The RT-qPCR analysis of selected type-i IFNs related genes, IRF7 and Oas3. The
|
|
|
- Dustin Hopkins
- 5 years ago
- Views:
Transcription
1 SUPPLEMENTARY MATERIALS AND METHODS Real time quantitative PCR The RT-qPCR analysis of selected type-i IFNs related genes, IRF7 and Oas3. The RT-qPCR was performed on the Applied Biosystems StepOne TM (Life Technologies) in 96-well format. The reactions were performed using fast SYBR Green PCR Master Mix (Life Technologies). IRF7 primer sequence, 5 -aagaccaacttccgctgtgc-3 (sense) and 5 - agcattgctgaggctcactt-3 (antisense); Oas3 primer sequence, 5 -tcattgacctcaaccatgat-3 (sense) and 5 -agatgccagggaggagtatg-3 (antisense). Primer sequences were chosen with the software Primer3 ( to detect 3 type-i IFNs related genes. The overall PCR product size was smaller than 200 bases. ELISA assay Mouse IFN-αexpression levels in sera from mice treated with irllc/sev/gm cells or irllc/sev/gm cells plus imiquimod were measured using the VeriKineTM mouse IFNα ELISA kit (PBL Interferon-Source, Piscataway, NJ).
2 In vivo experiments For prophylactic tumor vaccination assays, on day 11 before tumor challenge with parental LLC cells in the right flank, C57/BL6N mice were s.c. vaccinated with the one million of the indicated tumor vaccine cells (irllc, irllc/sev/gfp or irllc/sev/gm cells) in the left flank. Subcutaneous tumor growth was monitored with a digital caliper every 2-3 days. Flow cytometric analysis On days 2 and 4 after tumor challenge with LLC cells, TDLNs harvested from the indicated groups of mice (n=3-5) were homogenized by mincing in RPMI 1640 medium containing 10% FBS and filtered through a 100-µm cell strainer. Cells were stained with an anti-mouse CD11c antibody in combination with anti-mouse antibodies including anti-mhc class I-PE ( ) (ebioscience, San Diego, CA), anti-cd40-pe (3/23), anti-i-a/i-e-fitc (M ), or anti-ccr7-alexa488 (4B12) (all Biolegend) at a dilution of 1: for 30 min. At 24 hours after 2 nd i.p. administration of anti-mouse PDCA-1 antibody, we harvested splenocytes and treated them with ammonium chloride
3 to lyse red blood. For pdcs detection, splenocytes were stained with anti-pdca-1-apc (JF05-1C2.4.1) (Miltenyi Biotec, Bergisch Gladbach, Germany) and anti-cd11c-percpcy5.5 (N418) (ebioscience). Cells were incubated with antibodies diluted at 1:25 to 1,000 for 30 min on ice and analyzed with BD FACSCalibur flow cytometer, CellQuest software (BD Biosciences), and FlowJo software (Tree star, Ashland, OR).
4 SUPPLEMENTARY FIGURE LEGENDS Figure S1. Effective depletion of PDCA-1 + cells in mouse splenocytes. Dot plots depict PDCA-1 and CD11c expression on splenocytes in mice treated with isotype (left panel) or anti-pdca-1 antibody (right panel). Figure S2. Validation of gene expression data by quantitative real time PCR. Each column represents the relative amount of mrnas expression level of IRF7 and Oas3. Figure S3. Effects of TLR ligands on body weight changes in mice s.c. treated with LLC/SeV/GM cells. Bar graph represents mean+sem of body weight of each experimental mouse group as indicated in Fig. 4A.
5 Figure S4. Increased number of TVS-infiltrating PDCA-1 + cells in mice treated with combined irllc/sev/gm cells and imiquimod. At 6 hours after the first tumor vaccination, infiltrating lymphocytes in TVS were as indicated in Fig. 5A. Bar graphs show mean+sem of number of PDCA-1 + cells in TVS. Figure S5. Increased serum IFN-α level in mice treated with combined irllc/sev/gm cells and imiquimod. IFN-α expression levels in mice sera at 6 hours after the first tumor vaccination, were measured by ELISA. Combined data from two independent experiments with similar results are shown. Figure S6. Prophylactic tumor vaccination using irllc/sev/gm cells induced significant
6 antitumor effects in a syngeneic mouse model. On day 11 before s.c. tumor challenge with parental LLC cells in the right flank of female C57/BL6N mice, mice were s.c. inoculated with HBSS (untreated), irllc cells, irllc/sev/gfp (MOI=100) cells or irllc/sev/gm (MOI=100) cells. Statistically significant difference on day 24 after the tumor challenge is shown between mice treated with irllc/sev/gm cells and other mice groups (*P < 0.05, **P < 0.01). Figure S7. Enhanced expression levels of maturation and co-stimulatory molecules including CCR7, CD40, MHC class I, and MHC class II in tumor cells-derived GM-CSF-sensitized DCs in TDLNs Representative histograms depict MFI of CCR7, CD40, MHC class I, or MHC class II expression, in CD11c + DCs in TDLNs from indicated mouse groups collected on days 2 or 4 after tumor challenge.
