. Spleen. DC enriched. CD11c. DC enriched. CD11c MLN CD CD11 + CD + CD11 d g CD CD11 + CD + CD11 CD + CD11 + Events (% of max) Events (% of max) CD + CD11 Events (% of max) Spleen CLN MLN Irf fl/fl e Irf fl/fl h Irf fl/fl DC enriched CD CD11 Spleen DC enriched

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 PPAR-γ is dispensable for the development of tissue macrophages in the heart, kidneys, lamina propria and white adipose tissue. Plots show the expression of F4/80 and CD11b (a) or

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11809 Supplementary Figure 1. Antibiotic treatment reduces intestinal bacterial load and allows access of non-pathogenic bacteria to the MLN, inducing intestinal

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.

Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting. Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice

More information

Supplementary Figure 1. Xbp1 deficiency does not alter hematopoietic cellularity.

Supplementary Figure 1. Xbp1 deficiency does not alter hematopoietic cellularity. Supplementary Figure 1 Xbp1 deficiency does not alter hematopoietic cellularity. Absolute number of leukocytes obtained from bone marrow (BM, 2 tibias and 2 femurs per mouse) of Xbp1 f/f and Xbp1 Vav1

More information

Strategies for Assessment of Immunotoxicology in Preclinical Drug Development

Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Rebecca Brunette, PhD Scientist, Analytical Biology SNBL USA Preclinical Immunotoxicology The study of evaluating adverse effects

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementary Figure S1 Supplementary Figure S1. CD11b expression on different B cell subsets in anti-snrnp Ig Tg mice. (a) Highly purified follicular (FO) and marginal zone (MZ) B cells were sorted from

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Microarray Data Analysis Gene expression data were obtained by hybridising a total of 24 samples from 6 experimental groups (n=4 per group) to Illumina HumanHT-12 Expression BeadChips.

More information

Table S1. Nucleotide sequences of synthesized oligonucleotides for quantitative

Table S1. Nucleotide sequences of synthesized oligonucleotides for quantitative Table S1. Nucleotide sequences of synthesized oligonucleotides for quantitative RT-PCR For CD8-1 transcript, forward primer CD8-1F 5 -TAGTAACCAGAGGCCGCAAGA-3 reverse primer CD8-1R 5 -TCTACTAAGGTGTCCCATAGCATGAT-3

More information

Supplementary Fig S1: Bone marrow macrophages and liver Kupffer cells increase IL-1 in response to adenosine signaling. (a) Murine bone marrow

Supplementary Fig S1: Bone marrow macrophages and liver Kupffer cells increase IL-1 in response to adenosine signaling. (a) Murine bone marrow Supplementary Fig S1: Bone marrow macrophages and liver Kupffer cells increase IL-1 in response to adenosine signaling. (a) Murine bone marrow derived macrophages (BMDM) were primed with LPS for 16 hrs,

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/4/9/eaat5401/dc1 Supplementary Materials for GLK-IKKβ signaling induces dimerization and translocation of the AhR-RORγt complex in IL-17A induction and autoimmune

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Overexpression of Ym1 reduces eosinophil numbers in the lungs.

Nature Immunology: doi: /ni Supplementary Figure 1. Overexpression of Ym1 reduces eosinophil numbers in the lungs. Supplementary Figure 1 Overexpression of Ym1 reduces eosinophil numbers in the lungs. (a-d) Absolute numbers per mg of tissue of CD8 + T cells (a), CD4 + T cells (b), CD19 + CD11b - B cells (c) and SigF

More information

Nature Biotechnology: doi: /nbt.4086

Nature Biotechnology: doi: /nbt.4086 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3

More information

Figure S1: GM-CSF upregulates CCL17 expression in in vitro-derived and ex vivo murine macrophage populations

Figure S1: GM-CSF upregulates CCL17 expression in in vitro-derived and ex vivo murine macrophage populations Figure S1 A B C Figure S1: GM-CSF upregulates CCL17 expression in in vitro-derived and ex vivo murine macrophage populations (A-B) Murine bone cells were cultured in either M-CSF (5,000 U/ml) or GM-CSF

More information

Distribution of human ILCs during chronic lung disease.