Nature Biotechnology: doi: /nbt.4086
Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3
B Vehicle 1V270 (35 μg) 1V270 (100 μg) Days post tumor implantation. Vehicle 100μg 1V270 biweekly 100μg 1V270 daily
Supplemental Figure 1 A 1 1V7 (8 μg) 1 1V7 (16 μg) 8 6 4 B 1 1 8 6 4 1V7 (35 μg) 1V7 (1 μg) 5 1 15 5 1 15 C Biweekly 8 11 14 17 Days Implant SCC7 cells Daily 8 9 1 11 1 Implant SCC7 cells 1V7 i.t. treatment
Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using
Supplementary Methods Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using the Qiagen RNeasy Mini Kit, according to the manufacturer s protocol with on-column DNase digestion
Supporting Information for. Bongseo Choi, 1, Hyojin Moon, 1, Sung Joon Hong, 1 Changsik Shin, 1 Yoonkyung Do, 1 Seongho Ryu, 2,* Sebyung Kang 1,*
Supporting Information for Effective Delivery of Antigen-Encapsulin Nanoparticle Fusions to Dendritic Cells Leads to Antigen-Specific Cytotoxic T Cell Activation and Tumor Rejection Bongseo Choi, 1, Hyojin
Mayumi Egawa, Kaori Mukai, Soichiro Yoshikawa, Misako Iki, Naofumi Mukaida, Yohei Kawano, Yoshiyuki Minegishi, and Hajime Karasuyama
Immunity, Volume 38 Supplemental Information Inflammatory Monocytes Recruited to Allergic Skin Acquire an Anti-inflammatory M2 Phenotype via Basophil-Derived Interleukin-4 Mayumi Egawa, Kaori Mukai, Soichiro
Supplementary Figure 1 (Page1)
Supplementary Figure 1 (Page1) A B FSC-A 45 Fitc-A 133 APC-A 19 APC-Cy7-A 34 PE-A 45 Fitc-A FSC-A 45 Fitcs-A C 38 PE-Cy7-A 45 Fitc-A 45 Fitc-A 7AAD FSC-A Supplementary Figure 1 (Page2) D (1) (6) (2) (3)
Supplementary Methods
Supplementary Methods Mice injections. C57BL/6 female mice 6-10 weeks of age were purchased from the Jackson Laboratory. Soluble rapamycin (Sigma) was diluted in PBS and administered i.p. to mice at 1.5
15h. 24h. Blander & Medzhitov supplementary Figure 1. Apoptotic cells. Apoptotic LPS blasts 30% 32% 32% + Exogenous LPS 0.1% 31% 21% 20% 48% 60% 53%
a None Apoptotic cells Apoptotic LPS blasts 30% 32% 32% Apoptotic cells + Exogenous LPS 6h 0.1% 31% 21% 20% 48% 60% 53% 15h 0% 7% 5% 4% 30% 32% 32% 24h CD11c 0% 8% 2% 2% CFSE Blander & Medzhitov supplementary
Supplementary Figure 1. Effect of FRC-specific ablation of Myd88 on PP and mln organization.
Supplementary Figure 1 Effect of FRC-specific ablation of Myd88 on PP and mln organization. (a) PP numbers in 8 10 week old Cre-negative littermate (Ctrl) and Myd88-cKO mice (n = 11 mice; each dot represents
The presence of T cell epitopes is important for induction of antibody
The presence of T cell epitopes is important for induction of antibody responses against antigens directed to DEC25 + dendritic cells Kelly N. S. Amorim, Eline V. Rampazo, Renan Antonialli, Marcio M. Yamamoto,
Supplementary Methods Antibodies for flow cytometry Cytotoxicity assay
Supplementary Methods Antibodies for flow cytometry HLA-Cw3 and CD2 expression: LCL 72.22 cell lines were stained with anti-hla-abc-apc (clone G46-2.6, BD) or migg-apc (clone MOPC-2, BD) antibody, or with
Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.