Distribution of human ILCs during chronic lung disease. Supplementary Figure 1 Distribution of human ILCs during chronic lung disease. Quantification of flow cytometric analysis of lung tissue from patients with COPD or IPF identifying (a) frequencies of total

More information

Table S1. Oligonucleotide primer sequences

Table S1. Oligonucleotide primer sequences Table S1. Oligonucleotide primer sequences Primer Name DNA Sequence (5 -> 3 ) Description CD19c CD19d Cre7 Sfpi1lox1 Sfpi1lox2 Sfpi1lox3 5 -AACCAGTCAACACCCTTCC-3 5 -CCAGACTAGATACAGACCAG-3 5 -TCAGCTACACCAGAGACGG-3

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Figure 1 A IL-12p7 (pg/ml) 7 6 4 3 2 1 Medium then TLR ligands MDP then TLR ligands Medium then TLR ligands + MDP MDP then TLR ligands + MDP B IL-12p4 (ng/ml) 1.2 1..8.6.4.2. Medium MDP Medium

More information

Interferon- -producing immature myeloid cells confer protection. against severe invasive group A Streptococcus infections. Supplementary Information

Interferon- -producing immature myeloid cells confer protection. against severe invasive group A Streptococcus infections. Supplementary Information Supplementary Information Interferon- -producing immature myeloid cells confer protection against severe invasive group A Streptococcus infections Takayuki Matsumura, Manabu Ato, Tadayoshi Ikebe, Makoto

More information

B Vehicle 1V270 (35 μg) 1V270 (100 μg) Days post tumor implantation. Vehicle 100μg 1V270 biweekly 100μg 1V270 daily

B Vehicle 1V270 (35 μg) 1V270 (100 μg) Days post tumor implantation. Vehicle 100μg 1V270 biweekly 100μg 1V270 daily Supplemental Figure 1 A 1 1V7 (8 μg) 1 1V7 (16 μg) 8 6 4 B 1 1 8 6 4 1V7 (35 μg) 1V7 (1 μg) 5 1 15 5 1 15 C Biweekly 8 11 14 17 Days Implant SCC7 cells Daily 8 9 1 11 1 Implant SCC7 cells 1V7 i.t. treatment

More information

STING-Dependent Cytosolic DNA Sensing Promotes Radiation-Induced Type I Interferon-Dependent Antitumor Immunity in Immunogenic Tumors

STING-Dependent Cytosolic DNA Sensing Promotes Radiation-Induced Type I Interferon-Dependent Antitumor Immunity in Immunogenic Tumors Immunity, Volume 41 Supplemental Information STING-Dependent Cytosolic DNA Sensing Promotes Radiation-Induced Type I Interferon-Dependent Antitumor Immunity in Immunogenic Tumors Liufu Deng, Hua Liang,

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact

More information

LRBA is Essential for Allogeneic Responses in Bone Marrow Transplantation

LRBA is Essential for Allogeneic Responses in Bone Marrow Transplantation LRBA is Essential for Allogeneic Responses in Bone Marrow Transplantation Mi Young Park, 1# Raki Sudan, 1# Neetu Srivastava, 1 Sudha Neelam, 1 Christie Youngs, 1 Jia- Wang Wang, 4 Robert W. Engelman, 5,6,7

More information

Supplemental Table S1. RT-PCR primers used in this study

Supplemental Table S1. RT-PCR primers used in this study Supplemental Table S1. RT-PCR primers used in this study -----------------------------------------------------------------------------------------------------------------------------------------------

More information

a Lamtor1 (gene) b Lamtor1 (mrna) c WT Lamtor1 Lamtor1 flox Lamtor2 A.U. p = LysM-Cre Lamtor3 Lamtor4 Lamtor5 BMDMs: Φ WT Φ KO β-actin WT BMDMs

a Lamtor1 (gene) b Lamtor1 (mrna) c WT Lamtor1 Lamtor1 flox Lamtor2 A.U. p = LysM-Cre Lamtor3 Lamtor4 Lamtor5 BMDMs: Φ WT Φ KO β-actin WT BMDMs a Lamtor (gene) b Lamtor (mrna) c BMDMs: Φ WT Φ KO Lamtor flox 8 bp LysM-Cre 93 bp..5 p =.4 WT BMDMs: Φ WT Φ KO Lamtor (protein) BMDMs: Φ WT Φ KO Lamtor 8 kda Lamtor 4 kda Lamtor3 4 kda Lamtor4 kda Lamtor5.5