LEGENDS TO SUPPLEMENTARY FIGURES Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.2) were stained with the antibodies oct3/4
SI Appendix. Tumor-specific CD8 + Tc9 cells are superior effector than Tc1 cells for. adoptive immunotherapy of cancers
SI Appendix Tumor-specific CD8 + Tc9 cells are superior effector than Tc1 cells for adoptive immunotherapy of cancers Yong Lu, Bangxing Hong, Haiyan Li, Yuhuan Zheng, Mingjun Zhang, Siqing Wang, Jianfei
STING-Dependent Cytosolic DNA Sensing Promotes Radiation-Induced Type I Interferon-Dependent Antitumor Immunity in Immunogenic Tumors
Immunity, Volume 41 Supplemental Information STING-Dependent Cytosolic DNA Sensing Promotes Radiation-Induced Type I Interferon-Dependent Antitumor Immunity in Immunogenic Tumors Liufu Deng, Hua Liang,
isolated from ctr and pictreated mice. Activation of effector CD4 +
Supplementary Figure 1 Bystander inflammation conditioned T reg cells have normal functional suppressive activity and ex vivo phenotype. WT Balb/c mice were treated with polyi:c (pic) or PBS (ctr) via
Supporting Information
Supporting Information of Laser Immunotherapy in Combination with Perdurable PD-1 Blocking for Treatment of Metastatic Tumor Lihua Luo, Chunqi Zhu, Hang Yin, Mengshi Jiang, Junlei Zhang, Bing Qin, Zhenyu
(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower
Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that
In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang *
In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang * Division of Hematology-Oncology, Department of Medicine, Medical University of South Carolina, Charleston,
Supplementary Material & Methods
Supplementary Material & Methods Affymetrix micro-array Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, USA). RNA concentration and quality was determined using the ND-1000 spectrophotometer
Table S1. Antibodies and recombinant proteins used in this study
Table S1. Antibodies and recombinant proteins used in this study Labeled Antibody Clone Cat. no. Streptavidin-PerCP BD Biosciences 554064 Biotin anti-mouse CD25 7D4 BD Biosciences 553070 PE anti-mouse
Interferon- -producing immature myeloid cells confer protection. against severe invasive group A Streptococcus infections. Supplementary Information
Supplementary Information Interferon- -producing immature myeloid cells confer protection against severe invasive group A Streptococcus infections Takayuki Matsumura, Manabu Ato, Tadayoshi Ikebe, Makoto
In vitro DC migration assays and DC activation. A DC line, JAWSII (ATCC, Manassas, VA) was used for in vitro experiments
Supplemental Material Supplemental Methods: In vitro DC migration assays and DC activation. A DC line, JAWSII (ATCC, Manassas, VA) was used for in vitro experiments and was maintained in -MEM (Invitrogen,
Female 6-7-week-old BALB/c mice were purchased from Japan SLC (Hamamatsu, Japan).
Supplementary materials Materials and Methods Mice Female 6-7-week-old BALB/c mice were purchased from Japan SLC (Hamamatsu, Japan). All mice were maintained under specific pathogen free conditions, and
To determine MRK-003 IC50 values, cell lines were plated in triplicate in 96-well plates at 3 x
Supplementary methods: Cellular growth assay and cell cycle analysis To determine MRK-003 IC50 values, cell lines were plated in triplicate in 96-well plates at 3 x 10 3 cells/well (except for TALL1 and
Supplementary Table S1
Primers used in RT-qPCR, ChIP and Bisulphite-Sequencing. Quantitative real-time RT-PCR primers Supplementary Table S1 gene Forward primer sequence Reverse primer sequence Product TRAIL CAACTCCGTCAGCTCGTTAGAAAG
Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating
Supplemental Figure Legend: Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating strategy for mouse MDSC. CD11b + Ly6C high Ly6G - cells are defined as M-MDSC. CD11b + Ly6C low
Supplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence
1 5 6 7 8 9 10 11 1 1 1 Supplementary Figure 1. Characterization of the POP transcriptional and post-transcriptional regulatory elements. (A) POP nucleotide sequence depicting the consensus sequence for
Marker Antibody Supplier. CD7 CD7 PE-CY 7 anti-human CD7 ebioscience, San Diego, USA
Supplementary Table 1: Flurochrome labelled antibody used Marker Antibody Supplier CD3 CD4 CD8 CD25 CD26 CD127 CCR4 CCR7 Ki67 Viability stain Alexa Fluor 700 anti-human CD3 Fluorescein isothiocyanate antihuman
Supplementary Information for Transient and Local Expression of Chemokine and Immune Checkpoint Traps to Treat Pancreatic Cancer
Supplementary Information for Transient and Local Expression of Chemokine and Immune Checkpoint Traps to Treat Pancreatic Cancer Lei Miao 1, Jingjing Li 2, Qi Liu 1,4, Richard Feng 2, Manisit Das 1, C.