More information

isolated from ctr and pictreated mice. Activation of effector CD4 +

isolated from ctr and pictreated mice. Activation of effector CD4 + Supplementary Figure 1 Bystander inflammation conditioned T reg cells have normal functional suppressive activity and ex vivo phenotype. WT Balb/c mice were treated with polyi:c (pic) or PBS (ctr) via

More information

The RT-qPCR analysis of selected type-i IFNs related genes, IRF7 and Oas3. The

The RT-qPCR analysis of selected type-i IFNs related genes, IRF7 and Oas3. The SUPPLEMENTARY MATERIALS AND METHODS Real time quantitative PCR The RT-qPCR analysis of selected type-i IFNs related genes, IRF7 and Oas3. The RT-qPCR was performed on the Applied Biosystems StepOne TM

More information

A group A Streptococcus ADP-ribosyltransferase toxin stimulates a protective IL-1β-dependent macrophage immune response

A group A Streptococcus ADP-ribosyltransferase toxin stimulates a protective IL-1β-dependent macrophage immune response A group A Streptococcus ADP-ribosyltransferase toxin stimulates a protective IL-1β-dependent macrophage immune response Ann E. Lin, Federico C. Beasley, Nadia Keller, Andrew Hollands, Rodolfo Urbano, Emily

More information

Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM

Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM of Cx3cr1 GFP/+ mice related to Fig. 1a. MDP was defined

More information

Supplemental Information. Obesity and Insulin Resistance Promote. Atherosclerosis through an IFNg-Regulated. Macrophage Protein Network

Supplemental Information. Obesity and Insulin Resistance Promote. Atherosclerosis through an IFNg-Regulated. Macrophage Protein Network Cell Reports, Volume 23 Supplemental Information Obesity and Insulin Resistance Promote Atherosclerosis through an IFNg-Regulated Macrophage Protein Network Catherine A. Reardon, Amulya Lingaraju, Kelly

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Time course of OT-II T reg cell development in thymic slices.

Nature Immunology: doi: /ni Supplementary Figure 1. Time course of OT-II T reg cell development in thymic slices. Supplementary Figure 1 Time course of OT-II T reg cell development in thymic slices. Time course of T reg cell development following addition of OT-II TCR transgenic Rag2 -/- mice (OT-II) thymocytes to

More information

Autocrine Complement Inhibits IL10-Dependent T-Cell Mediated. Antitumor Immunity to Promote Tumor Progression

Autocrine Complement Inhibits IL10-Dependent T-Cell Mediated. Antitumor Immunity to Promote Tumor Progression Supplemental Information Autocrine Complement Inhibits IL10-Dependent T-Cell Mediated Antitumor Immunity to Promote Tumor Progression Yu Wang, Sheng-Nan Sun, Qing Liu, Yang-Yang Yu, Jian Guo, Kun Wang,

More information

Anti-ERK1/2, anti-p-erk1/2, anti-p38 anti-p-msk1 (Thr581) and anti-p-msk2

Anti-ERK1/2, anti-p-erk1/2, anti-p38 anti-p-msk1 (Thr581) and anti-p-msk2 Supplementary methods Antibodies Anti-ERK1/2, anti-p-erk1/2, anti-p38 anti-p-msk1 (Thr581) and anti-p-msk2 polyclonal were from Cell Signalling and the anti-p-histone H3(Ser1) antibody was from Upstate.

More information

Development of NOG mice

Development of NOG mice Development of NOG mice General characteris5cs of NOG mice 1. T and B cell deficient 2. NK cell deficient 3. Reduced macrophage and dendri;c cell func;on 4. Complement ac;vity deficient 5. No incidence

More information

Supplementary information

Supplementary information Supplementary information Cooperation of Oncolytic Herpes Virotherapy and PD-1 Blockade in Murine Rhabdomyosarcoma Models Chun-Yu Chen 1, Pin-Yi Wang 1, Brian Hutzen 1, Les Sprague 3, Hayley M. Swain 1,

More information

Receptor Revision Diminishes the Autoreactive B Cell Response after Antigen. PNA Tet. Day 8. Day 16

Receptor Revision Diminishes the Autoreactive B Cell Response after Antigen. PNA Tet. Day 8. Day 16 Receptor Revision Diminishes the Autoreactive Cell Response after Antigen Activation Ying-Hua Wang and etty Diamond Supplemental data: PNA Tet 5 8 11 16 Supplemental Figure 1: Kinetic analysis of tetramer-binding