Nanogel-Based Immunologically Stealth Vaccine Targets Macrophages in the Medulla of Lymph Node and Induces Potent Antitumor Immunity
Nanogel-Based Immunologically Stealth Vaccine Targets Macrophages in the Medulla of Lymph Node and Induces Potent Antitumor Immunity Daisuke Muraoka, Naozumi Harada,, Tae Hayashi, Yoshiro Tahara,, Fumiyasu
7-amino actinomycin D (7ADD) was added to all samples 10 minutes prior to analysis on the flow cytometer in order to gate 7AAD viable cells.
Antibody staining for Ho uptake analyses For HSC staining, 10 7 BM cells from Ho perfused mice were stained with biotinylated lineage antibodies (CD3, CD5, B220, CD11b, Gr-1, CD41, Ter119), anti Sca-1-PECY7,
Supplementary Materials & Methods
Supplementary Materials & Methods Mice and tumor lines. All experiments were performed using protocols approved by the University of Pennsylvania Laboratory Animal Resources (ULAR) policies and standard
Supplemental methods Supplemental figure and legend...7. Supplemental table.. 8
Supplemental Digital Content (SDC) Contents Supplemental methods..2-6 Supplemental figure and legend...7 Supplemental table.. 8 1 SDC, Supplemental Methods Flow cytometric analysis of intracellular phosphorylated
Whole Spleen Flow Cytometry Assay Cathy S. Yam *, Adeline M. Hajjar *
Whole Spleen Flow Cytometry Assay Cathy S. Yam *, Adeline M. Hajjar * Department of Comparative Medicine, University of Washington, Seattle, USA *For correspondence: csyam@u.washington.edu; hajjar@uw.edu
In vivo amelioration of endogenous anti-tumor autoantibodies via low-dose P 4 N through. the LTA4H/activin A/BAFF pathway
Supporting Information to: In vivo amelioration of endogenous anti-tumor autoantibodies via low-dose P 4 N through the LTA4H/activin A/BAFF pathway by Yu-Ling Lin, Nu-Man Tsai, Cheng-Hao Hsieh, Shu-Yi
Human Astrocytes. ohsv (MOI)
Fig. S1 ohsv treated Control Human Astrocytes 12 Cell viability percentage 1 6 4 2..1.2.3.4.5.6.7.8.9 1. ohsv (MOI) % Cell viability % Cell viability % Cell viability Fig. S2 A Established human melanoma
Autocrine Complement Inhibits IL10-Dependent T-Cell Mediated. Antitumor Immunity to Promote Tumor Progression
Supplemental Information Autocrine Complement Inhibits IL10-Dependent T-Cell Mediated Antitumor Immunity to Promote Tumor Progression Yu Wang, Sheng-Nan Sun, Qing Liu, Yang-Yang Yu, Jian Guo, Kun Wang,
Yalin Emre, Magali Irla, Isabelle Dunand- Sauthier, Romain Ballet, Mehdi Meguenani, Stephane Jemelin, Christian Vesin, Walter Reith and Beat A.
Supplementary information Thymic epithelial cell expansion through matricellular protein CYR61 boosts progenitor homing and T- cell output Yalin Emre, Magali Irla, Isabelle Dunand- Sauthier, Romain Ballet,
CD1a-autoreactive T cells are a normal component of the human αβ T cell repertoire
CDa-autoreactive T cells are a normal component of the human αβ T cell repertoire Annemieke de Jong, Victor Peña-Cruz, Tan-Yun Cheng, Rachael A. Clark, Ildiko Van Rhijn,, D. Branch Moody Division of Rheumatology,
SUPPORTING INFORMATION
Electronic Supplementary Material (ESI) for Dalton Transactions. This journal is The Royal Society of Chemistry 2015 Terbium-Based Time-Gated Förster Resonance Energy Transfer Imaging for Evaluating Protein-Protein
Supplementary Figure. S1
Supplementary Figure. S1 Supplementary Figure S1. Correlation of phagocytic ability measured with YG and YO beads. Fresh human monocytes (2 10 6 /ml) were labelled with APC conjugated anti CD14 mab alone
Single-cell suspensions of C57BL/6J splenocytes were incubated with CD5 beads
S S Single-cell suspensions of C57BL/6J splenocytes were incubated with CD5 beads (Miltenyi Biotech) and T cells were positively selected by magnetically activated cell sorting (MACS). 50x10 6 or greater
Murine in vivo CD8 + T Cell Killing Assay Myoungjoo V. Kim 1*, Weiming Ouyang 2, Will Liao 3, Michael Q. Zhang 4 and Ming O. Li 5
Murine in vivo CD8 + T Cell Killing Assay Myoungjoo V. Kim 1*, Weiming Ouyang 2, Will Liao 3, Michael Q. Zhang 4 and Ming O. Li 5 1 Department of Immunobiology, Yale University School of Medicine, New
Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM
Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM of Cx3cr1 GFP/+ mice related to Fig. 1a. MDP was defined
We designed the targeting vector in such a way that the first exon was flanked by two LoxP sites and
Mice We designed the targeting vector in such a way that the first exon was flanked by two LoxP sites and an Frt flanked neo cassette (Fig. S1A). Targeted BA1 (C57BL/6 129/SvEv) hybrid embryonic stem cells
Supplemental Figure 1
Supplemental Figure 1 A IL-12p7 (pg/ml) 7 6 4 3 2 1 Medium then TLR ligands MDP then TLR ligands Medium then TLR ligands + MDP MDP then TLR ligands + MDP B IL-12p4 (ng/ml) 1.2 1..8.6.4.2. Medium MDP Medium
Murine and Non-Human Primate Dendritic Cell Targeting Nanoparticles for In Vivo Generation of Regulatory T-Cells
Murine and Non-Human Primate Dendritic Cell Targeting Nanoparticles for In Vivo Generation of Regulatory T-Cells Sebastian O. Stead 1, Svjetlana Kireta 2, Steven James Peter McInnes 3, Francis D. Kette
SUPPLEMENTARY FIG. S2. Expression of single HLA loci in shns- and shb 2 m-transduced MKs. Expression of HLA class I antigens (HLA-ABC) as well as
Supplementary Data Supplementary Methods Flow cytometric analysis of HLA class I single locus expression Expression of single HLA loci (HLA-A and HLA-B) by shns- and shb 2 m-transduced megakaryocytes (MKs)
Supplemental Materials and Methods
Supplemental Materials and Methods 125 I-CXCL12 binding assay KG1 cells (2 10 6 ) were preincubated on ice with cold CXCL12 (1.6µg/mL corresponding to 200nM), CXCL11 (1.66µg/mL corresponding to 200nM),
Supplementary Figures
Supplementary Figures Fig. S1. Specificity of perilipin antibody in SAT compared to various organs. (A) Images of SAT at E18.5 stained with perilipin and CD31 antibody. Scale bars: 100 μm. SAT stained
Protein and transcriptome quantitation using BD AbSeq Antibody-Oligonucleotide
Protein and transcriptome quantitation using BD AbSeq Antibody-Oligonucleotide technology and the 10X Genomics Chromium Single Cell Gene Expression Solution Jocelyn G. Olvera, Brigid S. Boland, John T.