More information

BmDCs were generated as described by a modified protocol of Inaba et al S1. Briefly, bone

BmDCs were generated as described by a modified protocol of Inaba et al S1. Briefly, bone Generation and culture of bone marrow-derived dendritic cells (bmdcs) BmDCs were generated as described by a modified protocol of Inaba et al S1. Briefly, bone marrow cells from murine tibias and femurs

More information

Development of CD11b-IRF8 transgenic and MTAG double transgenic mice The CMV-

Development of CD11b-IRF8 transgenic and MTAG double transgenic mice The CMV- Supplemental Data Development of CD11b-IRF8 transgenic and MTAG double transgenic mice The CMV- IRF8 transgenic mouse was previously developed by cloning complementary DNA, containing the IRF-8 coding

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/1/494/eaak972/dc1 Supplementary Materials for Blockade of surface-bound TGF-β on regulatory T cells abrogates suppression of effector T cell function in the tumor

More information

Eight-week-old wildtype mice were kept under standard diet (SD) for 4 weeks, or fed Western

Eight-week-old wildtype mice were kept under standard diet (SD) for 4 weeks, or fed Western Supplemental information M. Itoh et al. 0 Supplemental Methods Inducible NASH model using wildtype mice Eight-week-old wildtype mice were kept under standard diet (SD) for weeks, or fed Western diet (WD)

More information

- Figure S1 (related to Fig. 1): Phenotype of CD1d-/- mice and IL-17 secretion by

- Figure S1 (related to Fig. 1): Phenotype of CD1d-/- mice and IL-17 secretion by Cell Host & Microbe, Volume 10 Supplemental Information Innate Recognition of Cell Wall β-glucans Drives Invariant Natural Killer T Cell Responses against Fungi Nadia R. Cohen, Raju V.V. Tatituri, Amariliz

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION ARTICLE NUMBER: 16108 DOI: 10.1038/NMICROBIOL.2016.108 The binary toxin CDT enhances Clostridium difficile virulence by suppressing protective colonic eosinophilia Carrie A. Cowardin,

More information

TRIM31 is recruited to mitochondria after infection with SeV.

TRIM31 is recruited to mitochondria after infection with SeV. Supplementary Figure 1 TRIM31 is recruited to mitochondria after infection with SeV. (a) Confocal microscopy of TRIM31-GFP transfected into HEK293T cells for 24 h followed with SeV infection for 6 h. MitoTracker

More information

Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells. in the injured sites

Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells. in the injured sites Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells in the injured sites Yunyuan Li, Reza Baradar Jalili, Aziz Ghahary Department of Surgery, University of British Columbia,

More information

Supplementary Material & Methods

Supplementary Material & Methods Supplementary Material & Methods Affymetrix micro-array Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, USA). RNA concentration and quality was determined using the ND-1000 spectrophotometer

More information

Supplementary Information

Supplementary Information Supplementary Information Mutual reinforcement of inflammation and carcinogenesis by the Helicobacter pylori CagA oncoprotein Nobumi Suzuki, Naoko Murata-Kamiya, Kohei Yanagiya, Wataru Suda, Masahira Hattori,

More information

Methods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis

Methods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis Methods Western blot analysis of plg Wild-type mice first received a standardized burn wound and then were intravenously administered 2 mg of human plg (Omnio AB, Umeå, Sweden). 24 hours after wounding

More information

Supplementary Fig. 1: Characterization of Asxl2 -/- mouse model. (a) HSCs and their

Supplementary Fig. 1: Characterization of Asxl2 -/- mouse model. (a) HSCs and their Supplementary Fig. 1: Characterization of Asxl2 -/- mouse model. (a) HSCs and their differentiated cell populations were sorted from the BM of WT mice using respective surface markers, and Asxl2 mrna expression

More information

Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in

Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in mouse NOD/SCID/Jak3 null mice were transplanted with human CD34 + hematopoietic stem cells. (Top) Four weeks after the transplantation

More information

TIB6 B16F1 LLC EL4. n=2 n=7 n=9 n=6

TIB6 B16F1 LLC EL4. n=2 n=7 n=9 n=6 Shojaei et al., Supplemental Fig. 1 9 Mean Inhibition by anti-vegf (%) 7 5 3 1 TIB6 n=2 n=7 n=9 n=6 Supplemental Figure 1 Differential growth inhibition by anti-vegf treatment. The percent of tumor growth