Supplementary methods. RNA isolation, cdna synthesis, and quantitative real-time PCR. Total RNAs were
Supplementary methods RNA isolation, cdna synthesis, and quantitative real-time PCR. Total RNAs were extracted from cells by using an RNeasy Mini Kit (QIAGEN) and then reverse-transcribed using the SuperScript
ab pdc Subset Phenotyping Kit
ab177772 pdc Subset Phenotyping Kit Instructions for Use A set of antibodies designed to identify pdcs and subsets of pdcs by multi-color flow cytometry. This product is for research use only and is not
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/1/494/eaak972/dc1 Supplementary Materials for Blockade of surface-bound TGF-β on regulatory T cells abrogates suppression of effector T cell function in the tumor
Supporting Information
Supporting Information Cieslewicz et al. 10.1073/pnas.1312197110 SI Results Human and mouse lesions of atherosclerosis contain both M1 and M2 macrophage phenotypes (1, 2). Previous work has suggested the
A human immunodeficiency caused by mutations in the PIK3R1 gene. Whole exome sequencing. Whole exome sequencing libraries were prepared from 3
A human immunodeficiency caused by mutations in the PIK3R1 gene. Supplementary Methods Whole exome sequencing. Whole exome sequencing libraries were prepared from 3 µg of genomic DNA extracted from total
Supplemental Table 1 Primers used in study. Human. Mouse
Supplemental Table 1 Primers used in study Human Forward primer region(5-3 ) Reverse primer region(5-3 ) RT-PCR GAPDH gagtcaacggatttggtcgt ttgattttggagggatctcg Raftlin atgggttgcggattgaacaagttaga ctgaggtataacaccaacgaatttcaggc
F4/80, CD11b, Gr-1, NK1.1, CD3, CD4, CD8 and CD19. A-antigen was detected with FITCconjugated
SDC MATERIALS AND METHODS Flow Cytometric Detection of A-Antigen Expression Single cell suspensions were prepared from bone marrow, lymph node and spleen. Peripheral blood was obtained and erythrocytes
Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail
Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail were stained with propidium iodide (PI), anti-cd45 (FITC),
Tgfb1 ACTGATACGCCTGAGTGGCT CCCTGTATTCCGTCTCCTTG. Supplemental data. Supplemental Table 1: Sequences of qpcr primers
Supplemental data Supplemental Table 1: Sequences of qpcr primers Gene Forward primer Reverse primer B2m GTGACCCTGGTCTTTCTGGT GTATGTTCGGCTTCCCATTC Ppl TTGAGACAGCAACCAGAAGC TTCAGGGTCTGGATTTCCTC Evpl TGCTTCACCACCATGTTCAA
SANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
Human skin punch biopsies were obtained under informed consent from normal healthy
SUPPLEMENTAL METHODS Acquisition of human skin specimens. Human skin punch biopsies were obtained under informed consent from normal healthy volunteers (n = 30) and psoriasis patients (n = 45) under a
Supplemental Information Inventory
Cell Stem Cell, Volume 6 Supplemental Information Distinct Hematopoietic Stem Cell Subtypes Are Differentially Regulated by TGF-β1 Grant A. Challen, Nathan C. Boles, Stuart M. Chambers, and Margaret A.
Tumor-infiltrating dendritic cells suppress nucleic acid-mediated. innate immune responses through TIM-3-HMGB1 interactions
SUPPLEMENTARY INFORMATION 8 Supplementary figures Tumor-infiltrating dendritic cells suppress nucleic acid-mediated innate immune responses through -HMG1 interactions Shigeki Chiba 1, Muhammad aghdadi
Establishing sirna assays in primary human peripheral blood lymphocytes
page 1 of 7 Establishing sirna assays in primary human peripheral blood lymphocytes This protocol is designed to establish sirna assays in primary human peripheral blood lymphocytes using the Nucleofector
Supplemental Methods Cell lines and culture
Supplemental Methods Cell lines and culture AGS, CL5, BT549, and SKBR were propagated in RPMI 64 medium (Mediatech Inc., Manassas, VA) supplemented with % fetal bovine serum (FBS, Atlanta Biologicals,
PITT ISL METHODS 1) Flow-based CTL assay 2) Gut Mucosal Processing
PITT ISL METHODS 1) Flow-based CTL assay a. Purified CD8 + T cells are co-cultured with fresh, autologous, infected CD4 + T cells at various effector/target ratios for 18 hours at 37 o C. b. Baseline percentage