More information

Nature Immunology: doi: /ni.3694

Nature Immunology: doi: /ni.3694 Supplementary Figure 1 Expression of Bhlhe41 and Bhlhe40 in B cell development and mature B cell subsets. (a) Scatter plot showing differential expression of genes between splenic B-1a cells and follicular

More information

The transcrip-on factor NR4A1 (Nur77) controls bone marrow differen-a-on and survival of Ly6C monocytes

The transcrip-on factor NR4A1 (Nur77) controls bone marrow differen-a-on and survival of Ly6C monocytes Supplementary Informa0on The transcrip-on factor NR4A1 (Nur77) controls bone marrow differen-a-on and survival of Ly6C monocytes Richard N. Hanna 1, Leo M. Carlin 2, Harper G. Hubbeling 3, Dominika Nackiewicz

More information

Supplementary information

Supplementary information Supplementary information Epigenetic silencing of retinoblastoma gene regulates pathologic differentiation of myeloid cells in cancer Je-In Youn, Vinit Kumar, Michelle Collazo, Yulia Nefedova, Thomas Condamine,

More information

Nature Immunology: doi: /ni.1744

Nature Immunology: doi: /ni.1744 Macrophage colony stimulating factor induces macrophage proliferation and survival through a pathway involving DAP12 and β-catenin Karel Otero, Isaiah R Turnbull, Pietro Luigi Poliani *, William Vermi

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed

More information

Figure S1- Targeting strategy for generating SIK1-T182A, SIK2-T175A and SIK3-T163A KI mice.

Figure S1- Targeting strategy for generating SIK1-T182A, SIK2-T175A and SIK3-T163A KI mice. Figure S1- Targeting strategy for generating SIK1-T12A, SIK2-T175A and SIK3-T163A mice. Left panel represents a depiction of the genomic loci of each gene, the targeting strategy and the final recombined

More information

(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower

(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that

More information

neutrophils (CD11b+, the total Statistical multiple

neutrophils (CD11b+, the total Statistical multiple Supplementary Figure 1. (A) Wild type and Vim / mice were treated with (24mg/kg LPS); lungs were harvested at 48h and enzymaticallyy digested. CD45+ cells were excluded from the total cell population and

More information

Supplementary Material. Levels of S100B protein drive the reparative process in acute muscle injury and muscular dystrophy

Supplementary Material. Levels of S100B protein drive the reparative process in acute muscle injury and muscular dystrophy Supplementary Material Levels of protein drive the reparative process in acute muscle injury and muscular dystrophy Francesca Riuzzi 1,4 *, Sara Beccafico 1,4 *, Roberta Sagheddu 1,4, Sara Chiappalupi

More information

TRAIL, Death Receptors, TRA-8, and Apoptosis

TRAIL, Death Receptors, TRA-8, and Apoptosis TRAIL, Death Receptors, TRA-8, and Apoptosis DR5 is a pro-apoptotic molecule, which can induce cell death in a variety of cells by engaging the it ligand, TRAIL or anti-dr5 antibody. TRA-8 is a monoclonal

More information

ClustalW algorithm. The alignment statistics are 96.9% for both pairwise identity and percent identical sites.

ClustalW algorithm. The alignment statistics are 96.9% for both pairwise identity and percent identical sites. Identity Human Mouse Supplemental Figure 1. Amino acid sequence alignment of -MyHC. The alignment was created using the ClustalW algorithm. The alignment statistics are 96.9% for both pairwise identity

More information

Center Drive, University of Michigan Health System, Ann Arbor, MI

Center Drive, University of Michigan Health System, Ann Arbor, MI Leukotriene B 4 -induced reduction of SOCS1 is required for murine macrophage MyD88 expression and NFκB activation Carlos H. Serezani 1,3, Casey Lewis 1, Sonia Jancar 2 and Marc Peters-Golden 1,3 1 Division

More information

Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail

Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail were stained with propidium iodide (PI), anti-cd45 (FITC),

More information

Supporting Information

Supporting Information Supporting Information Kawane et al. 10.1073/pnas.1010603107 SI Materials and Methods Mice. The DNase II / IFN-IR / and DNase II flox/ Mx1-Cre T mice were described previously (1). To delete the DNase

More information

Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1

Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 a His-ORMDL3 ~ 17 His-ORMDL3 GST-ORMDL3 - + - + IPTG GST-ORMDL3 ~ b Integrated Density (ORMDL3/ -actin) 0.4 0.3 0.2 0.1

More information

Supplemental Information. Neutrophil-Derived IL-1b Impairs the Efficacy. of NF-kB Inhibitors against Lung Cancer

Supplemental Information. Neutrophil-Derived IL-1b Impairs the Efficacy. of NF-kB Inhibitors against Lung Cancer Cell Reports, Volume 16 Supplemental Information Neutrophil-Derived IL-1b Impairs the Efficacy of NF-kB Inhibitors against Lung Cancer Allyson G. McLoed, Taylor P. Sherrill, Dong-Sheng Cheng, Wei Han,

More information

Myofibroblasts in kidney fibrosis. LeBleu et al.

Myofibroblasts in kidney fibrosis. LeBleu et al. Origin and Function of Myofibroblasts in Kidney Fibrosis Valerie S. LeBleu, Gangadhar Taduri, Joyce O Connell, Yingqi Teng, Vesselina G. Cooke, Craig Woda, Hikaru Sugimoto and Raghu Kalluri Supplementary

More information

Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2

Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2 Molecular Cell, Volume 65 Supplemental Information The TRAIL-Induced Cancer Secretome Promotes a Tumor-Supportive Immune Microenvironment via CCR2 Torsten Hartwig, Antonella Montinaro, Silvia von Karstedt,

More information

SI Appendix. Tumor-specific CD8 + Tc9 cells are superior effector than Tc1 cells for. adoptive immunotherapy of cancers

SI Appendix. Tumor-specific CD8 + Tc9 cells are superior effector than Tc1 cells for. adoptive immunotherapy of cancers SI Appendix Tumor-specific CD8 + Tc9 cells are superior effector than Tc1 cells for adoptive immunotherapy of cancers Yong Lu, Bangxing Hong, Haiyan Li, Yuhuan Zheng, Mingjun Zhang, Siqing Wang, Jianfei

More information

Tgfb1 ACTGATACGCCTGAGTGGCT CCCTGTATTCCGTCTCCTTG. Supplemental data. Supplemental Table 1: Sequences of qpcr primers

Tgfb1 ACTGATACGCCTGAGTGGCT CCCTGTATTCCGTCTCCTTG. Supplemental data. Supplemental Table 1: Sequences of qpcr primers Supplemental data Supplemental Table 1: Sequences of qpcr primers Gene Forward primer Reverse primer B2m GTGACCCTGGTCTTTCTGGT GTATGTTCGGCTTCCCATTC Ppl TTGAGACAGCAACCAGAAGC TTCAGGGTCTGGATTTCCTC Evpl TGCTTCACCACCATGTTCAA

More information

Tumor Ablation and Therapeutic Immunity Induction by an

Tumor Ablation and Therapeutic Immunity Induction by an Tumor Ablation and Therapeutic Immunity Induction by an Injectable Peptide Hydrogel Honglin Jin, 1 Chao Wan, 1 Zhenwei Zou, 1 Guifang Zhao, LingLing Zhang, Yuanyuan Geng, Tong Chen, Ai Huang, Fagang Jiang,

More information

Supplementary Fig. 5

Supplementary Fig. 5 Supplementary Fig. 5 Supplemental Figures legends Supplementary Figure 1 (A) Additional dot plots from CyTOF analysis from untreated group. (B) Gating strategy for assessment of CD11c + NK cells frequency

More information

Figure legend. The expression of BAFF and its receptors in macrophages was detected at lesion areas of atherosclerosis and arthritis.