Figure S1: GM-CSF upregulates CCL17 expression in in vitro-derived and ex vivo murine macrophage populations
Figure S1 A B C Figure S1: GM-CSF upregulates CCL17 expression in in vitro-derived and ex vivo murine macrophage populations (A-B) Murine bone cells were cultured in either M-CSF (5,000 U/ml) or GM-CSF
Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1
Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 a His-ORMDL3 ~ 17 His-ORMDL3 GST-ORMDL3 - + - + IPTG GST-ORMDL3 ~ b Integrated Density (ORMDL3/ -actin) 0.4 0.3 0.2 0.1
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3206 Supplementary Figure 1 Autophagy-related gene expression in murine and human intestinal tumors. (a) Representative LC3 immunostaining in colonic adenoma and adjacent non tumoral tissue
Supplementary Materials and Methods:
Supplementary Materials and Methods: Preclinical chemoprevention experimental design Mice were weighed and each mammary tumor was manually palpated and measured with digital calipers once a week from 4
DC enriched CD103. CD11b. CD11c. Spleen. DC enriched. CD11c. DC enriched. CD11c MLN
CD CD11 + CD + CD11 d g CD CD11 + CD + CD11 CD + CD11 + Events (% of max) Events (% of max) CD + CD11 Events (% of max) Spleen CLN MLN Irf fl/fl e Irf fl/fl h Irf fl/fl DC enriched CD CD11 Spleen DC enriched
Supplemental Information. Inflammatory Ly6C high Monocytes Protect. against Candidiasis through IL-15-Driven. NK Cell/Neutrophil Activation
Immunity, Volume 46 Supplemental Information Inflammatory Ly6C high Monocytes Protect against Candidiasis through IL-15-Driven NK Cell/Neutrophil Activation Jorge Domínguez-Andrés, Lidia Feo-Lucas, María
Dendritic epidermal T cells regulate skin antimicrobial barrier function
Online supplemental material Dendritic epidermal T cells regulate skin antimicrobial barrier function Amanda S. MacLeod 1, Saskia Hemmers 1,2, Olivia Garijo 1, Marianne Chabod 1, Kerri Mowen 1,2, Deborah
Quick-Spin the tetramer tubes before opening, due to the change in altitude and the low volume.
Quick-Spin the tetramer tubes before opening, due to the change in altitude and the low volume. Staining ex vivo samples with IA g7 Ins10-23 RE#3 Tetramers, from Kappler/Marrack Laboratory Howard Hughes
Supplementary Table-1: List of genes that were identically matched between the ST2 and
Supplementary data Supplementary Table-1: List of genes that were identically matched between the ST2 and ST3. Supplementary Table-2: List of genes that were differentially expressed in GD2 + cells compared
Initial genotyping of all new litters was performed by Transnetyx (Memphis,
SUPPLEMENTAL INFORMATION MURILLO ET AL. SUPPLEMENTAL EXPERIMENTAL PROCEDURES Mouse Genotyping Initial genotyping of all new litters was performed by Transnetyx (Memphis, USA). Assessment of LoxPpα recombination
Supplementary Figure 1
DOI: 1.138/ncb273 Supplementary Figure 1 a 1x DAPI field images 4x contoured cells 2µm 5µm b Tissue map Dot plot Histogram Y X antigen X DAPI antigen X Figure S1 Laser Scanning Cytometry of bone marrow
Figure S1. Correlated scfv and GFP transgene expression following F-28 CAR
SUPPLEMENTARY FIGURE LEGENDS Figure S1. Correlated scfv and GFP transgene expression following F-28 CAR transduction. T cells were lentivirally transduced to express the costimulatory F-28 CAR and 5 days
CFSE Cell Division Assay Kit
CFSE Cell Division Assay Kit Item No. 10009853 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION
Supplementary Figure 1
Supplementary Figure 1 Ex2 promotor region Cre IRES cherry pa Ex4 Ex5 Ex1 untranslated Ex3 Ex5 untranslated EYFP pa Rosa26 STOP loxp loxp Cre recombinase EYFP pa Rosa26 loxp 1 kb Interleukin-9 fate reporter
Online Supplementary Information
Online Supplementary Information NLRP4 negatively regulates type I interferon signaling by targeting TBK1 for degradation via E3 ubiquitin ligase DTX4 Jun Cui 1,4,6,7, Yinyin Li 1,5,6,7, Liang Zhu 1, Dan
MeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132
Conservation Figure S1. Schematic showing 3 UTR (top; thick black line), mir132 MRE (arrow) and nucleotide sequence conservation (vertical black lines; http://genome.ucsc.edu). a GFP mir1-1 mir132 b GFP
Supplemental Figure 1. Study flow chart.