Figure legend. The expression of BAFF and its receptors in macrophages was detected at lesion areas of atherosclerosis and arthritis. Data supplement #1 Figure legend. The expression of BAFF and its receptors in macrophages was detected at lesion areas of atherosclerosis and arthritis. A. Consecutive sections of an atherosclerotic plaque

More information

Supplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total

Supplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total Supplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total ERK in the aortic tissue from the saline- or AngII-infused

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Ex2 promotor region Cre IRES cherry pa Ex4 Ex5 Ex1 untranslated Ex3 Ex5 untranslated EYFP pa Rosa26 STOP loxp loxp Cre recombinase EYFP pa Rosa26 loxp 1 kb Interleukin-9 fate reporter

More information

IL-17 Regulates Systemic Fungal Immunity by Controlling the Functional Competence of NK Cells

IL-17 Regulates Systemic Fungal Immunity by Controlling the Functional Competence of NK Cells Immunity, Volume 40 Supplemental Information IL-17 Regulates Systemic Fungal Immunity by Controlling the Functional Competence of NK Cells Eva Bär, Paul G. Whitney, Kathrin Moor, Caetano Reis e Sousa,

More information

Supplemental Table 1 Primers used in study. Human. Mouse

Supplemental Table 1 Primers used in study. Human. Mouse Supplemental Table 1 Primers used in study Human Forward primer region(5-3 ) Reverse primer region(5-3 ) RT-PCR GAPDH gagtcaacggatttggtcgt ttgattttggagggatctcg Raftlin atgggttgcggattgaacaagttaga ctgaggtataacaccaacgaatttcaggc

More information

Supplemental Information. Commensal Fungi Recapitulate. the Protective Benefits of Intestinal Bacteria

Supplemental Information. Commensal Fungi Recapitulate. the Protective Benefits of Intestinal Bacteria Cell Host & Microbe, Volume Supplemental Information Commensal Fungi Recapitulate the Protective enefits of Intestinal acteria Tony T. Jiang, Tzu-Yu Shao, W.X. Gladys Ang, Jeremy M. Kinder, Lucien H. Turner,

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 Sox2 localizes in neutrophils of mouse spleen. (a) Microscopy analysis of Sox2 and MPO in wild-type mouse spleen. Nucl, nucleus. (b) Immunohistochemistry staining of Sox2 and MPO

More information

Supplementary Figures

Supplementary Figures Supplementary Figures 1 Supplementary Figure 1. Expression of TFF2 in splenic T cells. (a) Accumulation of CD11b + Gr-1 + cells in spleen upon 2.5% DSS treatment. The values presented as mean ±s.d. per

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.8/nature85 Supplementary Methods Plasmid construction Murine RIG-I, HMGB and Rab5 cdnas were obtained by polymerase chain reaction with reverse transcription (RT-PCR) on total RNA from, and then cloned

More information

Supplementary Methods Plasmid constructs

Supplementary Methods Plasmid constructs Supplementary Methods Plasmid constructs. Mouse cdna encoding SHP-1, amplified from mrna of RAW264.7 macrophages with primer 5'cgtgcctgcccagacaaactgt3' and 5'cggaattcagacgaatgcccagatcacttcc3', was cloned

More information

Cell death analysis using the high content bioimager BD PathwayTM 855 instrument (BD

Cell death analysis using the high content bioimager BD PathwayTM 855 instrument (BD Supplemental information Materials and Methods: Cell lines, reagents and antibodies: Wild type (A3) and caspase-8 -/- (I9.2) Jurkat cells were cultured in RPMI 164 medium (Life Technologies) supplemented

More information

Nature Medicine: doi: /nm.4169

Nature Medicine: doi: /nm.4169 Supplementary Fig.1. EC-specific deletion of Ccm3 by Cdh5-CreERT2. a. mt/mg reporter mice were bred with Cdh5CreERT2 deleter mice followed by tamoxifen feeding from P1 to P3. mg expression was specifically

More information

F4/80, CD11b, Gr-1, NK1.1, CD3, CD4, CD8 and CD19. A-antigen was detected with FITCconjugated

F4/80, CD11b, Gr-1, NK1.1, CD3, CD4, CD8 and CD19. A-antigen was detected with FITCconjugated SDC MATERIALS AND METHODS Flow Cytometric Detection of A-Antigen Expression Single cell suspensions were prepared from bone marrow, lymph node and spleen. Peripheral blood was obtained and erythrocytes

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1: Synthetic annealed poly(ra):poly(dt) hybrid induces type I interferon response. a) Bone marrow derived macrophages (BMDM) were transfected with or without

More information

To determine the effect of N1IC in the susceptibility of T cells to the tolerogenic effect of tumorassociated

To determine the effect of N1IC in the susceptibility of T cells to the tolerogenic effect of tumorassociated Supplementary Methods Tolerogenic effect of MDSC To determine the effect of N1IC in the susceptibility of T cells to the tolerogenic effect of tumorassociated MDSC in vivo, we used a model described previously