Supplemental Figure 1. Study flow chart. 1 Supplemental Figure 2. Histograms represent fold changes of mir-22 in HL-1 cells. Vehicle-treated (gray) or sildenafil-treated (black b) cells. Results are expressed
Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,
Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time
efluor Organic Dyes 450/50 BP Fluorescence Intensity Wavelength (nm)
efluor Organic Dyes efluor Organic Dyes Catalog No. Description Clone Application Anti-Mouse efluor 450 Products 48-0042 Anti-mouse CD4 RM4-5 Flow Cytometry 48-0081 Anti-mouse CD8 53-6.7 Flow Cytometry
Single cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor
SUPPLEMENTARY INFORMATION Single cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor Anna Turetsky 1,a, Eunha Kim 1,a, Rainer H. Kohler 1, Miles A. Miller 1, Ralph Weissleder 1,2,
Generation of mouse BMDCs Vectors Short hairpin RNA constructs cdna constructs and generation of stable cell lines
Generation of mouse BMDCs Mouse BMDCs were differentiated from BM cells isolated from femur and tibiae of the hind legs. Cell suspensions were filtered through a 40 µm cell strainer and incubated for 2
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 Validation of the monoclonal antibody to mouse ACKR1 and expression of ACKR1 by BM hematopoietic cells. (a to d) Comparison of immunostaining of BM cells by anti-mouse ACKR1 antibodies:
Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and
Determining positive selection gates for LRCs and nonlrcs Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and shape of the Gaussian distributions. For
0.5% Triton X-100 for 5 min at room temperature. Fixed and permeabilized cells were
1 Supplementary Methods Immunohistochemistry EBC-1 cells were fixed in 4% paraformaldehyde for 15 min at room temperature, followed by 0.5% Triton X-100 for 5 min at room temperature. Fixed and permeabilized
Primer Name Sequence (Forward) Sequence (Reverse) GAPDH GAGTCAACGGATTTGGTCGT GACAAGCTTCCCGTTCTCAG ORF73/LANA CCTGGAAGTCCCACAGTGTT AGACACAGGATGGGATGGAG
Supplemental Information: RNA Isolation and Quantitative real-time RT-PCR Total RNA isolation and quantitative real-time RT-PCR (qrt-pcr) were performed as previously reported 1. The primers sets used
Supplementary Figure 1. Phenotype, morphology and distribution of embryonic GFP +
Supplementary Figure 1 Supplementary Figure 1. Phenotype, morphology and distribution of embryonic GFP + haematopoietic cells in the intestine. GFP + cells from E15.5 intestines were obtained after collagenase
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION ARTICLE NUMBER: 16108 DOI: 10.1038/NMICROBIOL.2016.108 The binary toxin CDT enhances Clostridium difficile virulence by suppressing protective colonic eosinophilia Carrie A. Cowardin,
TRIM31 is recruited to mitochondria after infection with SeV.
Supplementary Figure 1 TRIM31 is recruited to mitochondria after infection with SeV. (a) Confocal microscopy of TRIM31-GFP transfected into HEK293T cells for 24 h followed with SeV infection for 6 h. MitoTracker
BmDCs were generated as described by a modified protocol of Inaba et al S1. Briefly, bone
Generation and culture of bone marrow-derived dendritic cells (bmdcs) BmDCs were generated as described by a modified protocol of Inaba et al S1. Briefly, bone marrow cells from murine tibias and femurs
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/4/9/eaat5401/dc1 Supplementary Materials for GLK-IKKβ signaling induces dimerization and translocation of the AhR-RORγt complex in IL-17A induction and autoimmune
Supplementary Information
1 2 Supplementary Information 3 4 5 6 7 8 Supplementary Figure 1. Loading of R837 into PLGA nanoparticles. The loading efficiency (a) and loading capacity (b) of R837 by PLGA nanoparticles obtained at
Flow Cytometry SOP: Monocytes from Frozen Cells
Flow Cytometry SOP: Monocytes from Frozen Cells Purpose This SOP standardizes the procedure for measuring immune cells using flow cytometry in ACTG Immunology Laboratories. Materials 1. 12x75mm flow tubes
MagniSort Mouse Hematopoietic Lineage Depletion Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures.
Page 1 of 2 MagniSort Mouse Hematopoietic Lineage Depletion Kit RUO: For Research Use Only. Not for use in diagnostic procedures. Mouse bone marrow cells were unsorted (top row) or sorted with the MagniSort