More information

Supplemental Figure 1: Podocyte specific knockdown of Klf4 in Podocin-Cre Klf4 flox/flox mice was confirmed. (A) Primary glomerular epithelial cells

Supplemental Figure 1: Podocyte specific knockdown of Klf4 in Podocin-Cre Klf4 flox/flox mice was confirmed. (A) Primary glomerular epithelial cells Supplemental Figure 1: Podocyte specific knockdown of Klf4 in Podocin-Cre Klf4 flox/flox mice was confirmed. (A) Primary glomerular epithelial cells were isolated from 10-week old Podocin-Cre Klf4 flox/flox

More information

Dierks Supplementary Fig. S1

Dierks Supplementary Fig. S1 Dierks Supplementary Fig. S1 ITK SYK PH TH K42R wt K42R (kinase deficient) R29C E42K Y323F R29C E42K Y323F (reduced phospholipid binding) (enhanced phospholipid binding) (reduced Cbl binding) E42K Y323F

More information

IGF-1 promotes the development and cytotoxic activity of human NK cells regulated

IGF-1 promotes the development and cytotoxic activity of human NK cells regulated Supplementary Information for IGF-1 promotes the development and cytotoxic activity of human NK cells regulated by mir-483-3p Fang Ni 1, 2, Rui Sun 1, Binqing Fu 1, Fuyan Wang 1, Chuang Guo 1, Zhigang

More information

Yalin Emre, Magali Irla, Isabelle Dunand- Sauthier, Romain Ballet, Mehdi Meguenani, Stephane Jemelin, Christian Vesin, Walter Reith and Beat A.

Yalin Emre, Magali Irla, Isabelle Dunand- Sauthier, Romain Ballet, Mehdi Meguenani, Stephane Jemelin, Christian Vesin, Walter Reith and Beat A. Supplementary information Thymic epithelial cell expansion through matricellular protein CYR61 boosts progenitor homing and T- cell output Yalin Emre, Magali Irla, Isabelle Dunand- Sauthier, Romain Ballet,

More information

Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer

Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer SUPPLEMENTAL METHODS Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer For Celigo experiments, 0.1 ml containing 5 x 10 4 cells was seeded into 96 well plates for 30 min

More information

Quantitative Imaging of Tumor Associated Macrophages and Their Response to Therapy Using 64Cu-Labeled Macrin

Quantitative Imaging of Tumor Associated Macrophages and Their Response to Therapy Using 64Cu-Labeled Macrin Supporting Information for Quantitative Imaging of Tumor Associated Macrophages and Their Response to Therapy Using 64Cu-Labeled Macrin Hye-Yeong Kim 1,2+, Ran Li 1+, Thomas S.C. Ng 1, Gabriel Courties

More information

Nature Medicine doi: /nm.3554

Nature Medicine doi: /nm.3554 SUPPLEMENTARY FIGURES LEGENDS Supplementary Figure 1: Generation, purification and characterization of recombinant mouse IL-35 (ril-35). High-Five insect cells expressing high levels of the bicistronic

More information

Supplementary Information Supplementary Figure 1

Supplementary Information Supplementary Figure 1 Supplementary Information Supplementary Figure 1 skeletal muscle lung (5 µg) Marker (KDa) +/+ +/+ -/- -/- -/- 17 13 7 55 MG53 4 35 25 Marker (KDa) 17 13 35 7 55 25 4 Supplementary Figure 1. The full scale

More information

Supporting Information. Exploiting CD22 to Selectively Tolerize Autoantibody Producing B-cells in. Rheumatoid Arthritis

Supporting Information. Exploiting CD22 to Selectively Tolerize Autoantibody Producing B-cells in. Rheumatoid Arthritis Supporting Information Exploiting CD22 to Selectively Tolerize Autoantibody Producing B-cells in Rheumatoid Arthritis Kyle J. Bednar 1,2, Corwin M. Nycholat 3, Tadimeti S. Rao 1, James C. Paulson 2,3,

More information

Nature Immunology: doi: /ni.3101

Nature Immunology: doi: /ni.3101 Supplementary Figure 1 Generation of Plvap / mice. (a) Schematic presentation of the targeting construct as well as the wild-type and targeted Plvap alleles]. PuroR, puromycin resistance. The location

More information